| Clone Name | rbaet37f01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_190918.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1233 Score = 131 bits (66), Expect = 2e-27 Identities = 93/102 (91%) Strand = Plus / Minus Query: 308 ggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagcccgac 367 |||||||||||| ||||||||||| ||||| || ||| |||||||||||||||||||||| Sbjct: 1224 ggaggaggagcagacgcggtggcgcgggcatgacacgaggtggtcgttggtgagcccgac 1165 Query: 368 ggcctgcatgaaggagtggagcacggttgggccgacgaaccg 409 |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 1164 ggcctgcatgaacgagtggatgacggtggggccgacgaaccg 1123
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 131 bits (66), Expect = 2e-27 Identities = 93/102 (91%) Strand = Plus / Minus Query: 308 ggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagcccgac 367 |||||||||||| ||||||||||| ||||| || ||| |||||||||||||||||||||| Sbjct: 33833442 ggaggaggagcagacgcggtggcgcgggcatgacacgaggtggtcgttggtgagcccgac 33833383 Query: 368 ggcctgcatgaaggagtggagcacggttgggccgacgaaccg 409 |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 33833382 ggcctgcatgaacgagtggatgacggtggggccgacgaaccg 33833341 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 38183172 cagatggatggatggatggat 38183192 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 27050288 cagatggatggatggatggat 27050308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 40572692 gatggatggatggatggatt 40572673 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 24220796 aggcggaggcggaggaggag 24220815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 21899260 agatggatggatggatggat 21899279 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 9764219 aggcggaggcggaggaggag 9764200 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 4726032 gatggatggatggatggatt 4726051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 1485322 agatggatggatggatggat 1485303
>dbj|AP003293.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0691E06 Length = 166497 Score = 131 bits (66), Expect = 2e-27 Identities = 93/102 (91%) Strand = Plus / Minus Query: 308 ggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagcccgac 367 |||||||||||| ||||||||||| ||||| || ||| |||||||||||||||||||||| Sbjct: 72489 ggaggaggagcagacgcggtggcgcgggcatgacacgaggtggtcgttggtgagcccgac 72430 Query: 368 ggcctgcatgaaggagtggagcacggttgggccgacgaaccg 409 |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 72429 ggcctgcatgaacgagtggatgacggtggggccgacgaaccg 72388
>dbj|AK109346.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E05, full insert sequence Length = 1487 Score = 131 bits (66), Expect = 2e-27 Identities = 93/102 (91%) Strand = Plus / Minus Query: 308 ggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagcccgac 367 |||||||||||| ||||||||||| ||||| || ||| |||||||||||||||||||||| Sbjct: 1272 ggaggaggagcagacgcggtggcgcgggcatgacacgaggtggtcgttggtgagcccgac 1213 Query: 368 ggcctgcatgaaggagtggagcacggttgggccgacgaaccg 409 |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 1212 ggcctgcatgaacgagtggatgacggtggggccgacgaaccg 1171
>gb|AY107384.1| Zea mays PCO116548 mRNA sequence Length = 482 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 305 ggcggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagccc 364 ||||| || |||||| ||||||||||| ||||| |||||| ||||||||||||||||||| Sbjct: 262 ggcggcggcggagcagacgcggtggcgcgggcacgagacgaggtggtcgttggtgagccc 203 Query: 365 gacggcctgcatgaaggagtggagcacggttgggccgacgaa 406 ||| |||| |||||||||||||| || || ||||||||||| Sbjct: 202 gaccgcctccatgaaggagtggatgacagtggggccgacgaa 161
>gb|AY065584.1| Zea mays clone tac 911.14 5' Ac insertion site sequence Length = 356 Score = 91.7 bits (46), Expect = 2e-15 Identities = 87/102 (85%) Strand = Plus / Plus Query: 305 ggcggaggaggagcaaacgcggtggcgagggcaggagacggggtggtcgttggtgagccc 364 ||||| || |||||| || ||||||| ||||| ||||| ||||| |||||||||| || Sbjct: 77 ggcggcggcggagcagacccggtggcscgggcacragacgaggtggccgttggtgaggcc 136 Query: 365 gacggcctgcatgaaggagtggagcacggttgggccgacgaa 406 ||| ||||||||||||||||||| ||||| ||||||||||| Sbjct: 137 gaccgcctgcatgaaggagtggatgacggtggggccgacgaa 178
>ref|XM_465880.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1030 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggagcaa 320 ||||||||||||||||||||||| Sbjct: 604 aggcggaggcggaggaggagcaa 626
>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence Length = 225556 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 188416 gtcagatggatggatggatggat 188438
>gb|AC134925.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0041J17, complete sequence Length = 148829 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 115813 ggccgtccgatggatggatggatggat 115839
>gb|AC136481.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0007D07, complete sequence Length = 133930 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 15432 ggccgtccgatggatggatggatggat 15458
