Clone Information

BLAST Search Result

Clone Name	rbaet39b05
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|X63052.1\|HVCP29 Hordeum vulgare gene for CP29 precursor for ...	757	0.0
2	gb\|AC135460.3\| Oryza sativa (japonica cultivar-group) chromosome...	283	2e-73
3	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	283	2e-73
4	dbj\|AK104824.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	283	2e-73
5	dbj\|AK098872.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	283	2e-73
6	dbj\|AK061295.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	283	2e-73
7	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	283	2e-73
8	dbj\|D85512.1\| Oryza sativa (japonica cultivar-group) CP26 mRNA, ...	258	1e-65
9	gb\|AY105650.1\| Zea mays PCO135935 mRNA sequence	240	3e-60
10	gb\|U23188.1\|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein...	236	4e-59
11	gb\|U23189.1\|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein...	210	3e-51
12	gb\|AY855171.1\| Eleusine coracana subsp. coracana clone 1 light h...	200	2e-48
13	gb\|M12152.1\|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene...	111	2e-21
14	ref\|NM_192636.1\| Oryza sativa (japonica cultivar-group), predic...	107	3e-20
15	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
16	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
17	dbj\|AP005313.3\| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
18	dbj\|AP003278.5\| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
19	dbj\|AP005700.3\| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
20	dbj\|AK121563.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
21	dbj\|AK119173.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
22	emb\|X13909.1\|OSCABR2 Rice cab2R gene for light harvesting chloro...	107	3e-20
23	dbj\|AK104350.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
24	dbj\|AK104288.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
25	dbj\|AK104281.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
26	dbj\|AK060851.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
27	dbj\|AK058305.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
28	ref\|XM_478729.1\| Oryza sativa (japonica cultivar-group), mRNA	103	4e-19
29	ref\|XM_507374.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
30	ref\|XM_507373.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
31	ref\|XM_507372.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
32	ref\|XM_507371.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
33	ref\|XM_507370.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
34	ref\|XM_507369.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
35	ref\|XM_506410.2\| PREDICTED Oryza sativa (japonica cultivar-group...	103	4e-19
36	gb\|AC135564.4\| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom...	103	4e-19
37	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	103	4e-19
38	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	103	4e-19
39	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	103	4e-19
40	dbj\|AP004270.3\| Oryza sativa (japonica cultivar-group) genomic D...	103	4e-19
41	dbj\|AK109399.2\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
42	dbj\|AK119545.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
43	dbj\|AK119533.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
44	dbj\|AK104495.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
45	dbj\|AK104465.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
46	dbj\|AK104224.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
47	dbj\|AK103999.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
48	dbj\|AK103926.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
49	dbj\|AK066762.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
50	dbj\|AK061512.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
51	dbj\|AK058315.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	4e-19
52	gb\|AF061577.1\|AF061577 Oryza sativa chlorophyll a/b binding prot...	103	4e-19
53	dbj\|D00642.1\|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN...	103	4e-19
54	emb\|X13908.1\|OSCABR1 Rice cab1R gene for light harvesting chloro...	100	7e-18
55	gb\|BC053854.1\| Homo sapiens cDNA clone IMAGE:5194336, partial cds	100	7e-18
56	dbj\|D00641.1\|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN...	100	7e-18
57	ref\|NM_191799.1\| Oryza sativa (japonica cultivar-group), predic...	96	1e-16
58	gb\|AY100470.1\| Oryza sativa (indica cultivar-group) putative sol...	96	1e-16
59	dbj\|AB211497.1\| Lemna paucicostata LpCAB1 mRNA for CAB homologue...	96	1e-16
60	dbj\|AP003292.2\| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-16
61	emb\|X63205.1\|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin...	96	1e-16
62	emb\|X68682.1\|ZMLHCB Z.mays mRNA for type II light-harvesting chl...	96	1e-16
63	dbj\|AK104176.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
64	dbj\|AK103946.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
65	dbj\|AK068972.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
66	dbj\|AK062725.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
67	gb\|AY112240.1\| Zea mays CL187_6 mRNA sequence	96	1e-16
68	dbj\|AK058312.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
69	dbj\|AK058289.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
70	gb\|AF479779.1\| Chlamydomonas reinhardtii major light-harvesting ...	94	4e-16
71	gb\|AF479777.1\| Chlamydomonas reinhardtii major light-harvesting ...	94	4e-16
72	gb\|DQ122900.1\| Chlamydomonas incerta chloroplast light-harvestin...	94	4e-16
73	dbj\|AB051208.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	94	4e-16
74	dbj\|AB051204.1\| Chlamydomonas reinhardtii gene for light-harvest...	94	4e-16
75	dbj\|AK061619.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	92	2e-15
76	gb\|AF079590.1\|AF079590 Sorghum bicolor photosystem II type II ch...	92	2e-15
77	emb\|X12735.1\|HVCAB2 Barley Cab-2 gene for major light-harvesting...	88	3e-14
78	gb\|M29334.1\|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ...	88	3e-14
79	gb\|AF104631.3\| Chlamydomonas reinhardtii light harvesting comple...	86	1e-13
80	gb\|AF330793.1\|AF330793 Chlamydomonas reinhardtii light-harvestin...	86	1e-13
81	dbj\|AB051209.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	86	1e-13
82	dbj\|AB051205.1\| Chlamydomonas reinhardtii gene for light-harvest...	86	1e-13
83	gb\|AY171229.1\| Chlamydomonas reinhardtii light-harvesting comple...	84	4e-13
84	emb\|X14794.1\|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding...	84	4e-13
85	gb\|AF022739.1\|AF022739 Oryza sativa chlorophyll a-b binding prot...	84	4e-13
86	gb\|U74295.1\|OSU74295 Oryza sativa chlorophyll a/b binding protei...	84	4e-13
87	dbj\|AB051210.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	84	4e-13
88	gb\|AF495473.1\| Chlamydomonas reinhardtii major light-harvesting ...	82	2e-12
89	dbj\|AB051206.1\| Chlamydomonas reinhardtii gene for light-harvest...	82	2e-12
90	dbj\|AB050007.2\| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, c...	80	6e-12
91	emb\|X55892.1\|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo...	80	6e-12
92	dbj\|D00571.1\|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light...	76	1e-10
93	emb\|X14505.1\|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro...	76	1e-10
94	gb\|L23107.1\|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c...	76	1e-10
95	emb\|X61915.1\|PTCABP P.thunbergii cab gene	74	4e-10
96	gb\|M37489.1\|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p...	74	4e-10
97	gb\|AF139465.2\|AF139465 Vigna radiata LHCII type III chlorophyll ...	74	4e-10
98	gb\|U51632.1\|PPU51632 Pinus palustris type 2 light-harvesting chl...	74	4e-10
99	gb\|AY389597.1\| Hyacinthus orientalis chloroplast chlorophyll a/b...	72	1e-09
100	gb\|AY617092.1\| Pinus monophylla chloroplast light harvesting chl...	72	1e-09
101	gb\|AF104630.1\|AF104630 Chlamydomonas reinhardtii light harvestin...	72	1e-09
102	gb\|AY646197.1\| Chlorella pyrenoidosa chloroplast light-harvestin...	70	6e-09
103	gb\|AF495472.1\| Chlamydomonas reinhardtii major light-harvesting ...	70	6e-09
104	gb\|AF398746.1\|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, ...	70	6e-09
105	gb\|AF398740.1\|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B)...	70	6e-09
106	emb\|X89023.1\|HVLHCIITI H.vulgare mRNA for LHC II type I protein	70	6e-09
107	gb\|AF165529.1\|AF165529 Rumex palustris chlorophyll a/b binding p...	70	6e-09
108	gb\|U51634.1\|PPU51634 Pinus palustris type 2 light-harvesting chl...	70	6e-09
109	gb\|M24072.1\|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi...	70	6e-09
110	emb\|X53398.1\|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl...	68	2e-08
111	emb\|AJ313013.1\|PCO313013 Pinus contorta cab gene for chlorophyll...	68	2e-08
112	gb\|DQ018376.1\| Pinus krempfii chloroplast putative light harvest...	68	2e-08
113	gb\|AY617095.1\| Pinus nelsonii chloroplast light harvesting chlor...	68	2e-08
114	gb\|AY617093.1\| Pinus remota chloroplast light harvesting chlorop...	68	2e-08
115	gb\|AY617084.1\| Pinus contorta chloroplast light harvesting chlor...	68	2e-08
116	gb\|AY617083.1\| Pinus radiata chloroplast light harvesting chloro...	68	2e-08
117	gb\|AY617082.1\| Pinus ponderosa chloroplast light harvesting chlo...	68	2e-08
