ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet38g01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds;... 125 1e-25
2gb|AY108838.1| Zea mays PCO101143 mRNA sequence 125 1e-25
3gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1... 86 1e-13
4gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA... 86 1e-13
5gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N... 86 1e-13
6dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond... 86 1e-13
7dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondri... 86 1e-13
8gb|AF387182.1|AF387182 Viburnum sp. Qiu95083 ribosomal protein L... 82 2e-12
9gb|AF387175.1|AF387175 Platanus occidentalis ribosomal protein L... 82 2e-12
10gb|AF387174.1|AF387174 Dicentra sp. Qiu 95026 ribosomal protein ... 82 2e-12
11gb|AF387183.1|AF387183 Lonicera sp. Palmer 679 ribosomal protein... 78 3e-11
12gb|AF387180.1|AF387180 Diospyros virginiana ribosomal protein L2... 74 4e-10
13gb|AF387184.1|AF387184 Abutilon theophrasti ribosomal protein L2... 70 6e-09
14gb|AF387185.1|AF387185 Quercus alba ribosomal protein L2 (rpl2) ... 68 3e-08
15gb|AF387179.1|AF387179 Hydrangea arborescens ribosomal protein L... 66 1e-07
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
17dbj|AP002521.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
18dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
19gb|AY109618.1| Zea mays CL8996_1 mRNA sequence 62 2e-06
20dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete ge... 62 2e-06
21emb|AJ295995.1|TAE295995 Triticum aestivum mitochondrial partial... 62 2e-06
22gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 58 2e-05
23ref|NM_114978.1| Arabidopsis thaliana structural constituent of ... 56 1e-04
24gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part... 56 1e-04
25emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B... 56 1e-04
26gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At... 56 1e-04
27gb|AF387177.1|AF387177 Corylopsis glabrescens f. gotoana ribosom... 56 1e-04
28gb|AY105581.1| Zea mays PCO150618 mRNA sequence 56 1e-04
29dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase... 54 4e-04
30gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ... 52 0.001
31gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ... 52 0.001
32gb|BT012998.1| Lycopersicon esculentum clone 114219R, mRNA sequence 52 0.001
33gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 52 0.001
34gb|AY044159.1| Lycopersicon esculentum ribosomal protein L2 gene... 52 0.001
35gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds 52 0.001
36gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR... 52 0.001
37dbj|AB251495.1| Physcomitrella patens mitochondrial DNA, complet... 52 0.001
38gb|CP000088.1| Thermobifida fusca YX, complete genome 50 0.006
39ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti... 48 0.023
40gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ... 48 0.023
41gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ... 48 0.023
42emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2 48 0.023
43gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 48 0.023
44gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 48 0.023
45gb|AF387178.1|AF387178 Cornus foemina ribosomal protein L2 (rpl2... 48 0.023
46gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 48 0.023
47dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.023
48emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co... 48 0.023
49emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co... 48 0.023
50emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co... 48 0.023
51emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co... 48 0.023
52emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co... 48 0.023
53dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.023
54dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.023
55gb|AY108123.1| Zea mays PCO067267 mRNA sequence 48 0.023
56gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.023
57emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa... 48 0.023
58emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1 48 0.023
59gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 48 0.023
60ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predi... 46 0.092
61gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein... 46 0.092
62emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 46 0.092
63gb|AY147698.1| Mayaca fluviatilis ribosomal protein L2 (rpl2) ge... 44 0.36
64ref|XM_790908.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.36
65dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 44 0.36
66gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 44 0.36
67dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 44 0.36
68gb|DQ206555.1| Leucosolenia sp. AR-2003 isolate TOA23 ribosomal ... 44 0.36
69gb|AE017221.1| Thermus thermophilus HB27, complete genome 44 0.36
70gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e... 44 0.36
71gb|AY147721.1| Allium textile ribosomal protein L2 (rpl2) gene, ... 42 1.4
72gb|AY596744.1| Lepistemon owariensis ribosomal protein L2 (rpl2)... 42 1.4
73gb|DQ069411.1| Nuphar advena ribosomal protein L2 (rpl2) gene, p... 42 1.4
74ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM062... 42 1.4
75gb|AY007489.1| Austrobaileya scandens ribosomal protein L2 (rpl2... 42 1.4
76emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on ... 42 1.4
77gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 1.4
78gb|AF426458.1| Primary endosymbiont of Sitophilus zeamais riboso... 42 1.4
79emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete ... 42 1.4
80emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BA... 42 1.4
81emb|AJ627251.1| Nymphaea alba chloroplast, complete genome 42 1.4
82gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 42 1.4
83gb|AF188855.1|AF188855 Nymphaea odorata ribosomal protein L2 (rp... 42 1.4
84emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in... 42 1.4
85gb|AF123787.1|AF123787 Cabomba caroliniana ribosomal protein L2 ... 42 1.4
86gb|AY007498.1| Schisandra chinensis ribosomal protein L2 (rpl2) ... 42 1.4
87gb|AY007491.1| Gunnera chilensis ribosomal protein L2 (rpl2) gen... 42 1.4
88gb|AY007488.1| Arabidopsis thaliana ribosomal protein L2 (rpl2) ... 42 1.4
89emb|BX088532.7| Zebrafish DNA sequence from clone CH211-127E17 i... 42 1.4
90emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1 42 1.4
91emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1 42 1.4
92emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1 42 1.4
93emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1 42 1.4
94emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1 42 1.4
95emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1 42 1.4
96emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1 42 1.4
97emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1 42 1.4
98emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1 42 1.4
99emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1 42 1.4
100emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1 42 1.4
101emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1 42 1.4
102emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1 42 1.4
103dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, co... 42 1.4
104emb|AJ343462.1|HSA343462 Homo sapiens genomic sequence surroundi... 42 1.4
105ref|XM_474323.1| Oryza sativa (japonica cultivar-group), predic... 40 5.7
106gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 40 5.7
107gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds 40 5.7
108gb|AY389974.1| Latimeria chalumnae ribosomal protein L8 mRNA, pa... 40 5.7
109gb|AY658799.1| Synthetic construct Peudomonas aeruginosa clone F... 40 5.7
110gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA 40 5.7
111gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA... 40 5.7
112ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA 40 5.7
113gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, com... 40 5.7
114gb|AY267353.1| Chara vulgaris mitochondrion, complete genome 40 5.7
115emb|AL606457.3|OSJN00002 Oryza sativa genomic DNA, chromosome 4,... 40 5.7
116gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 40 5.7
117gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell... 40 5.7
118ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG... 40 5.7
119ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG... 40 5.7
120gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA 40 5.7
121gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome 40 5.7
122gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.7
123gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA 40 5.7
124dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
125emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Co... 40 5.7
126gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, co... 40 5.7
127gb|AE004841.1| Pseudomonas aeruginosa PAO1, section 402 of 529 o... 40 5.7
128dbj|AK119773.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.7
129emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 5.7
130gb|AC115021.15| Mus musculus chromosome 3, clone RP24-232N19, co... 40 5.7
131dbj|AK059048.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.7
132gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal pro... 40 5.7
133emb|AL732344.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 5.7
134gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ... 40 5.7
135gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal pro... 40 5.7
136emb|AL355112.4|CNS05TCB Human chromosome 14 DNA sequence BAC R-1... 40 5.7
137emb|AL683809.7| Mouse DNA sequence from clone RP23-440B21 on chr... 40 5.7
138emb|AL352984.4|CNS05TC2 Human chromosome 14 DNA sequence BAC R-1... 40 5.7
139emb|AL669969.14| Mouse DNA sequence from clone RP23-254J18 on ch... 40 5.7

>gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds; nuclear gene for
            mitochondrial product
          Length = 1347

 Score =  125 bits (63), Expect = 1e-25
 Identities = 156/187 (83%)
 Strand = Plus / Minus

                                                                        
Query: 236  taccctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgc 295
            |||||||| ||||||||||| |||||||| || || || |||||||| || || || |||
Sbjct: 1280 taccctgctttggtgggctttccccagggagaaactgaaggcctgcctcctttagtacgc 1221

                                                                        
Query: 296  ccctcgcctcctccatggggatggtccaccgggttcatcgccacaccacggacgaccggc 355
            ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 1220 ccctcgcctccaccatggggatgatccacaggattcatagcaacaccacggacaacaggg 1161

                                                                        
Query: 356  cgcctgcccagccaccggctgtgccctgccttcctcagcttccgcgcaccgtgggtcggg 415
            || ||||| | ||||| ||||||||||||||| || ||||| || | ||| ||| | |||
Sbjct: 1160 cgtctgcctaaccacctgctgtgccctgcctttcttagcttgcgtgtaccatggcttggg 1101

                   
Query: 416  ttggaga 422
            |||||||
Sbjct: 1100 ttggaga 1094



to top

>gb|AY108838.1| Zea mays PCO101143 mRNA sequence
          Length = 985

 Score =  125 bits (63), Expect = 1e-25
 Identities = 156/187 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 taccctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgc 295
           |||||||| ||||||||||| |||||||| || || || |||||||| || || || |||
Sbjct: 541 taccctgctttggtgggctttccccagggagaaactgaaggcctgcctcctttagtacgc 482

                                                                       
Query: 296 ccctcgcctcctccatggggatggtccaccgggttcatcgccacaccacggacgaccggc 355
           ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 481 ccctcgcctccaccatggggatgatccacaggattcatagcaacaccacggacaacaggg 422

                                                                       
Query: 356 cgcctgcccagccaccggctgtgccctgccttcctcagcttccgcgcaccgtgggtcggg 415
           || ||||| | ||||| ||||||||||||||| || ||||| || | ||| ||| | |||
Sbjct: 421 cgtctgcctaaccacctgctgtgccctgcctttcttagcttgcgtgtaccatggcttggg 362

                  
Query: 416 ttggaga 422
           |||||||
Sbjct: 361 ttggaga 355



to top

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                          
Query: 239    cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
              ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 298602 cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 298543

                                                             
Query: 299    tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
              || ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 298542 tcacctcctccatgaggatgatccactggattcattgcaacaccacg 298496



to top

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                          
Query: 239    cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
              ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 297792 cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 297733