>gb|AC119219.6| Mus musculus chromosome 12, clone RP24-201C18, complete sequence Length = 187098 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggattag 299 ||||||||||||||||||||||| Sbjct: 27083 agatggatggatggatggattag 27105 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 148679 gatggatggatggatggatta 148699 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 156401 agatggatggatggatggat 156420 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 148949 agatggatggatggatggat 148968
>gb|AC146615.2| Mus musculus BAC clone RP23-19K2 from chromosome 14, complete sequence Length = 192561 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 156149 gtcagatggatggatggatggat 156127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 62379 agatggatggatggatggat 62360
>emb|BX571706.24| Zebrafish DNA sequence from clone DKEYP-123H11 in linkage group 11, complete sequence Length = 196333 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggatta 298 ||||||||||||||||||||||| Sbjct: 58322 cagatggatggatggatggatta 58300 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 58667 cagatggatggatggatggat 58647 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 58661 gatggatggatggatggatta 58641 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 58469 cagatggatggatggatggat 58449 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 57796 gatggatggatggatggatta 57776 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 57763 cagatggatggatggatggat 57743 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 57728 cagatggatggatggatggat 57708 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 57658 cagatggatggatggatggat 57638 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 57514 cagatggatggatggatggat 57494 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatgga 295 |||||||||||||||||||| Sbjct: 57892 cagatggatggatggatgga 57873
>emb|CT009660.7| Zebrafish DNA sequence from clone CH73-353G18 in linkage group 22, complete sequence Length = 14232 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 9436 gtcagatggatggatggatggat 9458 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 13287 agatggatggatggatggat 13268
>emb|CT010448.4| Mouse DNA sequence from clone RP23-290P4 on chromosome 17, complete sequence Length = 136671 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 83699 gtcagatggatggatggatggat 83677 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 83667 gatggatggatggatggatt 83648
>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7, complete sequence Length = 168673 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 120754 gtcagatggatggatggatggat 120732 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 120130 agatggatggatggatggat 120111
>emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in linkage group 5, complete sequence Length = 144909 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 143862 gtcagatggatggatggatggat 143840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 143567 agatggatggatggatggat 143548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 39436 gatggatggatggatggatt 39417
>emb|BX276112.19| Zebrafish DNA sequence from clone CH211-220I12 in linkage group 24, complete sequence Length = 146065 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 20472 gtcagatggatggatggatggat 20494 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 20423 agatggatggatggatggat 20442
>emb|AL442127.7| Human DNA sequence from clone RP11-297I6 on chromosome 13 Contains two novel genes, the 5' end of the EFNB2 gene for ephrin-B2 (HTKL EPLG5 LERK5), an ATP synthase H+ transporting mitochondrial F0 complex subunit c pseudogene and two CpG islands, complete sequence Length = 210115 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 5961 gatggatggatggatggattagg 5983
>emb|AL121910.26|HSDJ827L5 Human DNA sequence from clone RP5-827L5 on chromosome 20 Contains two putative novel genes, a CpG island, ESTs, STSs and GSSs, complete sequence Length = 141895 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 35632 gtcagatggatggatggatggat 35610
>emb|AL049540.11|HSJ890O15 Human DNA sequence from clone RP5-890O15 on chromosome 20, complete sequence Length = 74549 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggattag 299 ||||||||||||||||||||||| Sbjct: 31372 agatggatggatggatggattag 31394
>emb|CR457449.7| Zebrafish DNA sequence from clone DKEY-104I15 in linkage group 14, complete sequence Length = 187354 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 27536 gtcagatggatggatggatggat 27558
>emb|BX571774.9| Zebrafish DNA sequence from clone DKEY-250A19 in linkage group 9, complete sequence Length = 140812 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggattag 299 ||||||||||||||||||||||| Sbjct: 99955 agatggatggatggatggattag 99977
>emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation factor 5A Length = 807 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Minus Query: 288 tggatggattaggcggaggcggaggag 314 ||||||||| ||||||||||||||||| Sbjct: 60 tggatggatcaggcggaggcggaggag 34
>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete sequence Length = 176383 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 276 cagatggatggatggatggattaggcg 302 |||||||||||||||||||||| |||| Sbjct: 92632 cagatggatggatggatggattgggcg 92658
>emb|BX323075.13| Zebrafish DNA sequence from clone CH211-230C4 in linkage group 6, complete sequence Length = 154270 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 128622 gtcagatggatggatggatggat 128644 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 128402 gatggatggatggatggatt 128421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 76173 agatggatggatggatggat 76154 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 8998 agatggatggatggatggat 9017
>emb|CR407560.11| Zebrafish DNA sequence from clone CH211-180L14, complete sequence Length = 127482 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 117664 gatggatggatggatggattagg 117642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 117530 gatggatggatggatggatt 117511 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 117241 gatggatggatggatggatt 117222
>emb|CR847883.10| Zebrafish DNA sequence from clone DKEYP-24H10 in linkage group 1, complete sequence Length = 83811 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 73399 gtcagatggatggatggatggat 73421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 72709 agatggatggatggatggat 72728
>emb|CR847930.5| Zebrafish DNA sequence from clone DKEY-148H19 in linkage group 19, complete sequence Length = 167262 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 82759 gtcagatggatggatggatggat 82737
>emb|AL929349.10| Zebrafish DNA sequence from clone CH211-207D24 in linkage group 20 Contains eight CpG islands, complete sequence Length = 196371 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 123221 gatggatggatggatggattagg 123199 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 123095 gatggatggatggatggatt 123076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 122810 gatggatggatggatggatt 122791
>emb|CR759889.5| Zebrafish DNA sequence from clone DKEY-172F14 in linkage group 5, complete sequence Length = 129171 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 953 gtcagatggatggatggatggat 931 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 94524 agatggatggatggatggat 94543 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 658 agatggatggatggatggat 639
>emb|BX005353.8| Zebrafish DNA sequence from clone DKEY-28D10, complete sequence Length = 212169 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 27958 gtcagatggatggatggatggat 27936 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 27790 gtcagatggatggatggatggat 27768 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 26622 agatggatggatggatggatt 26602 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 14246 agatggatggatggatggat 14265
>gb|AC132275.4| Mus musculus BAC clone RP24-341P14 from chromosome 3, complete sequence Length = 174425 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 151967 gatggatggatggatggattagg 151945
>gb|AC109439.3| Homo sapiens chromosome 5 clone CTB-1I21, complete sequence Length = 153667 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 23362 gtcagatggatggatggatggat 23384
>emb|BX119916.10| Zebrafish DNA sequence from clone CH211-202I5 in linkage group 11, complete sequence Length = 196164 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 58438 gtcagatggatggatggatggat 58416 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 53874 cagatggatggatggatggat 53854 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 97178 agatggatggatggatggat 97159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 96338 gatggatggatggatggatt 96319 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 59243 agatggatggatggatggat 59224 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 59108 agatggatggatggatggat 59089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 58742 gatggatggatggatggatt 58723 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 53948 gatggatggatggatggatt 53929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 53608 agatggatggatggatggat 53589
>gb|AC159259.2| Mus musculus BAC clone RP24-83G17 from chromosome 3, complete sequence Length = 191517 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 58235 gatggatggatggatggattagg 58213
