ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet40c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT018300.1| Zea mays clone EL01T0206D10.c mRNA sequence 58 1e-05
2gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 42 0.85
3gb|AC109276.12| Mus musculus chromosome 1, clone RP23-461J11, co... 42 0.85
4ref|XM_954818.1| Neurospora crassa OR74A hypothetical protein (N... 42 0.85
5ref|XM_331042.1| Neurospora crassa OR74A hypothetical protein (N... 42 0.85
6gb|AE014075.1| Escherichia coli CFT073, complete genome 42 0.85
7gb|CP000243.1| Escherichia coli UTI89, complete genome 42 0.85
8emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clon... 42 0.85
9gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 42 0.85
10gb|AY973631.1| Oncidium Gower Ramsey phytoene synthase mRNA, com... 40 3.4
11gb|DQ011154.1| Monkeypox virus strain Congo_2003_358, complete g... 40 3.4
12gb|AY496865.1| Oncidium cv. 'Gower Ramsey' phytoene synthase (PS... 40 3.4
13gb|AC020593.6| Homo sapiens BAC clone RP11-317G22 from 4, comple... 40 3.4
14gb|AC127684.5| Mus musculus BAC clone RP24-171J12 from chromosom... 40 3.4
15gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cance... 40 3.4

>gb|BT018300.1| Zea mays clone EL01T0206D10.c mRNA sequence
          Length = 828

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 ggacgagctcactcttcgtcctcactgattagcgcaaacgagaatggtgcgaacttgtaa 255
           |||||| |||| ||||| |||||||  || ||||||||  ||||||| ||||||||||||
Sbjct: 502 ggacgatctcaatcttcttcctcacgaatcagcgcaaagtagaatggggcgaacttgtaa 443

                
Query: 256 ccatc 260
           |||||
Sbjct: 442 ccatc 438



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 36      tacccttcgtgtaatccacat 56
               |||||||||||||||||||||
Sbjct: 2851603 tacccttcgtgtaatccacat 2851623



to top

>gb|AC109276.12| Mus musculus chromosome 1, clone RP23-461J11, complete sequence
          Length = 173589

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 95    aggggctggggttttatgatt 115
             |||||||||||||||||||||
Sbjct: 47452 aggggctggggttttatgatt 47472



to top

>ref|XM_954818.1| Neurospora crassa OR74A hypothetical protein (NCU02267.1) partial
           mRNA
          Length = 1821

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 142 ggcaacaaggccacccgcaag 162
           |||||||||||||||||||||
Sbjct: 183 ggcaacaaggccacccgcaag 163



to top

>ref|XM_331042.1| Neurospora crassa OR74A hypothetical protein (NCU02267.1) partial
           mRNA
          Length = 1821

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 142 ggcaacaaggccacccgcaag 162
           |||||||||||||||||||||
Sbjct: 183 ggcaacaaggccacccgcaag 163



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 36      tacccttcgtgtaatccacat 56
               |||||||||||||||||||||
Sbjct: 3161371 tacccttcgtgtaatccacat 3161391



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 36      tacccttcgtgtaatccacat 56
               |||||||||||||||||||||
Sbjct: 3040344 tacccttcgtgtaatccacat 3040364



to top

>emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clone B13D24
          Length = 107482

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   ggcaacaaggccacccgcaag 162
             |||||||||||||||||||||
Sbjct: 43798 ggcaacaaggccacccgcaag 43778



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 36      tacccttcgtgtaatccacat 56
               |||||||||||||||||||||
Sbjct: 2846307 tacccttcgtgtaatccacat 2846327



to top

>gb|AY973631.1| Oncidium Gower Ramsey phytoene synthase mRNA, complete cds
          Length = 1383

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 182 agatacaagaatttggacgagctc 205
           |||||||||||||| |||||||||
Sbjct: 737 agatacaagaatttcgacgagctc 760



to top

>gb|DQ011154.1| Monkeypox virus strain Congo_2003_358, complete genome
          Length = 197195

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 48    aatccacatctaaagaaaaatgat 71
             |||| |||||||||||||||||||
Sbjct: 33380 aatcaacatctaaagaaaaatgat 33403



to top

>gb|AY496865.1| Oncidium cv. 'Gower Ramsey' phytoene synthase (PSY) mRNA, complete
           cds
          Length = 1576

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 182 agatacaagaatttggacgagctc 205
           |||||||||||||| |||||||||
Sbjct: 781 agatacaagaatttcgacgagctc 804



to top

>gb|AC020593.6| Homo sapiens BAC clone RP11-317G22 from 4, complete sequence
          Length = 184206

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     acatctaaagaaaaatgatg 72
              ||||||||||||||||||||
Sbjct: 163750 acatctaaagaaaaatgatg 163731



to top

>gb|AC127684.5| Mus musculus BAC clone RP24-171J12 from chromosome 6, complete sequence
          Length = 178299

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    acatctaaagaaaaatgatg 72
             ||||||||||||||||||||
Sbjct: 26172 acatctaaagaaaaatgatg 26191



to top

>gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 152539

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     acatctaaagaaaaatgatg 72
              ||||||||||||||||||||
Sbjct: 127355 acatctaaagaaaaatgatg 127374


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,117,197
Number of Sequences: 3902068
Number of extensions: 2117197
Number of successful extensions: 34747
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34701
Number of HSP's gapped (non-prelim): 46
length of query: 260
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 238
effective length of database: 17,147,199,772
effective search space: 4081033545736
effective search space used: 4081033545736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top