ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet39b04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_468756.1| Oryza sativa (japonica cultivar-group), mRNA 285 6e-74
2ref|XM_468752.1| Oryza sativa (japonica cultivar-group), mRNA 262 8e-67
3dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 8e-67
4dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 8e-67
5dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 8e-67
6gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence 244 2e-61
7gb|AY110589.1| Zea mays CL4331_3 mRNA sequence 244 2e-61
8gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome... 218 1e-53
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 218 1e-53
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 218 1e-53
11gb|AY109388.1| Zea mays CL4331_2 mRNA sequence 196 4e-47
12dbj|D29730.1|RICYK44 Oryza sativa mRNA, partial homologous to ri... 105 1e-19
13gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.001
14gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.001
15gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal prot... 48 0.023
16gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
17gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
18gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
19gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
20gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
21gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
22gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
23gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
24gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
25gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.092
26gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
27gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
28gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
29gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
30gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
31gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
32gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
33gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.092
34gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
35gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
36gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
37gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
38gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
39gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
40gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
41gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
42gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
43gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.092
44gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
45gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
46gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
47gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
48gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
49gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
50gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
51gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
52gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
53gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.092
54gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT1... 46 0.092
55gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete s... 42 1.4
56emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on ch... 42 1.4
57gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete s... 42 1.4
58gb|AF454262.1| Ficedula hypoleuca isolate Sp10 microsatellite Hr... 42 1.4
59gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete... 42 1.4
60gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, comple... 42 1.4
61emb|AJ012684.1|CAR012684 Cicer arietinum mRNA for 40S ribosomal ... 42 1.4
62ref|NM_125510.3| Arabidopsis thaliana structural constituent of ... 40 5.7
63ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-lik... 40 5.7
64gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds 40 5.7
65emb|AL358134.11| Human DNA sequence from clone RP11-306O13 on ch... 40 5.7
66gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds 40 5.7
67gb|AC092999.3| Homo sapiens 3 BAC RP11-170K4 (Roswell Park Cance... 40 5.7
68dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
69dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
70emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Co... 40 5.7
71emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chr... 40 5.7
72dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
73dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal prot... 40 5.7
74dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
75dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
76dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.7
77gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, com... 40 5.7
78gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome... 40 5.7
79emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chrom... 40 5.7
80gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
81gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
82gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
83gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
84gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
85gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
86gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
87gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
88gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
89gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 5.7
90emb|AL808017.4| Mouse DNA sequence from clone RP23-145G21 on chr... 40 5.7 
>ref|XM_468756.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 635

 Score =  285 bits (144), Expect = 6e-74
 Identities = 198/216 (91%)
 Strand = Plus / Minus

                                                                       
Query: 210 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 269
           ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 460 tggtccagatcacgccttccctgggaggtgatgagtcttccacccttcgggtcgacatca 401

                                                                       
Query: 270 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 329
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 400 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 341

                                                                       
Query: 330 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 389
           |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| |||
Sbjct: 340 cagaagtgcggggggcgtgagccgttcctctggcggccaccatagatcttctggaagcca 281

                                               
Query: 390 ccaatcccaattccctgcctcaggtagatcttcctt 425
           || |  ||||| ||||||||||||||||||||||||
Sbjct: 280 cctacaccaataccctgcctcaggtagatcttcctt 245
to top
>ref|XM_468752.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 829

 Score =  262 bits (132), Expect = 8e-67
 Identities = 195/216 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 269
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 483 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 424

                                                                       
Query: 270 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 329
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 423 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 364

                                                                       
Query: 330 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 389
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 363 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 304

                                               
Query: 390 ccaatcccaattccctgcctcaggtagatcttcctt 425
           || |  ||||| ||||||||||||||||||||||||
Sbjct: 303 cctacaccaataccctgcctcaggtagatcttcctt 268
to top
>dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G11, full
           insert sequence
          Length = 786