                                                             
Query: 299    tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
              || ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 297732 tcacctcctccatgaggatgatccactggattcattgcaacaccacg 297686



to top

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                          
Query: 239    cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
              ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 297789 cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 297730

                                                             
Query: 299    tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
              || ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 297729 tcacctcctccatgaggatgatccactggattcattgcaacaccacg 297683



to top

>dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochondrial DNA, complete genome
          Length = 490520

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                          
Query: 239    cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
              ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 297641 cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 297582

                                                             
Query: 299    tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
              || ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 297581 tcacctcctccatgaggatgatccactggattcattgcaacaccacg 297535



to top

>dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondrial DNA for
            ribosomal protein L2, ribosomal protein S19, complete cds
          Length = 4565

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
            ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 4068 cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 4009

                                                           
Query: 299  tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
            || ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 4008 tcacctcctccatgaggatgatccactggattcattgcaacaccacg 3962



to top

>gb|AF387182.1|AF387182 Viburnum sp. Qiu95083 ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 608

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcct 304
           ||||||||||||||||| || |||||||| || || || || || ||||||||||| |||
Sbjct: 598 ttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccctcacct 539

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 538 cctccatgaggatgatccactggattcattgcaacaccacg 498



to top

>gb|AF387175.1|AF387175 Platanus occidentalis ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 538

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcct 304
           ||||||||||||||||| || |||||||| || || || || || ||||||||||| |||
Sbjct: 536 ttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccctcacct 477

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 476 cctccatgaggatgatccactggattcattgcaacaccacg 436



to top

>gb|AF387174.1|AF387174 Dicentra sp. Qiu 95026 ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 559

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcct 304
           ||||||||||||||||| || |||||||| || || || || || ||||||||||| |||
Sbjct: 543 ttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccctcacct 484

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 483 cctccatgaggatgatccactggattcattgcaacaccacg 443



to top

>gb|AF387183.1|AF387183 Lonicera sp. Palmer 679 ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 600

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                       
Query: 239 cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
           ||||| ||||||||||||||||| || |||||||| || || || || || |||||||||
Sbjct: 11  cctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 70

                                                          
Query: 299 tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           || ||||||||||| ||||| | ||| || ||||| || ||||||||
Sbjct: 71  tcacctcctccatgaggatgattcactggattcattgcaacaccacg 117



to top

>gb|AF387180.1|AF387180 Diospyros virginiana ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 584

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcct 304
           ||||||||||| ||||| || |||||||| || || || || || ||||||||||| |||
Sbjct: 564 ttggtgggctttccccaaggtgacaccgaaggtctacctcctttcgtgcgcccctcacct 505

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 504 cctccatgaggatgatccactggattcattgcaacaccacg 464



to top

>gb|AF387184.1|AF387184 Abutilon theophrasti ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 457

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
           ||||| |||||||||||||| || || |||||||| || || || || || |||||||||
Sbjct: 456 cctgctttggtgggcttccctcaaggtgacaccgaaggtctacctcctttcgtgcgcccc 397

                                                          
Query: 299 tcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           || ||||||||||| ||||| ||||| || || || || ||||||||
Sbjct: 396 tcacctcctccatgaggatgatccactggattgattgcaacaccacg 350



to top

>gb|AF387185.1|AF387185 Quercus alba ribosomal protein L2 (rpl2) mitochondrial pseudogene,
           partial sequence
          Length = 541

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 244 cttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcc 303
           ||||||||||||||| || || || ||||| || || || || || ||||||||||| ||
Sbjct: 539 cttggtgggcttccctcaaggtgaaaccgaaggtctacctcctttcgtgcgcccctcacc 480

                                                     
Query: 304 tcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 479 tcctccatgaggatgatccactggattcattgcaacaccacg 438



to top

>gb|AF387179.1|AF387179 Hydrangea arborescens ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 591

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 244 cttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcc 303
           |||||||||||||||||| |  |||||||| || || || || || ||||||||||| ||
Sbjct: 590 cttggtgggcttcccccaagctgacaccgaaggtctacctcctttcgtgcgcccctcccc 531

                                
Query: 304 tcctccatggggatggtccac 324
           ||||||||| ||||| |||||
Sbjct: 530 tcctccatgaggatgatccac 510



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                           
Query: 240     ctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccct 299
               |||| ||||||||||||||||| || |||||||| || || || || || |||| |||||
Sbjct: 3076024 ctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcacccct 3075965

                                        
Query: 300     cgcctcctccatggggatggtccac 324
               | ||||||||||| ||||| |||||
Sbjct: 3075964 cacctcctccatgaggatgatccac 3075940



to top

>dbj|AP002521.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0041E11
          Length = 146335

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccct 299
             |||| ||||||||||||||||| || |||||||| || || || || || |||| |||||
Sbjct: 19812 ctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcacccct 19753

                                      
Query: 300   cgcctcctccatggggatggtccac 324
             | ||||||||||| ||||| |||||
Sbjct: 19752 cacctcctccatgaggatgatccac 19728



to top

>dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0433F09
          Length = 150150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccct 299
             |||| ||||||||||||||||| || |||||||| || || || || || |||| |||||
Sbjct: 44064 ctgctttggtgggcttcccccaaggtgacaccgaaggtctacctcctttcgtgcacccct 44005