>emb|BX120011.13| Zebrafish DNA sequence from clone DKEY-18O5 in linkage group 25, complete sequence Length = 225675 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 19533 gatggatggatggatggattagg 19555 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 19844 gatggatggatggatggatta 19864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 73933 agatggatggatggatggat 73914 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 73920 gatggatggatggatggatt 73901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 19839 agatggatggatggatggat 19858
>emb|BX004772.17| Zebrafish DNA sequence from clone DKEY-15L1 in linkage group 7, complete sequence Length = 210545 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 37061 gtcagatggatggatggatggat 37039 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 36997 gtcagatggatggatggatggat 36975 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 36945 gtcagatggatggatggatggat 36923 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 36877 gtcagatggatggatggatggat 36855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 37136 gatggatggatggatggatt 37155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 37131 agatggatggatggatggat 37150
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 276 cagatggatggatggatggattaggcg 302 |||||||||||||||||||||| |||| Sbjct: 22998176 cagatggatggatggatggattgggcg 22998202 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 5642130 tcagatggatggatggatggat 5642151 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 5642056 tcagatggatggatggatggat 5642077 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 297 taggcggaggcggaggaggag 317 ||||||||||||||||||||| Sbjct: 21422997 taggcggaggcggaggaggag 21422977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 29370032 agatggatggatggatggat 29370051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 28128457 agatggatggatggatggat 28128476 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 13812037 aggcggaggcggaggaggag 13812056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 5225170 aggcggaggcggaggaggag 5225189
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 19012615 ggccgtccgatggatggatggatggat 19012641 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 26166425 gatggatggatggatggatt 26166406 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 21324769 aggcggaggcggaggaggag 21324788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 7984372 gatggatggatggatggatt 7984353 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 289 ggatggattaggcggaggcggagg 312 |||||||| ||||||||||||||| Sbjct: 162072 ggatggatcaggcggaggcggagg 162095
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggagcaa 320 ||||||||||||||||||||||| Sbjct: 18081716 aggcggaggcggaggaggagcaa 18081694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 ggcggaggcggaggaggagc 318 |||||||||||||||||||| Sbjct: 35445763 ggcggaggcggaggaggagc 35445782 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 28966757 aggcggaggcggaggaggag 28966776 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 301 cggaggcggaggaggagcaa 320 |||||||||||||||||||| Sbjct: 12305288 cggaggcggaggaggagcaa 12305269 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 ggcggaggcggaggaggagc 318 |||||||||||||||||||| Sbjct: 10047997 ggcggaggcggaggaggagc 10048016 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 9046606 agatggatggatggatggat 9046587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatgg 294 |||||||||||||||||||| Sbjct: 4702925 tcagatggatggatggatgg 4702944 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 1615319 gatggatggatggatggatt 1615338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 1447197 aggcggaggcggaggaggag 1447178
>dbj|AP005066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0047E05 Length = 184323 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggagcaa 320 ||||||||||||||||||||||| Sbjct: 5117 aggcggaggcggaggaggagcaa 5095
>gb|AC002448.1|AC002448 Homo sapiens PAC clone RP1-68N8 from 5q31, complete sequence Length = 122322 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 66973 gtcagatggatggatggatggat 66951
>dbj|AK073398.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033045F02, full insert sequence Length = 1030 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggagcaa 320 ||||||||||||||||||||||| Sbjct: 604 aggcggaggcggaggaggagcaa 626
>dbj|AK071574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023105D14, full insert sequence Length = 977 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 948 ggccgtccgatggatggatggatggat 974
>emb|BX537287.8| Zebrafish DNA sequence from clone CH211-206O8 in linkage group 19, complete sequence Length = 195505 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 135403 gtcagatggatggatggatggat 135425
>dbj|AK061093.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-A02, full insert sequence Length = 1053 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 945 ggccgtccgatggatggatggatggat 971