118	gb\|AY617081.1\| Pinus echinata chloroplast light harvesting chlor...	68	2e-08
119	emb\|X54856.1\|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi...	68	2e-08
120	emb\|X67714.1\|PCCABA P.contorta cab gene for chlorophyll a/b bind...	68	2e-08
121	gb\|AY109324.1\| Zea mays CL187_1 mRNA sequence	68	2e-08
122	gb\|U51633.1\|PPU51633 Pinus palustris type 1 light-harvesting chl...	68	2e-08
123	gb\|AF479778.1\| Chlamydomonas reinhardtii major light-harvesting ...	66	9e-08
124	gb\|AY617086.1\| Pinus roxburghii chloroplast light harvesting chl...	66	9e-08
125	gb\|AY617085.1\| Pinus merkusii chloroplast light harvesting chlor...	66	9e-08
126	gb\|S73603.1\| Pinus thunbergii chlorophyll a/b-binding protein (L...	66	9e-08
127	gb\|AF247178.1\|AF247178 Picea glauca needle chlorophyll a/b-bindi...	66	9e-08
128	emb\|X13407.1\|PTCAB Pinus thunbergii cab mRNA for light-harvestin...	66	9e-08
129	emb\|AJ309102.1\|PPI309102 Pinus pinaster partial mRNA for putativ...	66	9e-08
130	emb\|X14506.1\|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro...	66	9e-08
131	gb\|AY554168.1\| Nicotiana tabacum chloroplast chlorophyll a-b bin...	66	9e-08
132	gb\|AF017998.1\|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin...	66	9e-08
133	gb\|U73218.1\|TAU73218 Triticum aestivum chlorophyll a/b-binding p...	66	9e-08
134	gb\|AY786530.1\| Haematococcus pluvialis chloroplast major light-h...	64	4e-07
135	gb\|AY617088.1\| Pinus flexilis chloroplast light harvesting chlor...	64	4e-07
136	emb\|X06602.1\|EGLHCPAB Euglena gracilis mRNA for light harvesting...	64	4e-07
137	gb\|AF398747.1\|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gen...	62	1e-06
138	gb\|AF398745.1\|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, e...	62	1e-06
139	gb\|AF398744.1\|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons ...	62	1e-06
140	gb\|AF398743.1\|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, ex...	62	1e-06
141	gb\|AF398741.1\|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C)...	62	1e-06
142	gb\|AF398739.1\|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene,...	62	1e-06
143	gb\|AF398738.1\|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) ...	62	1e-06
144	gb\|AF398737.1\|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, e...	62	1e-06
145	gb\|AF398736.1\|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) ge...	62	1e-06
146	gb\|AF398735.1\|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) ge...	62	1e-06
147	gb\|AF398734.1\|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB...	62	1e-06
148	gb\|AF398733.1\|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB...	62	1e-06
149	gb\|AF398732.1\|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-...	62	1e-06
150	gb\|AF398731.1\|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A)...	62	1e-06
151	gb\|AF398730.1\|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) g...	62	1e-06
152	gb\|AF398729.1\|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-...	62	1e-06
153	gb\|AF398728.1\|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) ...	62	1e-06
154	gb\|AF398726.1\|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) ge...	62	1e-06
155	gb\|AF398725.1\|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) ge...	62	1e-06
156	gb\|AF398723.1\|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-...	62	1e-06
157	emb\|AJ843976.1\| Plantago major partial mRNA for light harvesting...	60	6e-06
158	gb\|DQ018375.1\| Pinus gerardiana chloroplast putative light harve...	60	6e-06
159	gb\|AY617094.1\| Pinus longaeva chloroplast light harvesting chlor...	60	6e-06
160	gb\|AY617091.1\| Pinus strobus chloroplast light harvesting chloro...	60	6e-06
161	gb\|AY617090.1\| Pinus monticola chloroplast light harvesting chlo...	60	6e-06
162	gb\|AY617089.1\| Pinus lambertiana chloroplast light harvesting ch...	60	6e-06
163	emb\|Z49749.1\|PMLHCABBP P.menziesii mRNA for light-harvesting chl...	60	6e-06
164	emb\|X81808.1\|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h...	60	6e-06
165	emb\|AJ635207.1\| Triticum durum ssp. durum partial mRNA for putat...	60	6e-06
166	dbj\|AP006706.1\| Lotus japonicus genomic DNA, chromosome 3, clone...	60	6e-06
167	gb\|U43707.1\|PAU43707 Picea abies chlorophyll a/b binding protein...	60	6e-06
168	dbj\|AB026686.1\| Physcomitrella patens mRNA for chlorophyll a/b-b...	60	6e-06
169	emb\|X54090.1\|GHCAB G.hirsutum cab gene for chlorophyll ab bindin...	58	2e-05
170	emb\|X61361.1\|EGLHCAB E.gracilis gene for light harvesting chloro...	58	2e-05
171	gb\|AY267624.1\| Bigelowiella natans chlorophyll a/b-binding prote...	58	2e-05
172	gb\|AF458406.1\|AF458406 Brassica oleracea chlorophyll a/b binding...	58	2e-05
173	emb\|AJ538464.1\|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC...	58	2e-05
174	dbj\|AB115772.1\| Physcomitrella patens subsp. patens PpLhcb2 gene...	58	2e-05
175	emb\|AJ234428.1\|HVU234428 Hordeum vulgare partial mRNA; clone cMW...	58	2e-05
176	emb\|X16647.1\|RSCHABBP Radish mRNA for chlorophyll a/b binding pr...	58	2e-05
177	emb\|X81810.1\|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig...	58	2e-05
178	emb\|X81809.1\|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh...	58	2e-05
179	gb\|L29644.1\|EGRLHCPII Euglena gracilis chlorophyll a/b binding p...	58	2e-05
180	gb\|M60049.1\|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,...	58	2e-05
181	gb\|M10144.1\|WHTCAB Wheat major chlorophyll a/b-binding protein g...	58	2e-05
182	gb\|M21397.1\|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab...	58	2e-05
183	dbj\|AB122118.1\| Chlamydomonas reinhardtii LhcI-5 gene for light-...	56	9e-05
184	gb\|AY267623.1\| Bigelowiella natans chlorophyll a/b-binding prote...	54	4e-04
185	gb\|AF398727.1\|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, e...	54	4e-04
186	gb\|AF398724.1\|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB...	54	4e-04
187	gb\|AF268321.1\|AF268321 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
188	gb\|AF268320.1\|AF268320 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
189	gb\|AF268319.1\|AF268319 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
190	emb\|X63197.1\|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p...	54	4e-04
191	gb\|AF003128.1\|AF003128 Mesembryanthemum crystallinum chlorophyll...	54	4e-04
192	gb\|AY389606.1\| Hyacinthus orientalis chloroplast chlorophyll A-B...	52	0.001
193	gb\|AY617096.1\| Picea sitchensis chloroplast light harvesting chl...	52	0.001
194	gb\|AY617087.1\| Pinus chiapensis chloroplast light harvesting chl...	52	0.001
195	ref\|NM_128995.2\| Arabidopsis thaliana LHB1B1; chlorophyll bindin...	50	0.005
196	ref\|NM_126537.2\| Arabidopsis thaliana LHCB2.2; chlorophyll bindi...	50	0.005
197	ref\|NM_001036246.1\| Arabidopsis thaliana ATP binding / kinase/ p...	50	0.005
198	ref\|NM_001036402.1\| Arabidopsis thaliana O-acetyltransferase AT2...	50	0.005
199	ref\|NM_001036401.1\| Arabidopsis thaliana O-acetyltransferase AT2...	50	0.005
200	ref\|NM_128994.2\| Arabidopsis thaliana LHB1B2; chlorophyll bindin...	50	0.005
201	ref\|NM_179900.1\| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ...	50	0.005
202	gb\|AY389549.1\| Hyacinthus orientalis chloroplast chlorophyll A-B...	50	0.005
203	gb\|DQ226725.1\| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence	50	0.005
204	emb\|X16436.1\|SACAB Mustard cab gene for chlorophyll a/b-binding ...	50	0.005
205	gb\|AF517869.1\| Griffithsia japonica isolate Gj446 light-harvest ...	50	0.005
206	gb\|AY142513.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
207	gb\|AY288914.1\| Brassica oleracea chlorophyll a/b binding protein...	50	0.005
208	gb\|AY045806.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
209	gb\|AF339687.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
210	gb\|AF326864.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
211	gb\|AY120776.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
212	gb\|AY093372.1\| Arabidopsis thaliana putative chlorophyll a/b bin...	50	0.005
213	gb\|AC007211.6\| Arabidopsis thaliana chromosome 2 BAC F1O13 genom...	50	0.005
214	gb\|AC004481.3\| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	50	0.005
215	gb\|AC004077.3\| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	50	0.005
216	gb\|AY081587.1\| Arabidopsis thaliana photosystem II type I chloro...	50	0.005
217	gb\|AY079110.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.005
218	gb\|AY079101.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.005
219	gb\|AY066036.1\| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	50	0.005
220	gb\|AY065125.1\| Arabidopsis thaliana photosystem II type I chloro...	50	0.005
221	gb\|AY062563.1\| Arabidopsis thaliana putative chlorophyll a/b bin...	50	0.005
222	gb\|AF419587.1\|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.005
223	gb\|AF419548.1\|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.005
224	gb\|AF428397.1\|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.005
225	gb\|AY054218.1\| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	50	0.005
226	gb\|AY039561.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.005
227	gb\|AF372886.1\|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.005
228	gb\|AF324693.2\|AF324693 Arabidopsis thaliana At2g34430 (At2g34430...	50	0.005
229	emb\|BX819881.1\|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co...	50	0.005