                                      
Query: 300   cgcctcctccatggggatggtccac 324
             | ||||||||||| ||||| |||||
Sbjct: 44004 cacctcctccatgaggatgatccac 43980



to top

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacggac 348
           |||||||| |||||||| ||||| |||||||| ||||||||||||||
Sbjct: 716 cctcctccgtggggatgctccacggggttcatggccacaccacggac 670



to top

>dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete genome
          Length = 452528

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                          
Query: 239    cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
              ||||| |||||| |||| ||||| || |||||||| || || || || || |||||||||
Sbjct: 283484 cctgctttggtgagctttccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 283543

                                                 
Query: 299    tcgcctcctccatggggatggtccaccgggttcat 333
              || ||||||||||| ||||| ||||| || |||||
Sbjct: 283544 tcacctcctccatgaggatgatccactggattcat 283578



to top

>emb|AJ295995.1|TAE295995 Triticum aestivum mitochondrial partial rpl2 pseudogene
          Length = 659

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 cctgccttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccc 298
           ||||| |||||| |||| ||||| || |||||||| || || || || || |||||||||
Sbjct: 267 cctgctttggtgagctttccccaaggtgacaccgaaggtctacctcctttcgtgcgcccc 208

                                              
Query: 299 tcgcctcctccatggggatggtccaccgggttcat 333
           || ||||||||||| ||||| ||||| || |||||
Sbjct: 207 tcacctcctccatgaggatgatccactggattcat 173



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                                
Query: 317     tggtccaccgggttcatcgccacaccacggacg 349
               |||||||||||||||||| ||||||||||||||
Sbjct: 4640534 tggtccaccgggttcatcaccacaccacggacg 4640502



to top

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190
           mRNA, complete cds
          Length = 783

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| ||||| ||||||||||| ||||||||
Sbjct: 644 cctcctccgtggggatgttccactgggttcatcgcaacaccacg 601



to top

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 125 cctcctccgtggggatgctccacagggttcatggccacaccacg 82



to top

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 302   cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
             |||||||| |||||||| ||||| ||||||||||| ||||||||
Sbjct: 76070 cctcctccgtggggatgttccactgggttcatcgcaacaccacg 76113



to top

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| ||||| ||||||||||| ||||||||
Sbjct: 644 cctcctccgtggggatgttccactgggttcatcgcaacaccacg 601



to top

>gb|AF387177.1|AF387177 Corylopsis glabrescens f. gotoana ribosomal protein L2 (rpl2)
           mitochondrial pseudogene, partial sequence
          Length = 522

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 290 gtgcgcccctcgcctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 512 gtgcgcccctcacctcctccatgaggatgatccactggattcattgcaacaccacg 457



to top

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 712 cctcctccgtggggatgctccacagggttcatggccacaccacg 669



to top

>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory
            subunit, complete cds
          Length = 2300

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 311  tggggatggtccaccgggttcatcgccacaccacg 345
            |||||||||||||| |||||||| |||||||||||
Sbjct: 1971 tggggatggtccacagggttcattgccacaccacg 1937



to top

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 299 tcgcctcctccatggggatggtccaccgggttcatcgccacaccacggac 348
           |||||||||||   |||||| ||||| |||||||| ||||||||||||||
Sbjct: 694 tcgcctcctccgaagggatgctccacagggttcatggccacaccacggac 645



to top

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 299 tcgcctcctccatggggatggtccaccgggttcatcgccacaccacggac 348
           |||||||||||   |||||| ||||| |||||||| ||||||||||||||
Sbjct: 694 tcgcctcctccgaagggatgctccacagggttcatggccacaccacggac 645



to top

>gb|BT012998.1| Lycopersicon esculentum clone 114219R, mRNA sequence
          Length = 929

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||||||||
Sbjct: 537 ccatgtggatgatccaccggattcatcgccacaccacg 500



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                     
Query: 296     ccctcgcctcctccatggggatggtccaccgggttcatcgccacaccacggacg 349
               |||||||| || ||||| || || ||||||||||||||  ||||||||||||||
Sbjct: 4233996 ccctcgccaccgccatgcgggtgatccaccgggttcataaccacaccacggacg 4234049



to top

>gb|AY044159.1| Lycopersicon esculentum ribosomal protein L2 gene, complete cds;
           nuclear gene for mitochondrial product
          Length = 689

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||||||||
Sbjct: 574 ccatgtggatgatccaccggattcatcgccacaccacg 537



to top

>gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds
          Length = 717

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| |||||||| |||||||||||
Sbjct: 635 ccatggggatgctccacagggttcatagccacaccacg 598



to top

>gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mRNA, partial cds
          Length = 543

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacggacg 349
           ||||||||||| || || |||||||| |||||||||||||||
Sbjct: 476 ccatggggatgctcaacggggttcatagccacaccacggacg 435



to top

>dbj|AB251495.1| Physcomitrella patens mitochondrial DNA, complete genome
          Length = 105340

