ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet42f03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC096845.2| Takifugu rubripes clone 214J14, complete sequence 44 0.33
2dbj|AK143030.1| Mus musculus 0 day neonate lung cDNA, RIKEN full... 44 0.33
3gb|AC152939.2| Mus musculus BAC clone RP23-312I2 from chromosome... 44 0.33
4gb|AC149607.6| Mus musculus BAC clone RP23-455C13 from chromosom... 44 0.33
5gb|AC130815.4| Mus musculus BAC clone RP23-19E7 from 16, complet... 44 0.33
6gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 42 1.3
7gb|AC090007.8| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP... 42 1.3
8gb|AC099573.15| Mus musculus chromosome 7, clone RP23-28E6, comp... 42 1.3
9gb|AC141020.2| Rattus norvegicus BAC CH230-497A18 (Children's H... 42 1.3
10emb|AL929547.13| Mouse DNA sequence from clone RP23-180L23 on ch... 42 1.3
11gb|AC151899.7| Mus musculus BAC clone RP24-170L4 from chromosome... 42 1.3
12gb|AF214008.1|AF214008 Brassica napus cytochrome p450-dependent ... 42 1.3
13gb|AF214007.1|AF214007 Brassica napus cytochrome p450-dependent ... 42 1.3
14gb|AC167566.1| Mus musculus BAC clone RP24-84B10 from chromosome... 42 1.3
15gb|AC138368.8| Mus musculus chromosome 8, clone RP23-328F4, comp... 42 1.3
16ref|NM_119790.2| Arabidopsis thaliana FAH1 (FERULATE-5-HYDROXYLA... 40 5.2
17gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosom... 40 5.2
18gb|AC161246.2| Mus musculus BAC clone RP24-421E18 from chromosom... 40 5.2
19gb|AC121982.3| Mus musculus BAC clone RP24-291D6 from chromosome... 40 5.2
20emb|AL390793.9| Human DNA sequence from clone RP13-192B13 on chr... 40 5.2
21gb|AC162856.2| Mus musculus chromosome 8, clone RP23-51I4, compl... 40 5.2
22emb|AL161589.2|ATCHRIV85 Arabidopsis thaliana DNA chromosome 4, ... 40 5.2
23emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, B... 40 5.2
24emb|AJ295585.1|ATH295585 Arabidopsis thaliana fah1 gene for feru... 40 5.2
25emb|AJ295584.1|ATH295584 Arabidopsis thaliana fah1 gene for feru... 40 5.2
26emb|AJ295583.1|ATH295583 Arabidopsis thaliana fah1 gene for feru... 40 5.2
27emb|AJ295582.1|ATH295582 Arabidopsis thaliana fah1 gene for feru... 40 5.2
28emb|AJ295581.1|ATH295581 Arabidopsis thaliana fah1 gene for feru... 40 5.2
29emb|AJ295579.1|ATH295579 Arabidopsis thaliana fah1 gene for feru... 40 5.2
30emb|AJ295578.1|ATH295578 Arabidopsis thaliana fah1 gene for feru... 40 5.2
31emb|AJ295569.1|ATH295569 Arabidopsis thaliana fah1 gene for feru... 40 5.2
32emb|AJ295568.1|ATH295568 Arabidopsis thaliana fah1 gene for feru... 40 5.2
33emb|AJ295567.1|ATH295567 Arabidopsis thaliana fah1 gene for feru... 40 5.2
34emb|AJ295566.1|ATH295566 Arabidopsis thaliana fah1 gene for feru... 40 5.2
35gb|AC116675.11| Mus musculus chromosome 8, clone RP23-16M20, com... 40 5.2
36gb|AC154879.10| Mus musculus chromosome 1, clone RP24-276N20, co... 40 5.2
37emb|CR523451.1| Gallus gallus finished cDNA, clone ChEST983b18 40 5.2
38emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on ch... 40 5.2
39gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosom... 40 5.2
40emb|AL731647.13| Mouse DNA sequence from clone RP23-226L1 on chr... 40 5.2
41emb|BX936290.16| Zebrafish DNA sequence from clone DKEY-188L8 in... 40 5.2
42gb|AF068574.1|AF068574 Arabidopsis thaliana ferulate-5-hydroxyla... 40 5.2
43dbj|AP003559.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.2
44gb|U38416.1|ATU38416 Arabidopsis thaliana ferulate-5-hydroxylase... 40 5.2
45gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, comple... 40 5.2
46dbj|AP003108.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.2 
>gb|AC096845.2| Takifugu rubripes clone 214J14, complete sequence
          Length = 134105