230	emb\|BX819347.1\|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co...	50	0.005
231	emb\|BX819270.1\|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co...	50	0.005
232	emb\|BX821505.1\|CNS0A93G Arabidopsis thaliana Full-length cDNA Co...	50	0.005
233	emb\|BX820206.1\|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co...	50	0.005
234	emb\|BX820202.1\|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co...	50	0.005
235	emb\|BX820019.1\|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co...	50	0.005
236	emb\|BX820007.1\|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co...	50	0.005
237	emb\|BX819668.1\|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co...	50	0.005
238	emb\|BX821638.1\|CNS0A92F Arabidopsis thaliana Full-length cDNA Co...	50	0.005
239	emb\|BX819509.1\|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co...	50	0.005
240	emb\|BX822910.1\|CNS0A63G Arabidopsis thaliana Full-length cDNA Co...	50	0.005
241	dbj\|AB206466.1\| Adiantum capillus-veneris AcCab1 gene for chloro...	50	0.005
242	gb\|AY086307.1\| Arabidopsis thaliana clone 23727 mRNA, complete s...	50	0.005
243	gb\|AF134123.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA...	50	0.005
244	gb\|AF134122.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA...	50	0.005
245	emb\|X02358.1\|PECAB25 Petunia gene for chlorophyll a/b binding pr...	50	0.005
246	emb\|X17697.1\|MDCHBP Apple light-harvesting chlorophyll a/b bindi...	50	0.005
247	emb\|Y13865.1\|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi...	50	0.005
248	emb\|X15894.1\|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b...	50	0.005
249	emb\|X64459.1\|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ...	50	0.005
250	emb\|X64460.1\|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c...	50	0.005
251	emb\|Z16408.1\|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 p...	50	0.005
252	emb\|X52743.1\|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/...	50	0.005
253	emb\|X16535.1\|GMCAB4 G.max DNA for Cab4	50	0.005
254	emb\|X12981.1\|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll...	50	0.005
255	gb\|BT002103.1\| Arabidopsis thaliana putative photosystem II type...	50	0.005
256	gb\|AY104614.1\| Zea mays PCO084486 mRNA sequence	50	0.005
257	gb\|K00975.1\|PETCAB10 Petunia major chlorophyll a/b binding prote...	50	0.005
258	gb\|K00973.1\|PETCAB3 Petunia major chlorophyll a/b binding protei...	50	0.005
259	gb\|M30622.1\|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-...	50	0.005
260	gb\|M30620.1\|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-...	50	0.005
261	gb\|M21396.1\|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin...	50	0.005
262	gb\|L07119.1\|COTIIABINA Gossypium hirsutum chloroplast photosyste...	50	0.005
263	dbj\|D14002.1\|LAUCAB Lettuce mRNA for light-harvesting chlorophyl...	50	0.005
264	dbj\|AB012638.1\| Nicotiana sylvestris Lhcb15, Lhcb16 genes for ...	50	0.005
265	gb\|BT014450.1\| Lycopersicon esculentum clone 133776F, mRNA sequence	48	0.022
266	gb\|DQ185425.1\| Rosa roxburghii clone C40 defense-related mRNA, p...	48	0.022
267	gb\|AF104633.2\| Chlamydomonas reinhardtii light harvesting comple...	48	0.022
268	gb\|S68728.1\| LHC Ib-21=light-harvesting complex I [Hordeum vulga...	48	0.022
269	gb\|AF110786.1\|AF110786 Volvox carteri f. nagariensis clone G18 l...	48	0.022
270	gb\|AF195794.1\|AF195794 Chlamydomonas reinhardtii chlorophyll A-B...	48	0.022
271	dbj\|AP004756.2\| Oryza sativa (japonica cultivar-group) genomic D...	48	0.022
272	dbj\|AB122119.1\| Chlamydomonas reinhardtii LhcI-6 gene for light-...	48	0.022
273	dbj\|AB122114.1\| Chlamydomonas reinhardtii LhcI-1 gene for light-...	48	0.022
274	emb\|X61287.1\|LECAB9 L.esculentum Cab9 gene for type I (26 kD) CP...	48	0.022
275	emb\|X02356.1\|PECAB91R Petunia gene for chlorophyll a/b binding p...	48	0.022
276	emb\|X65119.1\|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harve...	48	0.022
277	gb\|AF218305.1\|AF218305 Hordeum vulgare chlorophyll a/b binding p...	48	0.022
278	dbj\|AK066997.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.022
279	gb\|K00976.1\|PETCAB102 Petunia major chlorophyll a/b binding prot...	48	0.022
280	gb\|K00974.1\|PETCAB4 Petunia major chlorophyll a/b binding protei...	48	0.022
281	gb\|DQ226825.1\| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence	46	0.085
282	gb\|BT014208.1\| Lycopersicon esculentum clone 133385R, mRNA sequence	46	0.085
283	gb\|AF517872.1\| Griffithsia japonica isolate Gj241 light-harvest ...	46	0.085
284	emb\|BX819530.1\|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co...	46	0.085
285	gb\|U21113.1\|STU21113 Solanum tuberosum chlorophyll a/b binding p...	46	0.085
286	gb\|M30618.1\|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-...	46	0.085
287	gb\|M14443.1\|TOMCBPA Tomato chlorophyll a/b-binding protein gene ...	46	0.085
288	gb\|M23531.1\|DUNCBP D.salina major chlorophyll binding protein mR...	46	0.085
289	dbj\|AU066541.1\| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	46	0.085
290	ref\|XM_507384.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
291	ref\|XM_507383.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
292	ref\|XM_507382.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
293	ref\|XM_478841.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.34
294	ref\|XM_507381.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
295	ref\|XM_507380.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
296	ref\|XM_507379.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
297	ref\|XM_506426.2\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.34
298	gb\|AY954738.1\| Ostreococcus tauri chloroplast chlorophyll a/b-bi...	44	0.34
299	gb\|AF139467.2\|AF139467 Vigna radiata LHCII type I chlorophyll a/...	44	0.34
300	dbj\|AP003804.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.34
301	dbj\|AB122116.1\| Chlamydomonas reinhardtii LhcI-3 gene for light-...	44	0.34
302	dbj\|AK119176.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
303	emb\|X84308.1\|HVLHCA2 H.vulgare mRNA for photosysteme I antenna p...	44	0.34
304	dbj\|AK104651.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
305	dbj\|AK104608.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
306	dbj\|AK104283.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
307	dbj\|AK104177.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
308	dbj\|AK104127.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
309	dbj\|AK104016.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
310	dbj\|AK103966.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
311	dbj\|AK070051.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
312	dbj\|AK060987.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.34
313	gb\|AY105356.1\| Zea mays PCO075138 mRNA sequence	44	0.34
314	gb\|AY105333.1\| Zea mays PCO095488 mRNA sequence	44	0.34
315	gb\|U22329.1\|VCU22329 Volvox carteri light harvesting complex a m...	44	0.34
316	gb\|AY845254.1\| Pisum sativum light-harvesting chlorophyll-a/b bi...	42	1.3
317	ref\|NM_102733.2\| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND...	42	1.3
318	ref\|NM_124807.2\| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH...	42	1.3
319	ref\|NM_124808.3\| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA...	42	1.3
320	ref\|NM_102731.2\| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND...	42	1.3
321	ref\|NM_126540.2\| Arabidopsis thaliana LHCB2.1; chlorophyll bindi...	42	1.3
322	gb\|DQ124219.1\| Fagus sylvatica putative chlorophyll a/b-binding ...	42	1.3
323	emb\|X61610.1\|BNLHCB3C B.napus gene for LHCII Type III chlorophyl...	42	1.3
324	gb\|AC003084.1\| Homo sapiens BAC clone CTB-84D4 from 7, complete ...	42	1.3
325	gb\|AY045787.1\| Arabidopsis thaliana At2g05100 mRNA sequence	42	1.3
326	gb\|AY091169.1\| Arabidopsis thaliana putative chlorophyll a/b-bin...	42	1.3
327	gb\|AY050935.1\| Arabidopsis thaliana putative photosystem II type...	42	1.3
328	emb\|AL939113.1\|SCO939113 Streptomyces coelicolor A3(2) complete ...	42	1.3
329	gb\|AY114594.1\| Arabidopsis thaliana chlorophyll a/b-binding prot...	42	1.3
330	gb\|AC007443.5\| Arabidopsis thaliana chromosome 2 clone F15L11 ma...	42	1.3
331	gb\|AC145591.5\| Mus musculus BAC clone RP24-176N2 from chromosome...	42	1.3
332	gb\|AF361858.1\| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	42	1.3
333	gb\|AY065165.1\| Arabidopsis thaliana chlorophyll a/b-binding prot...	42	1.3
334	gb\|AY058180.1\| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	42	1.3
335	gb\|AY057735.1\| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	42	1.3
336	gb\|AF428359.1\|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m...	42	1.3
337	gb\|AF398742.1\|AF398742 Centromadia pungens ASCAB9 (ASCAB9) gene,...	42	1.3
338	gb\|AY052348.1\| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	42	1.3
339	gb\|AY052275.1\| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	42	1.3
340	gb\|AY045673.1\| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	42	1.3
341	gb\|AF372917.1\|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN...	42	1.3
342	gb\|DQ356257.1\| Homo sapiens isolate cftr10471_A cystic fibrosis ...	42	1.3
343	emb\|BX815726.1\|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