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 245   ttggtgggcttcccccagggcgacaccgacggcctgccgcccttggtgcgcccctcgcct 304
             |||| |||||| ||||| || || ||||| || || || || || ||||| || ||||||
Sbjct: 93722 ttggcgggctttccccaaggtgataccgaaggtctacctcctttcgtgcgtccttcgcct 93663

                                                   
Query: 305   cctccatggggatggtccaccgggttcatcgccacacc 342
             |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 93662 cctccatgaggatgatccaccggattcatagcaacacc 93625



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 325     cgggttcatcgccacaccacggacg 349
               |||||||||||||||||||||||||
Sbjct: 3106247 cgggttcatcgccacaccacggacg 3106271



to top

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           AT2G18020 (EMB2296) mRNA, complete cds
          Length = 968

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 688 cctcctccatgaggatgctccactggattcatagccacaccacg 645



to top

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| ||||| |||||||| ||||||||||||||
Sbjct: 702 gggatgctccacagggttcatggccacaccacggac 667



to top

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| ||||| |||||||| ||||||||||||||
Sbjct: 654 gggatgctccacagggttcatggccacaccacggac 619



to top

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 705 cctcctccatgaggatgctccactggattcatagccacaccacg 662



to top

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 688 cctcctccatgaggatgctccactggattcatagccacaccacg 645



to top

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 302   cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
             ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 37865 cctcctccatgaggatgctccactggattcatagccacaccacg 37908



to top

>gb|AF387178.1|AF387178 Cornus foemina ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 523

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 290 gtgcgcccctcgcctcctccatggggatggtccaccgggttcat 333
           ||||||||||| ||||||||||| ||||| ||||| || |||||
Sbjct: 502 gtgcgcccctcacctcctccatgaggatgatccactggattcat 459



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                          
Query: 290    gtgcgcccctcgcctcctccatggggatggtccaccgggttcatcgccacaccacggacg 349
              |||||||||||||| || || || || || || |||||||||||| | ||||||||||||
Sbjct: 439940 gtgcgcccctcgccaccgccgtgcgggtgatcgaccgggttcatcacgacaccacggacg 439881



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 302      cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
                |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 23385102 cctcctccgtggggatgctcaacggggttcatggccacaccacg 23385059



to top

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 666 cctcctccatgaggatgctccactggattcatagccacaccacg 623



to top

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 652 cctcctccatgaggatgctccactggattcatagccacaccacg 609



to top

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 666 cctcctccatgaggatgctccactggattcatagccacaccacg 623



to top

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 659 cctcctccatgaggatgctccactggattcatagccacaccacg 616



to top

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 637 cctcctccatgaggatgctccactggattcatagccacaccacg 594



to top

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 706 cctcctccgtggggatgctcaacggggttcatggccacaccacg 663



to top

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 707 cctcctccgtggggatgctcaacggggttcatggccacaccacg 664



to top

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| || || |||||||| |||||||||||
Sbjct: 737 cctcctccatgaggatgctcaacagggttcatggccacaccacg 694



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 302      cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
                |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 23313293 cctcctccgtggggatgctcaacggggttcatggccacaccacg 23313250



to top

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 302    cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
              |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 117057 cctcctccgtggggatgctcaacggggttcatggccacaccacg 117100



to top

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| || || |||||||| |||||||||||
Sbjct: 674 cctcctccatgaggatgctcaacggggttcatagccacaccacg 631



to top

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 641 cctcctccatgaggatgctccactggattcatagccacaccacg 598



to top

>ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predicted mRNA
          Length = 765

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 308 ccatggggatggtccaccgggttcatcgccacacc 342
           |||||||||||||| || |||||||| ||||||||
Sbjct: 635 ccatggggatggtcgacggggttcatagccacacc 601



to top

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 311  tggggatggtccaccgggttcatcgccacaccacg 345
            |||||||| ||||| |||||||| |||||||||||
Sbjct: 1410 tggggatgctccacggggttcatggccacaccacg 1376



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 308     ccatggggatggtccaccgggttcatcgccacacc 342
               |||||||||||||| || |||||||| ||||||||
Sbjct: 3210487 ccatggggatggtcgacggggttcatagccacacc 3210453



to top

>gb|AY147698.1| Mayaca fluviatilis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 308  ccatggggatggtccaccgggttcat 333
            ||||||||||||||||| ||||||||
Sbjct: 1209 ccatggggatggtccactgggttcat 1184



to top

>ref|XM_790908.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L8 (LOC591341), mRNA
          Length = 788

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||||||||| || |||||||| || ||||||||
Sbjct: 649 ccatggggatggtcaacggggttcatagcaacaccacg 612



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 317     tggtccaccgggttcatcgccacacc 342
               ||||| ||||||||||||||||||||
Sbjct: 5989926 tggtcaaccgggttcatcgccacacc 5989901



to top

>gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal protein L8 mRNA,
           complete cds
          Length = 477

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| || || |||||||| |||||||||||
Sbjct: 251 ccatggggatgctcaacagggttcatagccacaccacg 214



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 296     ccctcgcctcctccatggggatggtccaccgggttcat 333
               |||||||| || || ||||| |||||||||||||||||
Sbjct: 1588473 ccctcgccgccgccgtgggggtggtccaccgggttcat 1588510



to top

>gb|DQ206555.1| Leucosolenia sp. AR-2003 isolate TOA23 ribosomal protein 8 large
           subunit mRNA, partial cds
          Length = 385