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 94     gatggggtaattaatattataa 115
              ||||||||||||||||||||||
Sbjct: 104017 gatggggtaattaatattataa 104038
to top
>dbj|AK143030.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
           library, clone:E030046D21 product:hypothetical protein,
           full insert sequence
          Length = 2833

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 3   tgtatatttgtgtaccacatgt 24
           ||||||||||||||||||||||
Sbjct: 978 tgtatatttgtgtaccacatgt 999
to top
>gb|AC152939.2| Mus musculus BAC clone RP23-312I2 from chromosome 7, complete sequence
          Length = 205980

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 3      tgtatatttgtgtaccacatgt 24
              ||||||||||||||||||||||
Sbjct: 180869 tgtatatttgtgtaccacatgt 180848
to top
>gb|AC149607.6| Mus musculus BAC clone RP23-455C13 from chromosome 7, complete sequence
          Length = 206284

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 3      tgtatatttgtgtaccacatgt 24
              ||||||||||||||||||||||
Sbjct: 127927 tgtatatttgtgtaccacatgt 127948
to top
>gb|AC130815.4| Mus musculus BAC clone RP23-19E7 from 16, complete sequence
          Length = 195188

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 3     tgtatatttgtgtaccacatgt 24
             ||||||||||||||||||||||
Sbjct: 57702 tgtatatttgtgtaccacatgt 57723
to top
>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 103     attaatattataaaggacatg 123
               |||||||||||||||||||||
Sbjct: 1408714 attaatattataaaggacatg 1408734
to top
>gb|AC090007.8| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-156J8, complete
              sequence
          Length = 188802

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 3      tgtatatttgtgtaccacatgtttg 27
              ||||||| |||||||||||||||||
Sbjct: 175656 tgtatatatgtgtaccacatgtttg 175680
to top
>gb|AC099573.15| Mus musculus chromosome 7, clone RP23-28E6, complete sequence
          Length = 212811

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 95   atggggtaattaatattataa 115
            |||||||||||||||||||||
Sbjct: 2491 atggggtaattaatattataa 2511
to top
>gb|AC141020.2| Rattus norvegicus  BAC CH230-497A18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 168022

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 3      tgtatatttgtgtaccacatgtttg 27
              ||||| |||||||||||||||||||
Sbjct: 113000 tgtatgtttgtgtaccacatgtttg 112976
to top
>emb|AL929547.13| Mouse DNA sequence from clone RP23-180L23 on chromosome 11 Contains
            part of a novel gene and a CpG island, complete sequence
          Length = 218414

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 4    gtatatttgtgtaccacatgt 24
            |||||||||||||||||||||
Sbjct: 2715 gtatatttgtgtaccacatgt 2695
to top
>gb|AC151899.7| Mus musculus BAC clone RP24-170L4 from chromosome 7, complete sequence
          Length = 168239

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 95     atggggtaattaatattataa 115
              |||||||||||||||||||||
Sbjct: 128006 atggggtaattaatattataa 127986
to top
>gb|AF214008.1|AF214008 Brassica napus cytochrome p450-dependent monooxygenase (BNF5H2) mRNA,
            complete cds
          Length = 1884

