| Clone Name | rbaet39d10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|L37070.1|WHTHSP169L Triticum aestivum clone 17LC3 heat shock protein 16.9 (hsp16.9-17LC3) mRNA, partial cds Length = 440 Score = 69.9 bits (35), Expect = 6e-09 Identities = 64/74 (86%), Gaps = 6/74 (8%) Strand = Plus / Plus Query: 142 gtagcactaaatgaacaaaccggaagcgagtggcttcatcgac------acaaccttgat 195 |||| ||||||||||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 294 gtagtactaaatgaacaaacaggaagcgactggcttcatcgaccgaacaacaaccttgat 353 Query: 196 ttcaaactcgtggc 209 |||||||| ||||| Sbjct: 354 ttcaaacttgtggc 367 Score = 63.9 bits (32), Expect = 3e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 257 ggacggacggacggatcaggcgcaggtgtatcccggcggcacgg 300 |||||||||| ||||||||||||||||||| ||||| ||||||| Sbjct: 390 ggacggacgggcggatcaggcgcaggtgtagcccgggggcacgg 433
>gb|AY105945.1| Zea mays PCO115682 mRNA sequence Length = 947 Score = 67.9 bits (34), Expect = 2e-08 Identities = 75/88 (85%), Gaps = 3/88 (3%) Strand = Plus / Minus Query: 291 ggcggcacggcgcagccgcagtcgttgacaagcagctggagggcgaggggcacgtagagg 350 ||||| |||||||||||||||| |||| |||| || ||| |||| ||||||||||| | Sbjct: 631 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 575 Query: 351 gcgaggttgagcaccttggccttgatgg 378 | || || |||||||||||||||||||| Sbjct: 574 gagatgtcgagcaccttggccttgatgg 547
>ref|XM_474092.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 783 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 781 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 725 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 724 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 680
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Plus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 32827138 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 32827194 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 32827195 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 32827239
>dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F11, full insert sequence Length = 1255 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 931 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 875 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 874 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 830
>dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F10, full insert sequence Length = 1242 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 931 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 875 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 874 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 830
>dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H11, full insert sequence Length = 1251 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 927 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 871 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 870 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 826
>dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094H13, full insert sequence Length = 1272 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 935 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 879 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 878 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 834
>dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F03, full insert sequence Length = 1257 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 933 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 877 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 876 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 832
>emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0413E07, complete sequence Length = 76546 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Plus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 22373 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 22429 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 22430 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 22474
>emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G05, complete sequence Length = 142556 Score = 54.0 bits (27), Expect = 3e-04 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Plus Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333 ||||||||||||| || ||||| ||| |||||||||||| |||| || |||| ||| | Sbjct: 89424 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 89480 Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378 ||| ||| | ||||| | || || |||||||||||||||||||| Sbjct: 89481 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 89525
>gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210923 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 255 acggacggacggacggatcagg 276 |||||||||||||||||||||| Sbjct: 171016 acggacggacggacggatcagg 170995
>gb|AC160060.20| Mus musculus 10 BAC RP23-360L4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 229681 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 255 acggacggacggacggatcagg 276 |||||||||||||||||||||| Sbjct: 70676 acggacggacggacggatcagg 70655
>gb|DQ393975.1| Cydia pomonella clone Cp4.161 microsatellite sequence Length = 422 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 255 acggacggacggacggatcag 275 ||||||||||||||||||||| Sbjct: 113 acggacggacggacggatcag 93
>ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase (DDB0231482), partial mRNA Length = 1770 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 acaaatcttacaagatttca 97 |||||||||||||||||||| Sbjct: 339 acaaatcttacaagatttca 358
>ref|NM_194617.1| Oryza sativa (japonica cultivar-group) putative G-protein (OSJNBa0023I19.15), mRNA Length = 1752 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccggcggcacggcgcagccg 308 |||||||||||||||||||| Sbjct: 256 ccggcggcacggcgcagccg 237
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccggcggcacggcgcagccg 308 |||||||||||||||||||| Sbjct: 1104096 ccggcggcacggcgcagccg 1104077
>emb|AL807799.5| Zebrafish DNA sequence from clone CH211-257P7 in linkage group 2, complete sequence Length = 175342 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 ggaacggacggacggacgga 271 |||||||||||||||||||| Sbjct: 123816 ggaacggacggacggacgga 123797
>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8, complete sequence Length = 137166 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 253 gaacggacggacggacggat 272 |||||||||||||||||||| Sbjct: 63584 gaacggacggacggacggat 63603
>gb|AC079037.3| Oryza sativa chromosome 10 clone OSJNBa0023I19, complete sequence Length = 157450 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccggcggcacggcgcagccg 308 |||||||||||||||||||| Sbjct: 101549 ccggcggcacggcgcagccg 101530
>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21, complete sequence Length = 153142 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 ggaacggacggacggacgga 271 |||||||||||||||||||| Sbjct: 66734 ggaacggacggacggacgga 66715
>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206191 Score = 40.1 bits (20), Expect = 5.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 55 caccttccatagccactggatatacaaa 82 |||||||||||||||||| |||||||| Sbjct: 41677 caccttccatagccactgtgtatacaaa 41650
>gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162273 Score = 40.1 bits (20), Expect = 5.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 55 caccttccatagccactggatatacaaa 82 |||||||||||||||||| |||||||| Sbjct: 153678 caccttccatagccactgtgtatacaaa 153651
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccggcggcacggcgcagccg 308 |||||||||||||||||||| Sbjct: 1104096 ccggcggcacggcgcagccg 1104077
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 aacggacggacggacggatc 273 |||||||||||||||||||| Sbjct: 33695616 aacggacggacggacggatc 33695597
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 gctggagggcgaggggcacg 344 |||||||||||||||||||| Sbjct: 781004 gctggagggcgaggggcacg 780985
>emb|AL840636.10| Zebrafish DNA sequence from clone CH211-262K7 in linkage group 20, complete sequence Length = 174999 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 ggaacggacggacggacgga 271 |||||||||||||||||||| Sbjct: 123472 ggaacggacggacggacgga 123453
>emb|BX842600.1| Neurospora crassa DNA linkage group II BAC clone B15P20 Length = 74452 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 253 gaacggacggacggacggat 272 |||||||||||||||||||| Sbjct: 73734 gaacggacggacggacggat 73753
>dbj|AP004054.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1249_F12 Length = 133205 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 aacggacggacggacggatc 273 |||||||||||||||||||| Sbjct: 64023 aacggacggacggacggatc 64004
>dbj|AP005115.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0700F06 Length = 139277 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 aacggacggacggacggatc 273 |||||||||||||||||||| Sbjct: 26483 aacggacggacggacggatc 26464
>emb|AL929281.7| Zebrafish DNA sequence from clone CH211-237I22, complete sequence Length = 148678 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 252 ggaacggacggacggacgga 271 |||||||||||||||||||| Sbjct: 124799 ggaacggacggacggacgga 124818
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccggcggcacggcgcagccg 308 |||||||||||||||||||| Sbjct: 1104093 ccggcggcacggcgcagccg 1104074 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,783,238 Number of Sequences: 3902068 Number of extensions: 2783238 Number of successful extensions: 68154 Number of sequences better than 10.0: 32 Number of HSP's better than 10.0 without gapping: 32 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67890 Number of HSP's gapped (non-prelim): 263 length of query: 378 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 356 effective length of database: 17,147,199,772 effective search space: 6104403118832 effective search space used: 6104403118832 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)