344	emb\|BX817619.1\|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co...	42	1.3
345	emb\|BX821952.1\|CNS0AABH Arabidopsis thaliana Full-length cDNA Co...	42	1.3
346	emb\|BX819843.1\|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co...	42	1.3
347	emb\|BX819702.1\|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
348	emb\|BX821844.1\|CNS0A936 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
349	emb\|BX821132.1\|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co...	42	1.3
350	emb\|BX819861.1\|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co...	42	1.3
351	emb\|BX819751.1\|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
352	emb\|BX819688.1\|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
353	emb\|BX819687.1\|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
354	emb\|BX819683.1\|CNS0A80L Arabidopsis thaliana Full-length cDNA Co...	42	1.3
355	emb\|BX830083.1\|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co...	42	1.3
356	emb\|BX831260.1\|CNS09ZEV Arabidopsis thaliana Full-length cDNA Co...	42	1.3
357	emb\|BX831139.1\|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co...	42	1.3
358	emb\|BX842010.1\|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co...	42	1.3
359	gb\|DP000025.1\| Gorilla gorilla gorilla target 1 genomic scaffold	42	1.3
360	gb\|AC022455.5\|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	42	1.3
361	gb\|AF312227.1\|AF312227 Citrus reticulata light-harvesting chloro...	42	1.3
362	gb\|AC008030.4\|AC008030 Arabidopsis thaliana chromosome I BAC F1N...	42	1.3
363	gb\|AY086905.1\| Arabidopsis thaliana clone 29298 mRNA, complete s...	42	1.3
364	gb\|AF134126.1\| Arabidopsis thaliana chromosome V Lhcb3 protein (...	42	1.3
365	gb\|AF134124.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA...	42	1.3
366	emb\|AJ538931.1\|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.3
367	emb\|AJ538874.1\|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.3
368	emb\|AJ538840.1\|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.3
369	emb\|AJ538493.1\|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC...	42	1.3
370	emb\|X61609.1\|BNLHCB3B B.napus gene for LHC II Type III chlorophy...	42	1.3
371	dbj\|AB010695.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	42	1.3
372	dbj\|AB115771.1\| Physcomitrella patens subsp. patens PpLhcb1 gene...	42	1.3
373	emb\|X02357.1\|PECAB13 Petunia gene for chlorophyll a/b binding pr...	42	1.3
374	emb\|X58230.1\|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind...	42	1.3
375	emb\|X58229.1\|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin...	42	1.3
376	emb\|X03909.1\|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy...	42	1.3
377	emb\|X03908.1\|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy...	42	1.3
378	emb\|Z29965.1\|TRLHCABBP T.repens (Huia) mRNA for light-harvesting...	42	1.3
379	emb\|X16536.1\|GMCAB5 G.max DNA for Cab5	42	1.3
380	emb\|X57082.1\|PSCABII P.sativum Cab II gene for chlorophyll a/b-b...	42	1.3
381	gb\|AF143691.1\|AF143691 Arabidopsis thaliana type III chlorophyll...	42	1.3
382	gb\|BT001933.1\| Arabidopsis thaliana clone C105385 putative chlor...	42	1.3
383	gb\|AF034631.1\|AF034631 Panax ginseng chlorophyll a/b binding pro...	42	1.3
384	gb\|AF003127.1\|AF003127 Mesembryanthemum crystallinum chlorophyll...	42	1.3
385	dbj\|AP008949.1\| Lotus japonicus genomic DNA, chromosome 2, clone...	42	1.3
386	gb\|U25812.1\|PSU25812 Pseudomonas syringae pv. syringae hrp gene ...	42	1.3
387	gb\|M34396.1\|PMJCABF3 Polystichum munitum chlorophyll a/b-binding...	42	1.3
388	gb\|U01964.1\|GMU01964 Glycine max cv. Dare photosystem II type I ...	42	1.3
389	dbj\|AB012641.1\| Nicotiana sylvestris Lhcb1*9 gene for light harv...	42	1.3
390	dbj\|AB012640.1\| Nicotiana sylvestris Lhcb1*8 gene for light harv...	42	1.3
391	dbj\|AB012637.1\| Nicotiana sylvestris Lhcb12, Lhcb13, Lhcb1*4 g...	42	1.3
392	dbj\|AB012636.1\| Nicotiana sylvestris Lhcb1*1 gene for light harv...	42	1.3
393	dbj\|AB006081.1\| Fagus crenata mRNA for chlorophyll a/b-binding p...	42	1.3
394	ref\|NM_122728.1\| Arabidopsis thaliana chlorophyll binding AT5G28...	40	5.3
395	ref\|NM_116012.2\| Arabidopsis thaliana LHCA2; chlorophyll binding...	40	5.3
396	ref\|XM_478415.1\| Oryza sativa (japonica cultivar-group), mRNA	40	5.3
397	gb\|AC139637.17\| Mus musculus chromosome 15, clone RP24-253M12, c...	40	5.3
398	ref\|NM_001039970.1\| Homo sapiens protein tyrosine phosphatase, n...	40	5.3
399	ref\|NM_032781.3\| Homo sapiens protein tyrosine phosphatase, non-...	40	5.3
400	ref\|NM_006906.1\| Homo sapiens protein tyrosine phosphatase, non-...	40	5.3
401	gb\|CP000359.1\| Deinococcus geothermalis DSM 11300, complete genome	40	5.3
402	gb\|BT013404.1\| Lycopersicon esculentum clone 135718R, mRNA sequence	40	5.3
403	gb\|BT012757.1\| Lycopersicon esculentum clone 113701F, mRNA sequence	40	5.3
404	gb\|BT012040.1\| Arabidopsis thaliana At5g28450 mRNA sequence	40	5.3
405	gb\|CP000115.1\| Nitrobacter winogradskyi Nb-255, complete genome	40	5.3
406	gb\|AC142474.4\| Mus musculus BAC clone RP24-362N7 from chromosome...	40	5.3
407	ref\|XM_883654.1\| Candida albicans SC5314 hypothetical protein (C...	40	5.3
408	ref\|XM_707383.1\| Candida albicans SC5314 potential guanine nucle...	40	5.3
409	gb\|BC046435.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.3
410	gb\|BC064807.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.3
411	gb\|BC039897.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.3
412	emb\|Z22873.1\|TABETGLUA T.aestivum beta glucanase mRNA, complete CDS	40	5.3
413	emb\|CR555306.1\| Azoarcus sp. EbN1 complete genome	40	5.3
414	emb\|AL832541.1\|HSM803850 Homo sapiens mRNA; cDNA DKFZp547A0817 (...	40	5.3
415	emb\|AL132962.1\|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA...	40	5.3
416	gb\|AY065429.1\| Arabidopsis thaliana putative Lhca2 protein (At3g...	40	5.3
417	emb\|AL806524.10\| Mouse DNA sequence from clone RP23-158E10 on ch...	40	5.3
418	dbj\|AK127312.1\| Homo sapiens cDNA FLJ45381 fis, clone BRHIP30210...	40	5.3
419	dbj\|AK090923.1\| Homo sapiens cDNA FLJ33604 fis, clone BRAMY20152...	40	5.3
420	dbj\|AK027333.1\| Homo sapiens cDNA FLJ14427 fis, clone HEMBA1006173	40	5.3
421	dbj\|AK055450.1\| Homo sapiens cDNA FLJ30888 fis, clone FEBRA20050...	40	5.3
422	gb\|AC103974.6\| Homo sapiens chromosome 11, clone RP11-1081L13, c...	40	5.3
423	gb\|BC028338.1\| Homo sapiens, clone IMAGE:5195357, mRNA	40	5.3
424	gb\|AY072483.1\| Arabidopsis thaliana Lhca2 protein (At3g61470; F2...	40	5.3
425	gb\|AY054670.1\| Arabidopsis thaliana Lhca2 protein (At3g61470; F2...	40	5.3
426	emb\|BX530075.7\| Zebrafish DNA sequence from clone CH211-1O14 in ...	40	5.3
427	emb\|BX822099.1\|CNS0A7GL Arabidopsis thaliana Full-length cDNA Co...	40	5.3
428	emb\|BX823150.1\|CNS0A635 Arabidopsis thaliana Full-length cDNA Co...	40	5.3
429	emb\|BX822082.1\|CNS0A5ZI Arabidopsis thaliana Full-length cDNA Co...	40	5.3
430	emb\|BX822402.1\|CNS0A5WB Arabidopsis thaliana Full-length cDNA Co...	40	5.3
431	emb\|BX823776.1\|CNS0A5AG Arabidopsis thaliana Full-length cDNA Co...	40	5.3
432	emb\|BX823614.1\|CNS0A5E1 Arabidopsis thaliana Full-length cDNA Co...	40	5.3
433	emb\|BX822984.1\|CNS0A4P7 Arabidopsis thaliana Full-length cDNA Co...	40	5.3
434	emb\|BX842122.1\|CNS09YDD Arabidopsis thaliana Full-length cDNA Co...	40	5.3
435	gb\|AY198376.1\| Citrus limon chlorophyll a/b-binding protein prec...	40	5.3
436	gb\|BC047349.1\| Mus musculus, clone IMAGE:3595895, mRNA	40	5.3
437	gb\|AY088983.1\| Arabidopsis thaliana clone 123159 mRNA, complete ...	40	5.3
438	gb\|AF497482.1\| Micromonospora echinospora calicheamicin biosynth...	40	5.3
439	gb\|AF134120.1\| Arabidopsis thaliana Lhca2 protein (Lhca2) mRNA, ...	40	5.3
440	gb\|AF262038.1\|F21B23 Arabidopsis thaliana BAC F21B23	40	5.3
441	dbj\|AP006618.1\| Nocardia farcinica IFM 10152 DNA, complete genome	40	5.3
442	dbj\|AP005320.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	5.3
443	dbj\|AB060245.1\| Macaca fascicularis brain cDNA clone:QflA-15249,...	40	5.3
444	emb\|X02360.1\|PECAB22R Petunia gene for chlorophyll a/b binding p...	40	5.3
445	emb\|X95727.1\|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding...	40	5.3
446	emb\|X52744.1\|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/...	40	5.3
447	emb\|X60275.1\|LELHBC1G L.esculentum lhbC1 gene for LHCII type III	40	5.3
448	dbj\|AK102726.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.3
449	dbj\|AK069570.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.3
450	gb\|BT002070.1\| Arabidopsis thaliana Lhca2 protein (At3g61470) mR...	40	5.3
451	gb\|K00972.1\|PETCAB146 Petunia major chlorophyll a/b binding prot...	40	5.3
452	gb\|U68715.1\|BFU68715 Botryotinia fuckeliana endopolygalacturonas...	40	5.3
453	gb\|AF003129.1\|AF003129 Mesembryanthemum crystallinum chlorophyll...	40	5.3
454	dbj\|AP006852.1\| Candida albicans genomic DNA, chromosome 7, comp...	40	5.3
455	gb\|AD000005.1\|MSGY42 Mycobacterium tuberculosis sequence from cl...	40	5.3
456	emb\|AL390254.6\|CNS06C7M Human chromosome 14 DNA sequence BAC R-9...	40	5.3
457	gb\|U21112.1\|STU21112 Solanum tuberosum chlorophyll a/b binding p...	40	5.3
458	emb\|X12861.1\|EGLHCI38 Euglena gracilis mRNA fragment for LHCI pr...	40	5.3
459	dbj\|AB008771.1\| Streptomyces thermoviolaceus nagA gene for beta-...	40	5.3

>emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for core chlorophyll a/b
            binding (CAB) protein of photosystem II (PSII)
          Length = 2689

 Score =  757 bits (382), Expect = 0.0
 Identities = 391/394 (99%)
 Strand = Plus / Minus

                                                                        
Query: 1    aatcaaaacggtcatgtttcttctgcccttgataatttacacgtacggcacattcgtact 60
            ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2416 aatcagaacggtcatgtttcttctgcccttgataatttacacgtacggcacattcgtact 2357

                                                                        
Query: 61   ctcatacttttccccggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatg 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2356 ctcatacttttccccggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatg 2297

                                                                        
Query: 121  cagctgagcatcaacagccgacggcggcggacgggcaatcaacggccagctcacaggctg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2296 cagctgagcatcaacagccgacggcggcggacgggcaatcaacggccagctcacaggctg 2237

                                                                        
Query: 181  ggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaaggggtcgctg 240
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2236 ggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaaggggtcgctg 2177

                                                                        
Query: 241  aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaag 300
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2176 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaag 2117

                                                                        
Query: 301  cccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagcagcgcc 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2116 cccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagcagcgcc 2057

                                              
Query: 361  gcctggtcggggtcggtggcgaggccgagcgggt 394
            ||||||||||||||||||||||||||||||||||
Sbjct: 2056 gcctggtcggggtcggtggcgaggccgagcgggt 2023

to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                         
Query: 173   acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
             |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 40261 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 40202

                                                                         
Query: 233   ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
             |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 40201 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 40142

                                                                         
Query: 293   tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
             |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 40141 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 40082

                                    
Query: 353   gcagcgccgcctggtcggggtcg 375
             |||||||||||||||| ||||||
Sbjct: 40081 gcagcgccgcctggtccgggtcg 40059

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                           
Query: 173     acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
               |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 7581175 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7581116

                                                                           
Query: 233     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
               |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 7581115 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7581056

                                                                           
Query: 293     tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
               |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7581055 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7580996

                                      
Query: 353     gcagcgccgcctggtcggggtcg 375
               |||||||||||||||| ||||||
Sbjct: 7580995 gcagcgccgcctggtccgggtcg 7580973

to top

>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full
           insert sequence
          Length = 1157

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 940 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 881

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 880 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 821

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 820 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 761

                                  
Query: 353 gcagcgccgcctggtcggggtcg 375
           |||||||||||||||| ||||||
Sbjct: 760 gcagcgccgcctggtccgggtcg 738

to top

>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full
           insert sequence
          Length = 1101

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 930 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 871

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 870 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 811

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 810 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 751

                                  
Query: 353 gcagcgccgcctggtcggggtcg 375
           |||||||||||||||| ||||||
Sbjct: 750 gcagcgccgcctggtccgggtcg 728

to top

>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full
           insert sequence
          Length = 1186

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 941 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 882

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 881 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 822

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 821 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 762

                                  
Query: 353 gcagcgccgcctggtcggggtcg 375
           |||||||||||||||| ||||||
Sbjct: 761 gcagcgccgcctggtccgggtcg 739

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                           
Query: 173     acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
               |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 7651262 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7651203

                                                                           
Query: 233     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
               |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 7651202 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7651143

                                                                           
Query: 293     tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
               |||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7651142 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7651083

                                      
Query: 353     gcagcgccgcctggtcggggtcg 375
               |||||||||||||||| ||||||
Sbjct: 7651082 gcagcgccgcctggtccgggtcg 7651060

to top

>dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, partial sequence
          Length = 556

 Score =  258 bits (130), Expect = 1e-65
 Identities = 178/194 (91%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           |||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 395 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 336

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 335 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 276

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           |||| || |||||||||||||||||||||||||| ||||||||||||||||||| ||| |
Sbjct: 275 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaacttca 216

                         
Query: 353 gcagcgccgcctgg 366
           ||||||||| ||||
Sbjct: 215 gcagcgccgtctgg 202

to top

>gb|AY105650.1| Zea mays PCO135935 mRNA sequence
          Length = 1366

 Score =  240 bits (121), Expect = 3e-60
 Identities = 193/217 (88%)
 Strand = Plus / Minus

                                                                        
Query: 170  ctcacaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccga 229
            ||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 1028 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 969

                                                                        
Query: 230  aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 289
            ||||||||||||||||   |   |||||||||| ||| || |||||||||||||||||||
Sbjct: 968  aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 909

                                                                        
Query: 290  ggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 349
            ||||||| ||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 908  ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 849

                                                 
Query: 350  tgagcagcgccgcctggtcggggtcggtggcgaggcc 386
            |||| |  || ||||||||||||||| |||| |||||
Sbjct: 848  tgaggatggcggcctggtcggggtcgctggccaggcc 812

to top

>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA,
           complete cds
          Length = 957

 Score =  236 bits (119), Expect = 4e-59
 Identities = 188/211 (89%)
 Strand = Plus / Minus

                                                                       
Query: 170 ctcacaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccga 229
           ||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 886 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 827

                                                                       
Query: 230 aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 289
           ||||||||||||||||   |   |||||||||| ||| || |||||||||||||||||||
Sbjct: 826 aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 767

                                                                       
Query: 290 ggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 349
           ||||||| ||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 766 ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 707

                                          
Query: 350 tgagcagcgccgcctggtcggggtcggtggc 380
           |||| |  || ||||||||||||||| ||||
Sbjct: 706 tgaggatggcggcctggtcggggtcgctggc 676

to top

>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA,
           complete cds
          Length = 1073

 Score =  210 bits (106), Expect = 3e-51
 Identities = 187/214 (87%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           ||||||| |||  |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 881 acaggctaggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 822

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   |   |||||||| | ||| || ||||||||||||||||||||||
Sbjct: 821 ggtcgctgaggtgcttggcgaggttctccacggggccttcgccggtgacgtaggcctgga 762

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           |||| ||| | | |||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 761 tgaagaaggcgaacatggagaacatcgcgagccggccgttcttgatctccttcaccttga 702

                                             
Query: 353 gcagcgccgcctggtcggggtcggtggcgaggcc 386
           | |  || ||||||||||||||| |||| |||||
Sbjct: 701 ggatggcggcctggtcggggtcgctggccaggcc 668

to top

>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein
           mRNA, partial cds
          Length = 364

 Score =  200 bits (101), Expect = 2e-48
 Identities = 170/193 (88%)
 Strand = Plus / Minus

                                                                       
Query: 173 acaggctgggcaccctctcggcggcgccggaaatgacggtgagcaggttgttgccgaagg 232
           ||||||||||  ||||||||||||| || || ||||||||||||||||||||||||||||
Sbjct: 193 acaggctgggtgccctctcggcggcaccagagatgacggtgagcaggttgttgccgaagg 134

                                                                       
Query: 233 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 292
           |||||||||||||   |   |||||||||| ||| ||| |||| ||||||||||||||||
Sbjct: 133 ggtcgctgaggtgcttggcgaggttctcgacgggacccccgcctgtgacgtaggcctgga 74

                                                                       
Query: 293 tgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 352
           | || ||| | | ||||||||||||||||||||  |||||||||||||||||||||||||
Sbjct: 73  taaagaaggcgaacatggagaacatggccagcctgccgttcttgatctccttcaccttga 14

                        
Query: 353 gcagcgccgcctg 365
           |||| ||||||||
Sbjct: 13  gcagagccgcctg 1



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 28  cttgataatttacacgtacggcacattcgtactctcat 65
           |||||||||||||||| |||| ||||||  ||||||||
Sbjct: 319 cttgataatttacacgcacggtacattcagactctcat 282

to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  111 bits (56), Expect = 2e-21
 Identities = 113/132 (85%)
 Strand = Plus / Minus

                                                                        
Query: 219  gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
            ||||||| ||| |||||||  || |||| ||  ||||||||||| ||| |||| ||||||
Sbjct: 1495 gttgttggcgacggggtcggcgatgtggtcggccaggttctcgatggggcccttgccggt 1436

                                                                        
Query: 279  gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
            ||||  |||||| | ||| ||||| | ||||||||||||||||||||| |||||||||||
Sbjct: 1435 gacgatggcctgaacgaagaagccgaacatggagaacatggccagccgcccgttcttgat 1376

                        
Query: 339  ctccttcacctt 350
            ||||||||||||
Sbjct: 1375 ctccttcacctt 1364

to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 713 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 654

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 653 aacatggcgaggcggccgttcttgatctccttcaccttgagc 612

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                            
Query: 253      aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
                |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 10793709 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 10793650

                                                          
Query: 313      aacatggccagccgtccgttcttgatctccttcaccttgagc 354
                |||||||| || || |||||||||||||||||||||||||||
Sbjct: 10793649 aacatggcgaggcggccgttcttgatctccttcaccttgagc 10793608



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 319     gccagccgtccgttcttgatctccttcacctt 350
               ||||| || |||||||||||||||||||||||
Sbjct: 7133596 gccaggcgaccgttcttgatctccttcacctt 7133565

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                            
Query: 253      aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
                |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 23604256 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 23604197

                                                          
Query: 313      aacatggccagccgtccgttcttgatctccttcaccttgagc 354
                |||||||| || || |||||||||||||||||||||||||||
Sbjct: 23604196 aacatggcgaggcggccgttcttgatctccttcaccttgagc 23604155



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                            
Query: 231      ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
                |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 30025084 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 30025025

                                                                            
Query: 291      gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
                || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 30025024 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 30024965

                    
Query: 351      gagc 354
                ||||
Sbjct: 30024964 gagc 30024961

to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 253   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
             |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 17432 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 17373

                                                       
Query: 313   aacatggccagccgtccgttcttgatctccttcaccttgagc 354
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 17372 aacatggcgaggcggccgttcttgatctccttcaccttgagc 17331

to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 253   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
             |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 66955 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 66896

                                                       
Query: 313   aacatggccagccgtccgttcttgatctccttcaccttgagc 354
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 66895 aacatggcgaggcggccgttcttgatctccttcaccttgagc 66854

to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                          
Query: 253    aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
              |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 130327 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 130268

                                                        
Query: 313    aacatggccagccgtccgttcttgatctccttcaccttgagc 354
              |||||||| || || |||||||||||||||||||||||||||
Sbjct: 130267 aacatggcgaggcggccgttcttgatctccttcaccttgagc 130226

to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683

to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 783 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 724

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 aacatggcgaggcggccgttcttgatctccttcaccttgagc 682

to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 1213 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1154

                                                      
Query: 313  aacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 1153 aacatggcgaggcggccgttcttgatctccttcaccttgagc 1112

to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 777 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 718

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 717 aacatggcgaggcggccgttcttgatctccttcaccttgagc 676

to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683

to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661

to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 822 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 763

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 762 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 703

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 702 ctccttgaccttgagc 687

to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692

to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 860 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 801

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 800 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 741