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 185  gtcgctcatgtcgagctctgttggtttcatgccatcgggta 225
            ||||||||| || |||||  |||||||||||||||| ||||
Sbjct: 1539 gtcgctcatatcaagctcgcttggtttcatgccatcaggta 1499
to top
>gb|AF214007.1|AF214007 Brassica napus cytochrome p450-dependent monooxygenase (BNF5H1) mRNA,
            complete cds
          Length = 1880

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 185  gtcgctcatgtcgagctctgttggtttcatgccatcgggta 225
            ||||||||| || |||||  |||||||||||||||| ||||
Sbjct: 1526 gtcgctcatatcaagctcgcttggtttcatgccatcaggta 1486
to top
>gb|AC167566.1| Mus musculus BAC clone RP24-84B10 from chromosome 14, complete sequence
          Length = 187792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 2     gtgtatatttgtgtaccacat 22
             |||||||||||||||||||||
Sbjct: 90824 gtgtatatttgtgtaccacat 90844
to top
>gb|AC138368.8| Mus musculus chromosome 8, clone RP23-328F4, complete sequence
          Length = 204091

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 3     tgtatatttgtgtaccacatgtttg 27
             ||||||| |||||||||||||||||
Sbjct: 74615 tgtatatatgtgtaccacatgtttg 74639
to top
>ref|NM_119790.2| Arabidopsis thaliana FAH1 (FERULATE-5-HYDROXYLASE 1); ferulate
            5-hydroxylase AT4G36220 (FAH1) mRNA, complete cds
          Length = 1819

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1499 tcatgtcgagctcacttggtttcatcccatcaggta 1464
to top
>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete
             sequence
          Length = 206486

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 2     gtgtatatttgtgtaccacatgtttgta 29
             |||||||| |||||||||||||| ||||
Sbjct: 85989 gtgtatatatgtgtaccacatgtgtgta 85962
to top
>gb|AC161246.2| Mus musculus BAC clone RP24-421E18 from chromosome 9, complete sequence
          Length = 201524

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tgtatatttgtgtaccacat 22
              ||||||||||||||||||||
Sbjct: 190092 tgtatatttgtgtaccacat 190111
to top
>gb|AC121982.3| Mus musculus BAC clone RP24-291D6 from chromosome 6, complete sequence
          Length = 167409

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 354    tccacccccttggcttccccatct 377
              |||||| |||||||||||||||||
Sbjct: 114572 tccaccaccttggcttccccatct 114549
to top
>emb|AL390793.9| Human DNA sequence from clone RP13-192B13 on chromosome X, complete
             sequence
          Length = 85382

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   cacccccttggcttccccat 375
             ||||||||||||||||||||
Sbjct: 59803 cacccccttggcttccccat 59822
to top
>gb|AC162856.2| Mus musculus chromosome 8, clone RP23-51I4, complete sequence
          Length = 247161

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     tgtatatttgtgtaccacat 22
             ||||||||||||||||||||
Sbjct: 72707 tgtatatttgtgtaccacat 72688
to top
>emb|AL161589.2|ATCHRIV85 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 85
          Length = 198750

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 190   tcatgtcgagctctgttggtttcatgccatcgggta 225
             |||||||||||||  |||||||||| ||||| ||||
Sbjct: 18972 tcatgtcgagctcacttggtttcatcccatcaggta 19007
to top
>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
             project)
          Length = 94695