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 308 ccatggggatggtccaccgggttcatcgccacaccacggacg 349
           ||||| ||||| || ||||||||||| || ||||||||||||
Sbjct: 383 ccatgaggatgctctaccgggttcatagcaacaccacggacg 342



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 296     ccctcgcctcctccatggggatggtccaccgggttcat 333
               |||||||| || || ||||| |||||||||||||||||
Sbjct: 1264343 ccctcgccgccgccgtgggggtggtccaccgggttcat 1264380



to top

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 308  ccatggggatggtccaccgggttcatcgccacaccacg 345
            ||||||||||| || || |||||||| |||||||||||
Sbjct: 1919 ccatggggatgctcaacggggttcatagccacaccacg 1882



to top

>gb|AY147721.1| Allium textile ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1260

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1214 cctccatggggatggtctacagggttcat 1186



to top

>gb|AY596744.1| Lepistemon owariensis ribosomal protein L2 (rpl2) gene, partial
           cds; chloroplast
          Length = 565

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 305 cctccatggggatggtccaccgggttcat 333
           ||||||||||||||||| || ||||||||
Sbjct: 540 cctccatggggatggtctacagggttcat 512



to top

>gb|DQ069411.1| Nuphar advena ribosomal protein L2 (rpl2) gene, partial cds;
           chloroplast
          Length = 819

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 305 cctccatggggatggtccaccgggttcat 333
           ||||||||||||||||| || ||||||||
Sbjct: 698 cctccatggggatggtctacagggttcat 670



to top

>ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM06220.1) partial mRNA
          Length = 303

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 317 tggtccaccgggttcatcgccacaccacg 345
           ||||| ||||||||||| |||||||||||
Sbjct: 161 tggtcaaccgggttcatagccacaccacg 133



to top

>gb|AY007489.1| Austrobaileya scandens ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1268

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1222 cctccatggggatggtctacagggttcat 1194



to top

>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 368   caccggctgtgccctgccttc 388
             |||||||||||||||||||||
Sbjct: 70592 caccggctgtgccctgccttc 70612



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 317     tggtccaccgggttcatcgccacaccacggacg 349
               ||||| |||||||||||| | ||||||||||||
Sbjct: 3476998 tggtcgaccgggttcatcacgacaccacggacg 3477030



to top

>gb|AF426458.1| Primary endosymbiont of Sitophilus zeamais ribosomal protein
           L2-like protein (rplB) gene, partial cds
          Length = 665

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 317 tggtccaccgggttcatcgcc 337
           |||||||||||||||||||||
Sbjct: 57  tggtccaccgggttcatcgcc 77



to top

>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29
          Length = 292100

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   tggtccaccgggttcatcgccacaccacg 345
             |||||||||||||||||  ||||||||||
Sbjct: 52447 tggtccaccgggttcatgaccacaccacg 52419



to top

>emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BAC clone T6H20
          Length = 98461

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 305   cctccatggggatggtccaccgggttcat 333
             ||||||||||||||||| || ||||||||
Sbjct: 89098 cctccatggggatggtcgacagggttcat 89070



to top

>emb|AJ627251.1| Nymphaea alba chloroplast, complete genome
          Length = 159930

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 305    cctccatggggatggtccaccgggttcat 333
              ||||||||||||||||| || ||||||||
Sbjct: 159768 cctccatggggatggtctacagggttcat 159740



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 305   cctccatggggatggtccaccgggttcat 333
             ||||||||||||||||| || ||||||||
Sbjct: 90177 cctccatggggatggtctacagggttcat 90205



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 351     ccggccgcctgcccagccacc 371
               |||||||||||||||||||||
Sbjct: 1563417 ccggccgcctgcccagccacc 1563437



to top

>gb|AF188855.1|AF188855 Nymphaea odorata ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1274

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1228 cctccatggggatggtctacagggttcat 1200



to top

>emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in linkage group 8,
             complete sequence
          Length = 162365

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 11    acttgttattattgatacatgataa 35
             ||||||||||||||| |||||||||
Sbjct: 50068 acttgttattattgagacatgataa 50092



to top

>gb|AF123787.1|AF123787 Cabomba caroliniana ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1272

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1228 cctccatggggatggtctacagggttcat 1200



to top

>gb|AY007498.1| Schisandra chinensis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1267

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1221 cctccatggggatggtctacagggttcat 1193



to top

>gb|AY007491.1| Gunnera chilensis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1249

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1203 cctccatggggatggtctacagggttcat 1175



to top

>gb|AY007488.1| Arabidopsis thaliana ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1266

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 305  cctccatggggatggtccaccgggttcat 333
            ||||||||||||||||| || ||||||||
Sbjct: 1240 cctccatggggatggtcgacagggttcat 1212



to top

>emb|BX088532.7| Zebrafish DNA sequence from clone CH211-127E17 in linkage group 8,
             complete sequence
          Length = 115792