 Score =  262 bits (132), Expect = 8e-67
 Identities = 195/216 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 269
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 491 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 432

                                                                       
Query: 270 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 329
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 431 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 372

                                                                       
Query: 330 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 389
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 371 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 312

                                               
Query: 390 ccaatcccaattccctgcctcaggtagatcttcctt 425
           || |  ||||| ||||||||||||||||||||||||
Sbjct: 311 cctacaccaataccctgcctcaggtagatcttcctt 276
to top
>dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147E16, full
           insert sequence
          Length = 937

 Score =  262 bits (132), Expect = 8e-67
 Identities = 195/216 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 269
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 492 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 433

                                                                       
Query: 270 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 329
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 432 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 373

                                                                       
Query: 330 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 389
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 372 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 313

                                               
Query: 390 ccaatcccaattccctgcctcaggtagatcttcctt 425
           || |  ||||| ||||||||||||||||||||||||
Sbjct: 312 cctacaccaataccctgcctcaggtagatcttcctt 277
to top
>dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106H18, full
           insert sequence
          Length = 862

 Score =  262 bits (132), Expect = 8e-67
 Identities = 195/216 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 269
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 494 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 435

                                                                       
Query: 270 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 329
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 434 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 375

                                                                       
Query: 330 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 389
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 374 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 315

                                               
Query: 390 ccaatcccaattccctgcctcaggtagatcttcctt 425
           || |  ||||| ||||||||||||||||||||||||
Sbjct: 314 cctacaccaataccctgcctcaggtagatcttcctt 279
to top
>gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence
          Length = 737

 Score =  244 bits (123), Expect = 2e-61
 Identities = 201/227 (88%)
 Strand = Plus / Minus

                                                                       
Query: 199 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 258
           ||||||| |||||||| ||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 488 ttccagccacctggtccagatcacgccttccctgggaggtgaggcgccgtccacccttgg 429

                                                                       
Query: 259 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 318
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 428 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 369

                                                                       
Query: 319 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 378
           ||||||||||||||||||| || |||||||| || |||||||| ||||||||||| ||||
Sbjct: 368 cactgctcttgcagaagtgaggtgggcgtgagccattcctctggcggccaccataaatct 309

                                                          
Query: 379 tctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
           ||||||| |||||||  ||||| || || |||| |||||||||||||
Sbjct: 308 tctggaagccaccaacaccaatgccttgtctcaagtagatcttcctt 262
to top
>gb|AY110589.1| Zea mays CL4331_3 mRNA sequence
          Length = 860

 Score =  244 bits (123), Expect = 2e-61
 Identities = 201/227 (88%)
 Strand = Plus / Plus

                                                                       
Query: 199 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 258
           ||||||| |||||||| ||||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 387 ttccagccacctggtccagatcacgccttccctgggaggtgatgcgccgtccacccttgg 446

                                                                       
Query: 259 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 318
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 447 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 506

                                                                       
Query: 319 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 378
           ||||||||||||||||||| || ||||| || || |||||||| ||||||||||| ||||
Sbjct: 507 cactgctcttgcagaagtgaggtgggcgggagccattcctctggcggccaccataaatct 566

                                                          
Query: 379 tctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
           ||||||| |||||||  ||||| || || |||| |||||||||||||
Sbjct: 567 tctggaagccaccaacaccaatgccttgtctcaagtagatcttcctt 613
to top
>gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0032H19
             map E30331S, complete sequence
          Length = 164820

 Score =  218 bits (110), Expect = 1e-53
 Identities = 158/174 (90%)
 Strand = Plus / Plus

                                                                         
Query: 252   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
             ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 23077 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 23136

                                                                         
Query: 312   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
             | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 23137 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 23196

                                                                   
Query: 372   tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
             |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 23197 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 23250



 Score =  202 bits (102), Expect = 7e-49
 Identities = 156/174 (89%)
 Strand = Plus / Plus

                                                                         
Query: 252   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
             ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 35214 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 35273