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 190   tcatgtcgagctctgttggtttcatgccatcgggta 225
             |||||||||||||  |||||||||| ||||| ||||
Sbjct: 42251 tcatgtcgagctcacttggtttcatcccatcaggta 42286
to top
>emb|AJ295585.1|ATH295585 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            WS-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916
to top
>emb|AJ295584.1|ATH295584 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            MR-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916
to top
>emb|AJ295583.1|ATH295583 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            KAS-1 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916
to top
>emb|AJ295582.1|ATH295582 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            ITA-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916
to top
>emb|AJ295581.1|ATH295581 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CVI-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916
to top
>emb|AJ295579.1|ATH295579 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            PER-1 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>emb|AJ295578.1|ATH295578 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CHA-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>emb|AJ295569.1|ATH295569 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            COL-2 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>emb|AJ295568.1|ATH295568 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            LA-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>emb|AJ295567.1|ATH295567 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            YO-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>emb|AJ295566.1|ATH295566 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CAN-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921
to top
>gb|AC116675.11| Mus musculus chromosome 8, clone RP23-16M20, complete sequence
          Length = 214196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      tgtatatttgtgtaccacat 22
              ||||||||||||||||||||
Sbjct: 131191 tgtatatttgtgtaccacat 131172
to top
>gb|AC154879.10| Mus musculus chromosome 1, clone RP24-276N20, complete sequence
          Length = 199527

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    ttgtgtaccacatgtttgta 29
             ||||||||||||||||||||
Sbjct: 79328 ttgtgtaccacatgtttgta 79347
to top
>emb|CR523451.1| Gallus gallus finished cDNA, clone ChEST983b18
          Length = 1508

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 312 cctgaaccgaacgacaataa 331
           ||||||||||||||||||||
Sbjct: 879 cctgaaccgaacgacaataa 860
to top
>emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on chromosome 3, complete
             sequence
          Length = 180483

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     gtgtatatttgtgtaccaca 21
             ||||||||||||||||||||
Sbjct: 85084 gtgtatatttgtgtaccaca 85065
to top
>gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosome 17, complete
            sequence
          Length = 176161

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  taatattataaaggacatgt 124
            ||||||||||||||||||||
Sbjct: 8092 taatattataaaggacatgt 8073
to top
>emb|AL731647.13| Mouse DNA sequence from clone RP23-226L1 on chromosome X, complete
              sequence
          Length = 185319

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      tgtatatttgtgtaccacat 22
              ||||||||||||||||||||
Sbjct: 124418 tgtatatttgtgtaccacat 124399
to top
>emb|BX936290.16| Zebrafish DNA sequence from clone DKEY-188L8 in linkage group 22,
             complete sequence
          Length = 79381

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   attaatattataaaggacat 122
             ||||||||||||||||||||
Sbjct: 48741 attaatattataaaggacat 48722
to top
>gb|AF068574.1|AF068574 Arabidopsis thaliana ferulate-5-hydroxylase (F5H) gene, complete cds
          Length = 8700

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 4442 tcatgtcgagctcacttggtttcatcccatcaggta 4407
to top
>dbj|AP003559.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-794G24, complete
             sequence
          Length = 181439

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   gatccacccccttggcttcc 371
             ||||||||||||||||||||
Sbjct: 65365 gatccacccccttggcttcc 65346
to top
>gb|U38416.1|ATU38416 Arabidopsis thaliana ferulate-5-hydroxylase (FAH1) mRNA, complete cds
          Length = 1838

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 190  tcatgtcgagctctgttggtttcatgccatcgggta 225
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1499 tcatgtcgagctcacttggtttcatcccatcaggta 1464
to top
>gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, complete sequence
          Length = 143838

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 354  tccacccccttggcttccccatct 377
            |||||| |||||||||||||||||
Sbjct: 3910 tccaccaccttggcttccccatct 3887
to top
>dbj|AP003108.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-286N22, complete
              sequence
          Length = 209572

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 352    gatccacccccttggcttcc 371
              ||||||||||||||||||||
Sbjct: 143699 gatccacccccttggcttcc 143680


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,751,281
Number of Sequences: 3902068
Number of extensions: 2751281
Number of successful extensions: 51416
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51339
Number of HSP's gapped (non-prelim): 77
length of query: 387
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 365
effective length of database: 17,147,199,772
effective search space: 6258727916780
effective search space used: 6258727916780
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top