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 740 ctccttgaccttgagc 725

to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Plus

                                                                         
Query: 219   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
             ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 79011 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 79070

                                                                         
Query: 279   gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
             ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 79071 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 79130

                             
Query: 339   ctccttcaccttgagc 354
             ||||||||||||||||
Sbjct: 79131 ctccttcaccttgagc 79146

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 219      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21808805 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21808746

                                                                            
Query: 279      gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
                ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21808745 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21808686

                                
Query: 339      ctccttcaccttgagc 354
                ||||||||||||||||
Sbjct: 21808685 ctccttcaccttgagc 21808670

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 219      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
                ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 22434833 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 22434774

                                                                            
Query: 279      gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
                ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 22434773 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 22434714

                                
Query: 339      ctccttcaccttgagc 354
                |||||| |||||||||
Sbjct: 22434713 ctccttgaccttgagc 22434698



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 315      catggccagccgtccgttcttgatctcctt 344
                |||||| ||||| |||||||||||||||||
Sbjct: 23305209 catggcgagccgcccgttcttgatctcctt 23305180



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 357      cgccgcctggtcggggtcgg 376
                ||||||||||||||||||||
Sbjct: 19834168 cgccgcctggtcggggtcgg 19834187

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 219      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21801834 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21801775

                                                                            
Query: 279      gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
                ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21801774 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21801715

                                
Query: 339      ctccttcaccttgagc 354
                ||||||||||||||||
Sbjct: 21801714 ctccttcaccttgagc 21801699

to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                         
Query: 219   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
             ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 95900 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 95841

                                                                         
Query: 279   gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
             ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 95840 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 95781

                             
Query: 339   ctccttcaccttgagc 354
             |||||| |||||||||
Sbjct: 95780 ctccttgaccttgagc 95765

to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661

to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 804 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 745

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 744 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 685

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 684 ctccttcaccttgagc 669

to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692

to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 379 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 320

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 319 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 260

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 259 ctccttcaccttgagc 244

to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 793 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 734

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 733 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 674

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 673 ctccttcaccttgagc 658

to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  103 bits (52), Expect = 4e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| ||||||| ||| |||| || | |||||||||| ||| |||| ||||||
Sbjct: 785 gttgttggcgacggggtcggtgacgtggtcgaagaggttctcgatggggcccttgccggt 726

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||||| ||| || || | ||||||||||||||| || || |||||||||| 
Sbjct: 725 gacgatggcctggacgaagaatccgaacatggagaacatggcgaggcggccgttcttgag 666

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 665 ctccttcaccttgagc 650

to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 1174 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1115

                                                      
Query: 313  aacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||| || || ||||||||||||| |||||||||||||
Sbjct: 1114 aacatggcgaggcggccgttcttgatcttcttcaccttgagc 1073

to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||| | ||| ||||| | |||||||
Sbjct: 791 aggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccgaacatggag 732

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 731 aacatggcgaggcggccgttcttgatctccttcaccttgagc 690

to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| ||||| | |||||||
Sbjct: 763 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 704

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || || ||||||||||||||||||||||||
Sbjct: 703 aacatggcgaggcggcctttcttgatctccttcaccttgagc 662

to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 747 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 688

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 687 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 628

               
Query: 351 gagc 354
           ||||
Sbjct: 627 gagc 624

to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 13927 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 13986

                                                                         
Query: 291   gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
             || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 13987 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 14046

                 
Query: 351   gagc 354
             ||||
Sbjct: 14047 gagc 14050

to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 gttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaa 314
           |||||||| ||| |||| |||||| |||  |||||||| ||| || || | |||||||||
Sbjct: 634 gttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaa 575

                                               
Query: 315 catggccagccgtccgttcttgatctccttcacctt 350
           ||| ||||||||||||||||||||||||||||||||
Sbjct: 574 catcgccagccgtccgttcttgatctccttcacctt 539

to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 21074 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 21015

                                                                         
Query: 291   gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
             || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 21014 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 20955

                 
Query: 351   gagc 354
             ||||
Sbjct: 20954 gagc 20951

to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
            ||||||| |||||||| ||   |||||||||| ||| |||| ||||||||||   |||||
Sbjct: 2670 ggggtcggtgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctg 2611

                                                                        
Query: 291  gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
             | ||| ||||| | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 2610 cacgaagaagccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 2551

                
Query: 351  gagc 354
            ||||
Sbjct: 2550 gagc 2547

to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 789 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 730

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||| | ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 729 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 670

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 669 ctccttcaccttgagc 654

to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

               
Query: 351 gagc 354
           ||||
Sbjct: 708 gagc 705

to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

               
Query: 351 gagc 354
           ||||
Sbjct: 708 gagc 705

to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 821 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 762

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  || ||||| ||| ||||| | ||||||||||||||| || || || ||||||||
Sbjct: 761 gacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 702

                           
Query: 339 ctccttcaccttgagc 354
           |||||| |||||||||
Sbjct: 701 ctccttgaccttgagc 686

to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

               
Query: 351 gagc 354
           ||||
Sbjct: 710 gagc 707

to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 278
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 437 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 378

                                                                       
Query: 279 gacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgat 338
           ||||  |||||| | ||| ||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 377 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 318

                           
Query: 339 ctccttcaccttgagc 354
           ||||||||||||||||
Sbjct: 317 ctccttcaccttgagc 302

to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||||||  ||||||
Sbjct: 813 ggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggtgacgatggcctg 754

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| ||||| | ||||||||||||||| || || || |||||||||||||| |||||
Sbjct: 753 gacgaagaagccgaacatggagaacatggcgaggcggccattcttgatctccttgacctt 694

               
Query: 351 gagc 354
           ||||
Sbjct: 693 gagc 690

to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 290
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 291 gatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || ||| || || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

               
Query: 351 gagc 354
           ||||
Sbjct: 710 gagc 707

to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 719 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 660

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 659 gaacatggccaggcggccgttcttgatctccttcacctt 621

to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 720 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 661

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 660 gaacatggccaggcggccgttcttgatctccttcacctt 622

to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 714 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 655

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 654 gaacatggccaggcggccgttcttgatctccttcacctt 616

to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 748 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 689

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 688 gaacatggccaggcggccgttcttgatctccttcacctt 650

to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 252  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
            |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 1590 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1531

                                                   
Query: 312  gaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||| || |||||||||||||||||||||||
Sbjct: 1530 gaacatggccaggcggccgttcttgatctccttcacctt 1492

to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| |||  |||| | | |||||
Sbjct: 313 aggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccgaacctggag 254

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 253 aacatggcgaggcggccgttcttgatctccttcaccttgagc 212

to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||||| ||| || || | |||||||
Sbjct: 505 aggttctcgatgggtcccttgccggtgacgatggcctggacgaagaacccaaacatggag 446

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 445 aacatggcgaggcggccgttcttgagctccttcaccttgagc 404

to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 255 gttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaa 314
           |||||||| ||||||||  |||||||||  |||||| | ||| || || | |||||||||
Sbjct: 900 gttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccgaacatggagaa 841

                                               
Query: 315 catggccagccgtccgttcttgatctccttcacctt 350
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 840 catggccaggcgtccgttcttgatctccttgacctt 805

to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                        
Query: 255  gttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaa 314
            |||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||||||
Sbjct: 1120 gttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccgaacatggagaa 1061

                                                
Query: 315  catggccagccgtccgttcttgatctccttcacctt 350
            ||||||||| ||||||||||||||||||||||||||
Sbjct: 1060 catggccaggcgtccgttcttgatctccttcacctt 1025

to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                       
Query: 268 ccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgt 327
           |||| |||||| |||  |||||||| ||| ||||| | |||||||||||||||||| || 
Sbjct: 758 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 699

                                  
Query: 328 ccgttcttgatctccttcacctt 350
           |||||||||||||||||||||||
Sbjct: 698 ccgttcttgatctccttcacctt 676

to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 702 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 643

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 642 gaacatagccaggcggccgttcttgatctccttcacctt 604

to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 718 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 659

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 658 gaacatagccaggcggccgttcttgatctccttcacctt 620

to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
            |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 1399 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1340

                                                   
Query: 312  gaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||| ||||| || |||||||||||||||||||||||
Sbjct: 1339 gaacatagccaggcggccgttcttgatctccttcacctt 1301

to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 241 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaag 300
           |||||| || |||||||||  | ||| |||| |||||| |||  |||||| | ||| |||
Sbjct: 733 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 674

                                                             
Query: 301 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 673 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 624

to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            ||||||||||  || |||| ||||||||||  |||||||| ||| ||||| | |||||| 
Sbjct: 1607 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccgaacatggaa 1548

                                                      
Query: 313  aacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 1547 aacatggcgaggcggccgttcttgagctccttcaccttgagc 1506

to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 255 gttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaa 314
           |||||||| ||| |||| ||||||||||  |||||||| ||| || |||| |||||||||
Sbjct: 764 gttctcgatggggcccttgccggtgacgatggcctggacgaagaaacccaacatggagaa 705

                                                 
Query: 315 catggccagccgtccgttcttgatctccttcaccttga 352
           |||||| || || ||||| |||| ||||||||||||||
Sbjct: 704 catggcgaggcggccgttattgaactccttcaccttga 667

to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 265 ggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagc 324
           ||||||| ||||||||||  ||||||||  ||||| || | |||||| |||||||| || 
Sbjct: 755 ggccccttgccggtgacgatggcctggacaaaaaacccgaacatggataacatggcgagg 696

                                         
Query: 325 cgtccgttcttgatctccttcaccttgagc 354
           || |||||||||||||||||||||||||||
Sbjct: 695 cggccgttcttgatctccttcaccttgagc 666

to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 241 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaag 300
           |||||| || |||||||||  | ||| |||| |||||| |||  |||||| | ||| |||
Sbjct: 717 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 658

                                                             
Query: 301 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 657 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 608

to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 250  cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatg 309
            ||||||||||  | ||| |||| |||||| |||  |||||| | ||| ||||| | ||||
Sbjct: 1432 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1373