                                                                         
Query: 312   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
             | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 35274 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 35333

                                                                   
Query: 372   tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
             |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 35334 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 35387



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                        
Query: 210   tggtcaagatcacgccttccctgggaggtgatgagccttccac 252
             ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 22951 tggtccagatcacgccttccctgggaggtgatgagtcttccac 22993



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                      
Query: 210   tggtcaagatcacgccttccctgggaggtgatgagccttcc 250
             ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 35094 tggtccagatcacgccttccctgggaggtgatgagtcttcc 35134
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  218 bits (110), Expect = 1e-53
 Identities = 158/174 (90%)
 Strand = Plus / Minus

                                                                            
Query: 252      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17540666 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17540607

                                                                            
Query: 312      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 17540606 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17540547

                                                                      
Query: 372      tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
                |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 17540546 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 17540493



 Score =  202 bits (102), Expect = 7e-49
 Identities = 156/174 (89%)
 Strand = Plus / Minus

                                                                            
Query: 252      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17528529 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17528470

                                                                            
Query: 312      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 17528469 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17528410

                                                                      
Query: 372      tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
                |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 17528409 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 17528356



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 210      tggtcaagatcacgccttccctgggaggtgatgagccttccac 252
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17540792 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17540750



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 210      tggtcaagatcacgccttccctgggaggtgatgagccttcc 250
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17528649 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17528609
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  218 bits (110), Expect = 1e-53
 Identities = 158/174 (90%)
 Strand = Plus / Minus

                                                                            
Query: 252      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17534207 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17534148

                                                                            
Query: 312      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 17534147 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17534088

                                                                      
Query: 372      tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
                |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 17534087 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 17534034



 Score =  202 bits (102), Expect = 7e-49
 Identities = 156/174 (89%)
 Strand = Plus / Minus

                                                                            
Query: 252      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 311
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17522070 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17522011

                                                                            
Query: 312      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 371
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 17522010 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17521951

                                                                      
Query: 372      tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
                |||||||||||||| ||||| |  ||||| ||||||||||||||||||||||||
Sbjct: 17521950 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttcctt 17521897



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 210      tggtcaagatcacgccttccctgggaggtgatgagccttccac 252
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17534333 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17534291



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 210      tggtcaagatcacgccttccctgggaggtgatgagccttcc 250
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17522190 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17522150
to top
>gb|AY109388.1| Zea mays CL4331_2 mRNA sequence
          Length = 1008

 Score =  196 bits (99), Expect = 4e-47
 Identities = 195/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 199 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 258
           ||||||| || ||||| ||||||||||||||||||  ||||||||| | |||||||||||
Sbjct: 223 ttccagccacttggtccagatcacgccttccctggttggtgatgaggcgtccacccttgg 282

                                                                       
Query: 259 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 318
           | |||||||| |||||||||||  |||||| || ||| ||||||||||| ||||  ||||
Sbjct: 283 gatcgacatcgatgatgcccataatctgcagctgctgcaggatgttgcgtgaaatggcac 342

                                                                       
Query: 319 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 378
           |||||||||||||||||||||| ||||| || || |||||||| |||||||| |||||||
Sbjct: 343 cactgctcttgcagaagtgtggtgggcgggagccattcctctggcggccaccgtagatct 402

                                                          
Query: 379 tctggaatccaccaatcccaattccctgcctcaggtagatcttcctt 425
           |||| || ||||| |  || || || ||||| |||||||||||||||
Sbjct: 403 tctgaaagccacccacaccgatgccttgccttaggtagatcttcctt 449
to top
>dbj|D29730.1|RICYK44 Oryza sativa mRNA, partial homologous to ribosomal protein S19 gene
          Length = 314

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 345 cgtgaaccgttcctctgacggccaccatagatcttctggaatccaccaatcccaattccc 404
           ||||| ||||||||||| ||||||||||||||||||||||| ||||| |  ||||| |||
Sbjct: 314 cgtgagccgttcctctggcggccaccatagatcttctggaagccacctacaccaataccc 255