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 11    acttgttattattgatacatgataa 35
             ||||||||||||||| |||||||||
Sbjct: 39200 acttgttattattgagacatgataa 39224



to top

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 674 cctccatgaggatgctcaacggggttcatagccacaccacg 634



to top

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 688 cctccatgaggatgctcaacggggttcatagccacaccacg 648



to top

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 197 cctccatgaggatgctcaacggggttcatagccacaccacg 237



to top

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||| |||||||| || || |||||||| |||||||||||
Sbjct: 683 cctccgtggggatgctcaacggggttcatagccacaccacg 643



to top

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||| |||||||| || || |||||||| |||||||||||
Sbjct: 196 cctccgtggggatgctcaacggggttcatagccacaccacg 236



to top

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 670 cctccatgaggatgctcaacggggttcatagccacaccacg 630



to top

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 197 cctccatgaggatgctcaacggggttcatagccacaccacg 237



to top

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 210 cctccatgaggatgctcaacggggttcatagccacaccacg 250



to top

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 674 cctccatgaggatgctcaacggggttcatagccacaccacg 634



to top

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 672 cctccatgaggatgctcaacggggttcatagccacaccacg 632



to top

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 197 cctccatgaggatgctcaacggggttcatagccacaccacg 237



to top

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 672 cctccatgaggatgctcaacggggttcatagccacaccacg 632



to top

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 cctccatggggatggtccaccgggttcatcgccacaccacg 345
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 197 cctccatgaggatgctcaacggggttcatagccacaccacg 237



to top

>dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, complete sequence,
              strain:Columbia
          Length = 154478

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 305    cctccatggggatggtccaccgggttcat 333
              ||||||||||||||||| || ||||||||
Sbjct: 154182 cctccatggggatggtcgacagggttcat 154154



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 305   cctccatggggatggtccaccgggttcat 333
             ||||||||||||||||| || ||||||||
Sbjct: 84467 cctccatggggatggtcgacagggttcat 84495



to top

>emb|AJ343462.1|HSA343462 Homo sapiens genomic sequence surrounding NotI site, clone NR1-CG4R
          Length = 741

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 368 caccggctgtgccctgccttc 388
           |||||||||||||||||||||
Sbjct: 552 caccggctgtgccctgccttc 532



to top

>ref|XM_474323.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1701

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  cgacggcctgccgcccttgg 290
            ||||||||||||||||||||
Sbjct: 1638 cgacggcctgccgcccttgg 1619



to top

>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105
           IMAGE:4786513), complete cds
          Length = 841

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 645 gggatgctcaacagggttcatagccacaccacggac 610



to top

>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds
          Length = 688

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 657 gggatgctcaacagggttcatagccacaccacggac 622



to top

>gb|AY389974.1| Latimeria chalumnae ribosomal protein L8 mRNA, partial cds
          Length = 509

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 448 gggatgttctacagggttcatagccacaccacggac 413



to top

>gb|AY658799.1| Synthetic construct Peudomonas aeruginosa clone FLH034232.01F
           PA4260 gene, partial cds
          Length = 822

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 308 ccatggggatggtccaccgggttcatcgccac 339
           ||||| || ||||| |||||||||||||||||
Sbjct: 698 ccatgcgggtggtcgaccgggttcatcgccac 667



to top

>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA
          Length = 2439

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 314  ggatggtccaccgggttcatcgccacaccacg 345
            ||||| ||||| |||||||| |||||||||||
Sbjct: 2120 ggatgctccacggggttcatggccacaccacg 2089



to top

>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds
          Length = 709

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 592 gggatgctcaacagggttcatagccacaccacggac 557



to top

>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA
          Length = 841

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 645 gggatgctcaacagggttcatagccacaccacggac 610



to top

>gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, complete sequence
          Length = 199554

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 372    ggctgtgccctgccttcctc 391
              ||||||||||||||||||||
Sbjct: 152888 ggctgtgccctgccttcctc 152869



to top

>gb|AY267353.1| Chara vulgaris mitochondrion, complete genome
          Length = 67737

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 302   cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
             ||||||||||| |||||||| || || ||||| || ||||||||
Sbjct: 19641 cctcctccatgaggatggtctacaggattcatagcaacaccacg 19684



to top

>emb|AL606457.3|OSJN00002 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05,
             complete sequence
          Length = 164943

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   cgacggcctgccgcccttgg 290
             ||||||||||||||||||||
Sbjct: 68959 cgacggcctgccgcccttgg 68978



to top

>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641
           IMAGE:6996953), complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 642 gggatgctcaacagggttcatagccacaccacggac 607



to top

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 192681

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 314    ggatggtccaccgggttcatcgccacaccacg 345
              ||||| ||||| |||||||| |||||||||||
Sbjct: 127313 ggatgctccacggggttcatggccacaccacg 127282



to top

>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript
           variant B (RpL8), mRNA
          Length = 1264

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 314 ggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||
Sbjct: 841 ggatgctccacggggttcatggccacaccacg 810



to top

>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript
           variant A (RpL8), mRNA
          Length = 1118

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 314 ggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||
Sbjct: 695 ggatgctccacggggttcatggccacaccacg 664



to top

>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA
          Length = 1019

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 314 ggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||
Sbjct: 693 ggatgctccacggggttcatggccacaccacg 662



to top

>gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome
          Length = 1176248