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1372 gagaacatggccaggcggccgttcttgatctccttcacctt 1332

to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 250  cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatg 309
            ||||||||||  | ||| |||| |||||| |||  |||||| | ||| ||||| | ||||
Sbjct: 1345 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1286

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1285 gagaacatggccaggcggccgttcttgatctccttcacctt 1245

to top

>dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, complete cds
          Length = 952

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 agggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggcca 322
           |||| ||||||||||| ||||||| ||||| |   |||||||||| ||||| ||||||||
Sbjct: 827 aggggccctcgccggtcacgtaggactggacggcgaagcccagcacggagaccatggcca 768

                                       
Query: 323 gccgtccgttcttgatctccttcacctt 350
           | || ||||||||||||||||| |||||
Sbjct: 767 ggcggccgttcttgatctccttgacctt 740



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 207 gacggtgagcaggttgttgccgaaggggtcg 237
           |||||| |||||||||| |||||||||||||
Sbjct: 883 gacggtcagcaggttgtagccgaaggggtcg 853

to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           ||||||||||  || |||| ||||||||||  |||||||| ||| || || | |||||||
Sbjct: 737 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccgaacatggag 678

                                                   
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttga 352
           |||||||| || || |||||||||| ||||||||||||||
Sbjct: 677 aacatggcgaggcggccgttcttgagctccttcaccttga 638

to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                     
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcac 347
           ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 773 catggagaacatggccaaccgtccgttcttgatctccttcac 732

to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                     
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcac 347
           ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 766 catggagaacatggccaaccgtccgttcttgatctccttcac 725

to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || | ||||||||||  |||||||| ||| || || | |||||||
Sbjct: 798 aggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccgaacatggag 739

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || |||||||||| |||||| |||||
Sbjct: 738 aacatggccaggcggccgttcttgagctccttaacctt 701

to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcacctt 350
            ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 2943 catggagaacatggccagccgaccgttcttaatctccttcacctt 2899

to top

>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA,
           partial cds
          Length = 583

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 329 catggagaacatggccagccgaccgttcttaatctccttcacctt 285

to top

>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein
           (CipLhcb3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1047

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||||||||||| ||| ||||||||||||||||| ||||||
Sbjct: 745 catggagaacatggccagccttccattcttgatctccttcactttgagc 697

to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 615 catggagaacatggccagccgcccgttctttatctccttcacctt 571

to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 255 gttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaa 314
           |||||| || ||||||| |||||| |||   ||||||| ||| ||||| | |||||| ||
Sbjct: 397 gttctccaatggccccttgccggtcacgatcgcctggacgaagaagccgaacatggataa 338

                                               
Query: 315 catggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||  || ||||||||||||||||||||
Sbjct: 337 catggccagcctgccattcttgatctccttcacctt 302

to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgkacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 86/100 (86%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 726 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 667

                                                   
Query: 312 gaacatggcc-agccgtccgttcttgatctccttcacctt 350
           |||||||||| || || |||||||||||||||||||||||
Sbjct: 666 gaacatggccaaggcg-ccgttcttgatctccttcacctt 628

to top

>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc
           II) mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 537

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 312 gaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||| || |||||||||||||||||||||||||||
Sbjct: 432 gaacatggccagacgaccgttcttgatctccttcaccttgagc 390

to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 729 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 670

                                                  
Query: 312 gaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||   ||||| || |||||||||||||||||||||||
Sbjct: 669 gaacgatgccaggcggccgttcttgatctccttcacctt 631

to top

>gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1100

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 986 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 927

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 926 tccttcacctt 916

to top

>gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 268 ccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgt 327
           |||| |||||||||   ||||||||  | |||||| | ||| ||||||||||| || || 
Sbjct: 731 cccttgccggtgactatggcctggacaagaaagccaaacatcgagaacatggcaaggcgg 672

                                      
Query: 328 ccgttcttgatctccttcaccttgagc 354
           |||||||||||||||||||||||||||
Sbjct: 671 ccgttcttgatctccttcaccttgagc 645

to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 268 ccctcgccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgt 327
           |||| ||||||||||  |||||||| ||| || || | |||||||||||| || |||| |
Sbjct: 761 cccttgccggtgacgatggcctggacgaagaatccgaacatggagaacatagctagcctt 702

                                      
Query: 328 ccgttcttgatctccttcaccttgagc 354
           || ||||||| ||||||||||||||||
Sbjct: 701 ccattcttgagctccttcaccttgagc 675

to top

>gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 252

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacc 348
           ||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 43  catggagaacatggccagccgaccgttcttaatctccttcacc 1

to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 252  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatgga 311
            |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||||
Sbjct: 1750 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1691

                                                   
Query: 312  gaacatggccagccgtccgttcttgatctccttcacctt 350
            ||||   ||||| || |||||||||||||||||||||||
Sbjct: 1690 gaacgatgccaggcggccgttcttgatctccttcacctt 1652

to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            ||||||||||  || ||||  |||||||||  |||||||| ||| || || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 313  aacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636

to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 815 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 756

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 755 aacatggccaaccgcccgttcttgatctccttcacctt 718

to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| |||| ||||||||||  |||||| | ||| || || | |||||| 
Sbjct: 742 aggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatggaa 683

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 682 aacatggccaagcgcccgttcttgagctccttcacctt 645

to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 309 ggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 674 ggagaacatggcaaggcggccgttcttgatctccttcaccttgagc 629

to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 1893 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 1834

                                                  
Query: 313  aacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||| ||| |||||||||||||||||||||||
Sbjct: 1833 aacatggccaaccgcccgttcttgatctccttcacctt 1796

to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                        
Query: 253  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
            ||||||||||  || ||||  |||||||||  |||||||| ||| || || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 313  aacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636

to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| || |  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 216 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 157

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 156 aacatggccaaccgcccgttcttgatctccttcacctt 119

to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 663 gagaacatggccaggcggccgttcttgatctccttcacctt 623

to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 738 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 694

to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||||||||||||| |||||||| | ||||||||||||
Sbjct: 748 catggagaacatggccagccgcccgttctttagctccttcacctt 704

to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 724 catggagaacatggccagccgaccgttcttaatctctttcacctt 680

to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 464 catggagaacatcgccagccgcccgttcttaatctccttcacctt 420

to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 747 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 703

to top

>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 600

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||| ||||  | ||||||||||||||||||||||||||||
Sbjct: 474 catggagaacatagccaatcttccgttcttgatctccttcaccttgagc 426

to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1620 catggagaacatagcgagacgcccgttcttgatctccttcaccttgagc 1572

to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 310 gagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           ||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 680 gagaacatggcaaggcgaccgttcttgatctccttcaccttgagc 636

to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 252 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagccca-gcatgg 310
           |||||||| || ||| |||| |||||| |||  |||||||| ||| ||||| | ||||| 
Sbjct: 391 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaagcatg- 333

                                                   
Query: 311 agaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| ||| ||||||||||||||||| |||||
Sbjct: 332 agaacatggccaaccgcccgttcttgatctccttgacctt 293

to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgyccgttcttgagctccttcacctt 648

to top

>emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting chlorophyll a/b protein
          Length = 681

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 315 catggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| |||||||||||||||||||||||
Sbjct: 236 catggccagccggccgttcttgatctccttcacctt 201

to top

>gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial
           cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6
           and partial cds
          Length = 1083

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1037

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 923 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 864

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 863 tccttcacctt 853

to top

>gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1102

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 988 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 929

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 928 tccttcacctt 918

to top

>gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1083

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1085

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 971 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 912

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 911 tccttcacctt 901

to top

>gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1101

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 987 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 928

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 927 tccttcacctt 917

to top

>gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and
           6 and partial cds
          Length = 1083

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and
           6 and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| ||||||||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||| || || ||||  |||||||||   ||||||| ||| || || | |||||||
Sbjct: 617 aggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaacatggag 558

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| ||||  |||||||||| |||||| |||||||||
Sbjct: 557 aacatggcaagcctgccgttcttgagctccttaaccttgagc 516

to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  ||||||||   |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  ||||||||   |||||| | ||| || || | |||||| 
Sbjct: 734 aggttctcgatgggtcccttcccggtgacaatggcctgaacgaagaatccgaacatggaa 675

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 674 aacatggccaagcgcccgttcttgatctccttcacctt 637

to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||  |||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           ||||| |||| ||| |||| |||||| |||   ||||| | ||| ||||| | |||||||
Sbjct: 634 aggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagccgaacatggag 575

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||| |||||||| |||||||| | ||||||||||||
Sbjct: 574 aacatcgccagccgcccgttctttagctccttcacctt 537

to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 285 ggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 344
           |||||||| ||| || || | ||||||||||||||||| ||| |||||||| | ||||||
Sbjct: 733 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 674

                 
Query: 345 cacctt 350
           ||||||
Sbjct: 673 cacctt 668

to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||| || || |||| |||||||||   |||||| |  || ||||| | |||||||
Sbjct: 723 aggttctccaatgggcccttgccggtgacaatggcctgcacaaagaagccaaacatggag 664

                                                     
Query: 313 aacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||| || || || |||||||||||||| |||||||||
Sbjct: 663 aacatggcgaggcggccattcttgatctccttaaccttgagc 622

to top

>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a,
             complete sequence
          Length = 16141

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 306   catggagaacatggccagccgtccgttcttgatctccttcac 347
             ||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 11294 catggagaacatggccaaccttccattcttgatctccttcac 11335

to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 285 ggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 344
           |||||||| ||| || || | ||||||||||||||||| ||| |||||||| | ||||||
Sbjct: 291 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 232

                 
Query: 345 cacctt 350
           ||||||
Sbjct: 231 cacctt 226

to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 285 ggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 344
           |||||||| ||| || || | ||| |||||||||||||  || |||||||||||||||||
Sbjct: 741 ggcctggacgaagaacccgaacattgagaacatggccaatcggccgttcttgatctcctt 682