                                
Query: 405 tgcctcaggtagatcttcctt 425
           |||||||||||||||||||||
Sbjct: 254 tgcctcaggtagatcttcctt 234
to top
>gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete sequence
          Length = 672

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 304
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 417 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 358

                                         
Query: 305 gcgggaaacagcaccactgctcttgcagaa 334
           ||| | ||| | ||||||||||||||||||
Sbjct: 357 gcgtgcaactgaaccactgctcttgcagaa 328
to top
>gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete cds
          Length = 398

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 304
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 119 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 60

                                         
Query: 305 gcgggaaacagcaccactgctcttgcagaa 334
           ||| | ||| | ||||||||||||||||||
Sbjct: 59  gcgtgcaactgaaccactgctcttgcagaa 30
to top
>gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal protein S19-like mRNA,
           complete cds
          Length = 759

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 283 tctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaa 334
           ||||||| | ||||||||||| ||| | ||| | ||||||||||||||||||
Sbjct: 380 tctgcaattgctgaaggatgtggcgtgcaactgaaccactgctcttgcagaa 329
to top
>gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277b allele, partial cds
          Length = 1409

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277a allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276b allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 777 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 718

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 717 ttgcaaaagtg 707
to top
>gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276a allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235a allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 781 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 722

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 721 ttgcaaaagtg 711
to top
>gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234a allele, partial cds
          Length = 1402

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233b allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT189) gene, partial
           cds
          Length = 1543

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 326
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 327 ttgcagaagtg 337
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete sequence
          Length = 115362

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 314   agcaccactgctcttgcagaa 334
             |||||||||||||||||||||
Sbjct: 53651 agcaccactgctcttgcagaa 53671
to top
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the
             PPIP11 gene for peptidylprolyl isomerase (cyclophilin)
             pseudogene 11 and a CpG island, complete sequence
          Length = 81304

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 115   ataattcaaaactgtagccaa 135
             |||||||||||||||||||||
Sbjct: 34162 ataattcaaaactgtagccaa 34142
to top
>gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete sequence
          Length = 116174

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 314   agcaccactgctcttgcagaa 334
             |||||||||||||||||||||
Sbjct: 62524 agcaccactgctcttgcagaa 62504
to top
>gb|AF454262.1| Ficedula hypoleuca isolate Sp10 microsatellite HrU3 sequence
          Length = 167

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 9   tcccaggcgggcagataattaaaaa 33
           ||||||||||| |||||||||||||
Sbjct: 102 tcccaggcggggagataattaaaaa 126
to top
>gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete sequence
          Length = 184471

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 24     taattaaaaactcagacaatt 44
              |||||||||||||||||||||
Sbjct: 160083 taattaaaaactcagacaatt 160063
to top
>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence
          Length = 172705

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  actgctcttgcagaagtgtgg 340
            |||||||||||||||||||||
Sbjct: 2468 actgctcttgcagaagtgtgg 2488
to top
>emb|AJ012684.1|CAR012684 Cicer arietinum mRNA for 40S ribosomal protein S19, partial
          Length = 550

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 317 accactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagat 376
           |||||||||||||||||| || || || ||   |||||||||||| |  |||||||| ||
Sbjct: 181 accactgctcttgcagaaatgaggtggccgactaccgttcctctggctcccaccataaat 122

                    
Query: 377 cttctggaa 385
           | |||||||
Sbjct: 121 cctctggaa 113
to top
>ref|NM_125510.3| Arabidopsis thaliana structural constituent of ribosome AT5G61170
           mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 311 aacagcaccactgctcttgcagaa 334
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-like suppressor
           (LOC478677), mRNA
          Length = 694

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 285 tgcaactcctgaaggatgttgcgggaaa 312
           ||||||| ||||||||||||| ||||||
Sbjct: 244 tgcaactgctgaaggatgttgtgggaaa 271
to top
>gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds
          Length = 432

