>gb|L37070.1|WHTHSP169L Triticum aestivum clone 17LC3 heat shock protein 16.9
           (hsp16.9-17LC3) mRNA, partial cds
          Length = 440

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 64/74 (86%), Gaps = 6/74 (8%)
 Strand = Plus / Plus

                                                                       
Query: 142 gtagcactaaatgaacaaaccggaagcgagtggcttcatcgac------acaaccttgat 195
           |||| ||||||||||||||| |||||||| |||||||||||||      |||||||||||
Sbjct: 294 gtagtactaaatgaacaaacaggaagcgactggcttcatcgaccgaacaacaaccttgat 353

                         
Query: 196 ttcaaactcgtggc 209
           |||||||| |||||
Sbjct: 354 ttcaaacttgtggc 367



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 257 ggacggacggacggatcaggcgcaggtgtatcccggcggcacgg 300
           |||||||||| ||||||||||||||||||| ||||| |||||||
Sbjct: 390 ggacggacgggcggatcaggcgcaggtgtagcccgggggcacgg 433

>gb|AY105945.1| Zea mays PCO115682 mRNA sequence
          Length = 947

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 75/88 (85%), Gaps = 3/88 (3%)
 Strand = Plus / Minus

                                                                       
Query: 291 ggcggcacggcgcagccgcagtcgttgacaagcagctggagggcgaggggcacgtagagg 350
           ||||| ||||||||||||||||   |||| |||| || ||| |||| ||||||||||| |
Sbjct: 631 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 575

                                       
Query: 351 gcgaggttgagcaccttggccttgatgg 378
           | || || ||||||||||||||||||||
Sbjct: 574 gagatgtcgagcaccttggccttgatgg 547

>ref|XM_474092.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 783

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 781 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 725

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 724 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 680

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Plus

                                                                            
Query: 274      aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
                ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 32827138 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 32827194

                                                             
Query: 334      cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
                ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 32827195 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 32827239

>dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F11, full
           insert sequence
          Length = 1255

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 931 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 875

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 874 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 830

>dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F10, full
           insert sequence
          Length = 1242

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 931 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 875

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 874 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 830

>dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H11, full
           insert sequence
          Length = 1251

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 927 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 871

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 870 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 826

>dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094H13, full
           insert sequence
          Length = 1272

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 935 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 879

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 878 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 834

>dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F03, full
           insert sequence
          Length = 1257

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 274 aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
           ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 933 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 877

                                                        
Query: 334 cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
           ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 876 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 832

>emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0413E07, complete
             sequence
          Length = 76546

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Plus

                                                                         
Query: 274   aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
             ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 22373 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 22429

                                                          
Query: 334   cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
             ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 22430 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 22474

>emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G05,
             complete sequence
          Length = 142556

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/105 (81%), Gaps = 3/105 (2%)
 Strand = Plus / Plus

                                                                         
Query: 274   aggcgcaggtgtatcccggcggcacggcgcagccgcagtcgttgacaagcagctggaggg 333
             ||||||||||||| || ||||| ||| ||||||||||||   |||| || |||| ||| |
Sbjct: 89424 aggcgcaggtgtagccaggcgggacgtcgcagccgcagt---tgacgaggagcttgagcg 89480

                                                          
Query: 334   cgaggggcacgtagagggcgaggttgagcaccttggccttgatgg 378
             ||| ||| | ||||| |  || || ||||||||||||||||||||
Sbjct: 89481 cgatggggatgtagatgctgatgtcgagcaccttggccttgatgg 89525

>gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 210923

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 255    acggacggacggacggatcagg 276
              ||||||||||||||||||||||
Sbjct: 171016 acggacggacggacggatcagg 170995

>gb|AC160060.20| Mus musculus 10 BAC RP23-360L4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 229681

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 255   acggacggacggacggatcagg 276
             ||||||||||||||||||||||
Sbjct: 70676 acggacggacggacggatcagg 70655

>gb|DQ393975.1| Cydia pomonella clone Cp4.161 microsatellite sequence
          Length = 422

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 255 acggacggacggacggatcag 275
           |||||||||||||||||||||
Sbjct: 113 acggacggacggacggatcag 93

>ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase (DDB0231482),
           partial mRNA
          Length = 1770

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 78  acaaatcttacaagatttca 97
           ||||||||||||||||||||
Sbjct: 339 acaaatcttacaagatttca 358

>ref|NM_194617.1| Oryza sativa (japonica cultivar-group) putative G-protein
           (OSJNBa0023I19.15), mRNA
          Length = 1752

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 289 ccggcggcacggcgcagccg 308
           ||||||||||||||||||||
Sbjct: 256 ccggcggcacggcgcagccg 237

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
               Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 289     ccggcggcacggcgcagccg 308
               ||||||||||||||||||||
Sbjct: 1104096 ccggcggcacggcgcagccg 1104077

>emb|AL807799.5| Zebrafish DNA sequence from clone CH211-257P7 in linkage group 2,
              complete sequence
          Length = 175342

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    ggaacggacggacggacgga 271
              ||||||||||||||||||||
Sbjct: 123816 ggaacggacggacggacgga 123797

>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8,
             complete sequence
          Length = 137166

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   gaacggacggacggacggat 272
             ||||||||||||||||||||
Sbjct: 63584 gaacggacggacggacggat 63603

>gb|AC079037.3| Oryza sativa chromosome 10 clone OSJNBa0023I19, complete sequence
          Length = 157450

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 289    ccggcggcacggcgcagccg 308
              ||||||||||||||||||||
Sbjct: 101549 ccggcggcacggcgcagccg 101530

>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21,
             complete sequence
          Length = 153142

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   ggaacggacggacggacgga 271
             ||||||||||||||||||||
Sbjct: 66734 ggaacggacggacggacgga 66715

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 55    caccttccatagccactggatatacaaa 82
             ||||||||||||||||||  ||||||||
Sbjct: 41677 caccttccatagccactgtgtatacaaa 41650

>gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162273

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 55     caccttccatagccactggatatacaaa 82
              ||||||||||||||||||  ||||||||
Sbjct: 153678 caccttccatagccactgtgtatacaaa 153651

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 289     ccggcggcacggcgcagccg 308
               ||||||||||||||||||||
Sbjct: 1104096 ccggcggcacggcgcagccg 1104077

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 254      aacggacggacggacggatc 273
                ||||||||||||||||||||
Sbjct: 33695616 aacggacggacggacggatc 33695597

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 325    gctggagggcgaggggcacg 344
              ||||||||||||||||||||
Sbjct: 781004 gctggagggcgaggggcacg 780985

>emb|AL840636.10| Zebrafish DNA sequence from clone CH211-262K7 in linkage group 20,
              complete sequence
          Length = 174999

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    ggaacggacggacggacgga 271
              ||||||||||||||||||||
Sbjct: 123472 ggaacggacggacggacgga 123453

>emb|BX842600.1| Neurospora crassa DNA linkage group II BAC clone B15P20
          Length = 74452

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   gaacggacggacggacggat 272
             ||||||||||||||||||||
Sbjct: 73734 gaacggacggacggacggat 73753

>dbj|AP004054.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1249_F12
          Length = 133205

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   aacggacggacggacggatc 273
             ||||||||||||||||||||
Sbjct: 64023 aacggacggacggacggatc 64004

>dbj|AP005115.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0700F06
          Length = 139277

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   aacggacggacggacggatc 273
             ||||||||||||||||||||
Sbjct: 26483 aacggacggacggacggatc 26464

>emb|AL929281.7| Zebrafish DNA sequence from clone CH211-237I22, complete sequence
          Length = 148678

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 252    ggaacggacggacggacgga 271
              ||||||||||||||||||||
Sbjct: 124799 ggaacggacggacggacgga 124818

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 289     ccggcggcacggcgcagccg 308
               ||||||||||||||||||||
Sbjct: 1104093 ccggcggcacggcgcagccg 1104074


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,783,238
Number of Sequences: 3902068
Number of extensions: 2783238
Number of successful extensions: 68154
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67890
Number of HSP's gapped (non-prelim): 263
length of query: 378
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 356
effective length of database: 17,147,199,772
effective search space: 6104403118832
effective search space used: 6104403118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)