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aacacatcacttgttattat 22
              ||||||||||||||||||||
Sbjct: 427775 aacacatcacttgttattat 427756



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 308     ccatggggatggtccaccgggttcatcgccac 339
               |||||||| ||||| |||||||||||| ||||
Sbjct: 3105595 ccatgggggtggtcgaccgggttcatcaccac 3105626



to top

>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA
          Length = 1776

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 314 ggatggtccaccgggttcatcgccacaccacg 345
           ||||| ||||| |||||||| |||||||||||
Sbjct: 496 ggatgctccacggggttcatggccacaccacg 465



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 271      cgacggcctgccgcccttgg 290
                ||||||||||||||||||||
Sbjct: 34451474 cgacggcctgccgcccttgg 34451493



to top

>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZH09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 302 cctcctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||||||| ||||| ||||| || ||||| |||||| ||||
Sbjct: 659 cctcctccatgaggatgctccactggattcatagccacaacacg 616



to top

>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds
          Length = 821

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 313 gggatggtccaccgggttcatcgccacaccacggac 348
           |||||| || || |||||||| ||||||||||||||
Sbjct: 646 gggatgctcaacagggttcatagccacaccacggac 611



to top

>gb|AE004841.1| Pseudomonas aeruginosa PAO1, section 402 of 529 of the complete genome
          Length = 15733

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 308   ccatggggatggtccaccgggttcatcgccac 339
             ||||| || ||||| |||||||||||||||||
Sbjct: 13406 ccatgcgggtggtcgaccgggttcatcgccac 13437



to top

>dbj|AK119773.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-F05, full
            insert sequence
          Length = 1898

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  cgacggcctgccgcccttgg 290
            ||||||||||||||||||||
Sbjct: 1679 cgacggcctgccgcccttgg 1660



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 320     tccaccgggttcatcgccac 339
               ||||||||||||||||||||
Sbjct: 3237556 tccaccgggttcatcgccac 3237575



to top

>gb|AC115021.15| Mus musculus chromosome 3, clone RP24-232N19, complete sequence
          Length = 168461

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 372   ggctgtgccctgccttcctc 391
             ||||||||||||||||||||
Sbjct: 41418 ggctgtgccctgccttcctc 41399



to top

>dbj|AK059048.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-D12, full
           insert sequence
          Length = 1174

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 cgacggcctgccgcccttgg 290
           ||||||||||||||||||||
Sbjct: 967 cgacggcctgccgcccttgg 948



to top

>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA,
           complete cds
          Length = 937

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 gggttcatcgccacaccacg 345
           ||||||||||||||||||||
Sbjct: 676 gggttcatcgccacaccacg 657



to top

>emb|AL732344.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0403D02, complete
             sequence
          Length = 138387

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   cgacggcctgccgcccttgg 290
             ||||||||||||||||||||
Sbjct: 72772 cgacggcctgccgcccttgg 72791



to top

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
              sequence
          Length = 301691

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 314    ggatggtccaccgggttcatcgccacaccacg 345
              ||||| ||||| |||||||| |||||||||||
Sbjct: 123685 ggatgctccacggggttcatggccacaccacg 123654



to top

>gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal protein 8 large
           subunit mRNA, partial cds
          Length = 385

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 306 ctccatggggatggtccaccgggttcatcgccacaccacg 345
           ||||||| ||||| || || |||||||| |||||||||||
Sbjct: 385 ctccatgaggatgctcaacggggttcatagccacaccacg 346



to top

>emb|AL355112.4|CNS05TCB Human chromosome 14 DNA sequence BAC R-159D23 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 147454

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 361    gcccagccaccggctgtgccctgccttc 388
              ||||||||||| |||| |||||||||||
Sbjct: 145679 gcccagccaccagctgcgccctgccttc 145652



to top

>emb|AL683809.7| Mouse DNA sequence from clone RP23-440B21 on chromosome X, complete
             sequence
          Length = 213187

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 246   tggtgggcttcccccagggc 265
             ||||||||||||||||||||
Sbjct: 70220 tggtgggcttcccccagggc 70201



to top

>emb|AL352984.4|CNS05TC2 Human chromosome 14 DNA sequence BAC R-187E13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 158613

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 361   gcccagccaccggctgtgccctgccttc 388
             ||||||||||| |||| |||||||||||
Sbjct: 61313 gcccagccaccagctgcgccctgccttc 61286



to top

>emb|AL669969.14| Mouse DNA sequence from clone RP23-254J18 on chromosome 11, complete
             sequence
          Length = 127045

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   gcctgcccagccaccggctg 376
             ||||||||||||||||||||
Sbjct: 52062 gcctgcccagccaccggctg 52081


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,905,275
Number of Sequences: 3902068
Number of extensions: 2905275
Number of successful extensions: 57016
Number of sequences better than 10.0: 139
Number of HSP's better than 10.0 without gapping: 139
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56260
Number of HSP's gapped (non-prelim): 756
length of query: 422
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 400
effective length of database: 17,147,199,772
effective search space: 6858879908800
effective search space used: 6858879908800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top