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 311 aacagcaccactgctcttgcagaa 334
           |||| |||||||||||||||||||
Sbjct: 300 aacaccaccactgctcttgcagaa 277
to top
>emb|AL358134.11| Human DNA sequence from clone RP11-306O13 on chromosome 6, complete
             sequence
          Length = 144828

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ttaaaaactcagacaattaa 46
             ||||||||||||||||||||
Sbjct: 46411 ttaaaaactcagacaattaa 46430
to top
>gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds
          Length = 7392

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 314  agcaccactgctcttgcaga 333
            ||||||||||||||||||||
Sbjct: 2817 agcaccactgctcttgcaga 2798
to top
>gb|AC092999.3| Homo sapiens 3 BAC RP11-170K4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167084

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     taaaaactcagacaattaac 47
              ||||||||||||||||||||
Sbjct: 126331 taaaaactcagacaattaac 126350
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 91       cataacaaacacagggaggg 110
                ||||||||||||||||||||
Sbjct: 28400536 cataacaaacacagggaggg 28400555
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 316     caccactgctcttgcagaag 335
               ||||||||||||||||||||
Sbjct: 3306778 caccactgctcttgcagaag 3306759
to top
>emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 645

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 311 aacagcaccactgctcttgcagaa 334
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chromosome 11, complete
             sequence
          Length = 154608

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    cataacaaacacagggaggg 110
             ||||||||||||||||||||
Sbjct: 27471 cataacaaacacagggaggg 27452
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0015I14
          Length = 150650

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   caccactgctcttgcagaag 335
             ||||||||||||||||||||
Sbjct: 94141 caccactgctcttgcagaag 94122
to top
>dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal protein S19 - like,
           complete cds, clone: RAFL22-68-D20
          Length = 737

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 311 aacagcaccactgctcttgcagaa 334
           |||| |||||||||||||||||||
Sbjct: 370 aacaccaccactgctcttgcagaa 347
to top
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0044E16
          Length = 153296

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     cataacaaacacagggaggg 110
              ||||||||||||||||||||
Sbjct: 129342 cataacaaacacagggaggg 129361
to top
>dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
            fosmid clone:OSJNOa199K18
          Length = 39582

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   cataacaaacacagggaggg 110
            ||||||||||||||||||||
Sbjct: 5338 cataacaaacacagggaggg 5357
to top
>dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19
          Length = 78379

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 311   aacagcaccactgctcttgcagaa 334
             |||| |||||||||||||||||||
Sbjct: 60721 aacaccaccactgctcttgcagaa 60698
to top
>gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, complete sequence
          Length = 196053

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    ccctgggaggtgatgagcct 247
              ||||||||||||||||||||
Sbjct: 127161 ccctgggaggtgatgagcct 127180
to top
>gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome 17, complete sequence
          Length = 213263

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   agcaccactgctcttgcaga 333
             ||||||||||||||||||||
Sbjct: 85787 agcaccactgctcttgcaga 85768
to top
>emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chromosome 16, complete
              sequence
          Length = 257276

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 314    agcaccactgctcttgcaga 333
              ||||||||||||||||||||
Sbjct: 168365 agcaccactgctcttgcaga 168384
to top
>gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 282 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 337
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>emb|AL808017.4| Mouse DNA sequence from clone RP23-145G21 on chromosome X, complete
              sequence
          Length = 183291

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     ttaaaaactcagacaattaa 46
              ||||||||||||||||||||
Sbjct: 165612 ttaaaaactcagacaattaa 165631


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,989,404
Number of Sequences: 3902068
Number of extensions: 3989404
Number of successful extensions: 76933
Number of sequences better than 10.0: 92
Number of HSP's better than 10.0 without gapping: 91
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 76750
Number of HSP's gapped (non-prelim): 181
length of query: 425
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 403
effective length of database: 17,147,199,772
effective search space: 6910321508116
effective search space used: 6910321508116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top