                 
Query: 345 cacctt 350
           ||||||
Sbjct: 681 cacctt 676

to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||| ||||| || ||||||||||||||||| |||||
Sbjct: 1215 catggagaacattgccaggcggccgttcttgatctccttaacctt 1171

to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 298  aagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 4917 aagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 4861



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 298  aagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 1474 aagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 1418



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 315  catggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||| |||||||||| ||||||||||||
Sbjct: 7000 catggccagccggccgttcttgacctccttcacctt 6965



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 315 catggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||| |||||||||| ||||||||||||
Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 300  gcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttg 351
            |||||||||||  | ||||||||| || |||||||| | |||||||||||||
Sbjct: 3759 gcccagcatggccagcatggccaggcggccgttcttcacctccttcaccttg 3708

to top

>gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding protein II 2 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1147

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 298 aagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||| |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 924 aagccgagcatggagaacatagcaagacggccgttcttgatctccttgacctt 872

to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||||||||||||||||
Sbjct: 713 gagaacatagccaaccttccgttcttgatctccttcacctt 673

to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           ||||||||||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 251 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 203

to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||||  || |||||||||||||||||||||||
Sbjct: 2894 gagaacatggccaatcgcccgttcttgatctccttcacctt 2854

to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||| ||||| || || || |||||||||||||||||||||||||||
Sbjct: 72  catggaaaacattgcaagacgaccgttcttgatctccttcaccttgagc 120

to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||||||||||||||||
Sbjct: 245 gagaacatagccaaccttccgttcttgatctccttcacctt 205

to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 274 ccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttc 333
           |||||||||  |||||||| ||| || || | ||| || |||||||||| ||| ||||||
Sbjct: 758 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 699

                            
Query: 334 ttgatctccttcacctt 350
           |||| ||||||||||||
Sbjct: 698 ttgagctccttcacctt 682

to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 274 ccggtgacgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttc 333
           |||||||||  |||||||| ||| || || | ||| || |||||||||| ||| ||||||
Sbjct: 755 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 696

                            
Query: 334 ttgatctccttcacctt 350
           |||| ||||||||||||
Sbjct: 695 ttgagctccttcacctt 679

to top

>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons
            1-5, 5' end
          Length = 3122

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 298  aagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 2926 aagcccagcatggccaccatggccagacggccgttcttcacctccttcaccttgagc 2870

to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || ||||||||||||||||| |||||
Sbjct: 677 gagaacatggccaggcggccgttcttgatctccttgacctt 637

to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           ||||||||||||||| || || || |||||||||||||| |||||||||
Sbjct: 875 catggagaacatggcgaggcggccattcttgatctccttaaccttgagc 827

to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
            ||||||||||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 1114 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 1066

to top

>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1886

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 315  catggccagccgtccgttcttgatctccttcaccttgagc 354
            ||||||||| || ||||||||||||||||| |||||||||
Sbjct: 1442 catggccaggcggccgttcttgatctccttaaccttgagc 1403

to top

>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1284

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 304 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 924 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 878

to top

>gb|AF398727.1|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| |||| |||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgccttgatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398724.1|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and
           6 and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 acgtaggcctggatgaaaaagcccagcatggagaacatggccagccgtccgttcttgatc 339
           ||||| |||| |||||||||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgccttgatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 340 tccttcacctt 350
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12
           mRNA, complete cds
          Length = 1170

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 304 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 922 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 876

to top

>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11
           mRNA, complete cds
          Length = 1128

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 304 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 879 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 833

to top

>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA,
           complete cds
          Length = 1191

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 304 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 919 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 873

to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 240 gaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaa 299
           ||||||| || |||||||||| || || |||| ||||||||||   || || | ||| ||
Sbjct: 777 gaggtggtcgaacaggttctccaatgggcccttgccggtgacgatagcttgcacgaagaa 718

                                                              
Query: 300 gcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 350
            || | ||| ||||||||||| || || || ||||||||||||||||||||
Sbjct: 717 cccgaacatagagaacatggcaagacggccattcttgatctccttcacctt 667

to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 328 ccgttcttgatctccttcaccttgagc 354
           |||||||||||||||||||||||||||
Sbjct: 668 ccgttcttgatctccttcaccttgagc 642

to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                         
Query: 306 catggagaacatggcca-gccgtccgttcttgatctccttcacctt 350
           ||||||||||| ||||| |||  |||||||||||||||||||||||
Sbjct: 732 catggagaacagggccaagcctgccgttcttgatctccttcacctt 687

to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||||| ||| |||||||||| ||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgagctccttcacctt 648

to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 253 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaaaaagcccagcatggag 312
           |||||||||| ||| ||||  |||||||||   ||||| | ||| || || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgattgcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 313 aacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688

to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 1412 gagaacatggcaagacgaccgttcttgagctccttcacctt 1452

to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2615 gagaacatagccaaccttccgttcttgagctccttcacctt 2655

to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2615 gagaacatagccaaccttccgttcttgagctccttcacctt 2655

to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 723 gagaacatagccaaccttccgttcttgagctccttcacctt 683

to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 681 gagaacatagccaaccttccgttcttgagctccttcacctt 641

to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||||||  || ||||||||||||||||||||
Sbjct: 544 gagaacatagccagcctgccattcttgatctccttcacctt 504

to top

>gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence
          Length = 452

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||||||| || || |||||||||| |||||| |||||
Sbjct: 270 catggagaacatggcaagacgaccgttcttgagctcctttacctt 226

to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||| |||| || ||||||||| ||||||||||||||
Sbjct: 2246 gagaacatagccaaccttccgttcttaatctccttcacctt 2206

to top

>gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest protein mRNA,
           partial cds
          Length = 758

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 314 acatggccagccgtccgttcttgatctcc 342
           |||||||||| ||||||||||||||||||
Sbjct: 520 acatggccaggcgtccgttcttgatctcc 492

to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| ||||  | ||||||||||||||||||||||||
Sbjct: 746 gagaacatagccaatcttccgttcttgatctccttcacctt 706

to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 723 gagaacatagccaaccttccgttcttgagctccttcacctt 683

to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 671 gagaacatagccaaccttccgttcttgagctccttcacctt 631

to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 668 gagaacatggcaagacgaccgttcttgagctccttcacctt 628

to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 310   gagaacatggccagccgtccgttcttgatctccttcacctt 350
             ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 81135 gagaacatggcaagacgaccgttcttgagctccttcacctt 81175

to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 310   gagaacatggccagccgtccgttcttgatctccttcacctt 350
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 95975 gagaacatagccaaccttccgttcttgagctccttcacctt 95935



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 310   gagaacatggccagccgtccgttcttgatctccttcacctt 350
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 93333 gagaacatagccaaccttccgttcttgagctccttcacctt 93373

to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 310   gagaacatggccagccgtccgttcttgatctccttcacctt 350
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 80869 gagaacatagccaaccttccgttcttgagctccttcacctt 80829



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 310   gagaacatggccagccgtccgttcttgatctccttcacctt 350
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 78227 gagaacatagccaaccttccgttcttgagctccttcacctt 78267

to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 668 gagaacatggcaagacgaccgttcttgagctccttcacctt 628

to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688

to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 726 gagaacatggcaagacgaccgttcttgagctccttcacctt 686

to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 739 gagaacatagccaaccttccgttcttgagctccttcacctt 699

to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 391 gagaacatagccaaccttccgttcttgagctccttcacctt 351

to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 709 gagaacatggcaagacgaccgttcttgagctccttcacctt 669

to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 699 gagaacatggcaagacgaccgttcttgagctccttcacctt 659

to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 710 gagaacatagccaaccttccgttcttgagctccttcacctt 670

to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 717 gagaacatggcaagacgaccgttcttgagctccttcacctt 677

to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 711 gagaacatggcaagacgaccgttcttgagctccttcacctt 671

to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 700 gagaacatagccaaccttccgttcttgagctccttcacctt 660

to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 703 gagaacatagccaaccttccgttcttgagctccttcacctt 663

to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 716 gagaacatggcaagacgaccgttcttgagctccttcacctt 676

to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 703 gagaacatagccaaccttccgttcttgagctccttcacctt 663

to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 704 gagaacatggcaagacgaccgttcttgagctccttcacctt 664

to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 216 gagaacatagccaaccttccgttcttgagctccttcacctt 256

to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||| |||||||  |||||||| | ||||||||||||
Sbjct: 1268 catggagaacatagccagcctaccgttcttcaactccttcacctt 1224

to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 718 gagaacatggcaagacgaccgttcttgagctccttcacctt 678

to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 726 gagaacatggcaagacgaccgttcttgagctccttcacctt 686

to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||| || || |  || ||||||||||||||||||||||||
Sbjct: 905 catggagaacatagcaagtctgccattcttgatctccttcaccttgagc 857

to top

>emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b binding polypeptide of
            photosystem II (LHCP-II AB10)
          Length = 1306

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 306  catggagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||||||||||||  | ||| ||||||| ||||||||||||
Sbjct: 1022 catggagaacatggccaatcttccattcttgagctccttcacctt 978

to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 306 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 354
           |||||||||||| ||||  | ||||||||||| |||||| |||||||||
Sbjct: 747 catggagaacatagccaatcttccgttcttgagctccttaaccttgagc 699

to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 310  gagaacatggccagccgtccgttcttgatctccttcacctt 350
            |||||||| |||| || ||||||||| ||||||||||||||
Sbjct: 2247 gagaacatagccaaccttccgttcttaatctccttcacctt 2207

to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 971 gagaacatagccaaccttccgttcttgagctccttcacctt 931

to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 310 gagaacatggccagccgtccgttcttgatctccttcacctt 350
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 968 gagaacatagccaaccttccgttcttgagctccttcacctt 928


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,327,878
Number of Sequences: 3902068
Number of extensions: 3327878
Number of successful extensions: 63391
Number of sequences better than 10.0: 459
Number of HSP's better than 10.0 without gapping: 462
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62107
Number of HSP's gapped (non-prelim): 1275
length of query: 394
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 372
effective length of database: 17,147,199,772
effective search space: 6378758315184
effective search space used: 6378758315184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result