>gb|AY103556.1| Zea mays PCO150862 mRNA sequence Length = 966 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Minus Query: 288 tggatggattaggcggaggcggaggag 314 ||||||||| ||||||||||||||||| Sbjct: 173 tggatggatcaggcggaggcggaggag 147
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete sequence Length = 170964 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 117498 gtcagatggatggatggatggat 117520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 120209 agatggatggatggatggat 120228
>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence Length = 162290 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggattag 299 ||||||||||||||||||||||| Sbjct: 156122 agatggatggatggatggattag 156144 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 66505 agatggatggatggatggat 66524
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 ggccgtcagatggatggatggatggat 296 ||||||| ||||||||||||||||||| Sbjct: 19171264 ggccgtccgatggatggatggatggat 19171290 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 26480245 gatggatggatggatggatt 26480226 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 21634968 aggcggaggcggaggaggag 21634987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 8054459 gatggatggatggatggatt 8054440 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 289 ggatggattaggcggaggcggagg 312 |||||||| ||||||||||||||| Sbjct: 162072 ggatggatcaggcggaggcggagg 162095
>gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, complete sequence Length = 173965 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 100044 gatggatggatggatggattagg 100066 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattagg 300 ||||||||||||||||||||||| Sbjct: 99776 gatggatggatggatggattagg 99798 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 99907 agatggatggatggatggat 99926
>gb|AC122391.4| Mus musculus BAC clone RP24-81C18 from 14, complete sequence Length = 184636 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 165557 gtcagatggatggatggatggat 165579
>emb|BX927093.8| Zebrafish DNA sequence from clone DKEY-53P2 in linkage group 11, complete sequence Length = 68923 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 274 gtcagatggatggatggatggat 296 ||||||||||||||||||||||| Sbjct: 63107 gtcagatggatggatggatggat 63085
>emb|AL596258.15| Mouse DNA sequence from clone RP23-226P4 on chromosome 11, complete sequence Length = 219037 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggattag 299 ||||||||||||||||||||||| Sbjct: 25599 agatggatggatggatggattag 25577 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 25660 cagatggatggatggatggat 25640
>emb|AL352981.4|CNS05TC0 Human chromosome 14 DNA sequence BAC R-15E14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 158214 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggatta 298 ||||||||||||||||||||||| Sbjct: 138350 cagatggatggatggatggatta 138372
>gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, complete sequence Length = 196519 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 159961 tcagatggatggatggatggat 159940
>gb|AC116121.8| Mus musculus chromosome 8, clone RP23-79K4, complete sequence Length = 216001 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 18748 tcagatggatggatggatggat 18727
>ref|XM_519216.1| PREDICTED: Pan troglodytes similar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1 homolog) (LOC463552), mRNA Length = 963 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 521 gatggatggatggatggattag 500
>gb|AF381548.1| Tetrao tetrix microsatellite BG14 sequence Length = 347 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 196 gatggatggatggatggattag 175
>gb|AY024079.1| Oryza sativa microsatellite MRG6404 containing (GATG)X6, genomic sequence Length = 224 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 98 tcagatggatggatggatggat 119 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 24 tcagatggatggatggatggat 45
>gb|AC147160.2| Mus musculus BAC clone RP24-336A22 from chromosome 15, complete sequence Length = 205374 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 131968 agatggatggatggatggatta 131947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 131852 cagatggatggatggatggat 131832
>gb|AC146201.2| Pan troglodytes BAC clone RP43-34J1 from 7, complete sequence Length = 169640 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 88262 tcagatggatggatggatggat 88283
>gb|AC144702.2| Danio rerio clone CH211-138D14, complete sequence Length = 192101 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 136442 gatggatggatggatggattag 136421 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 120406 cagatggatggatggatggat 120386 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 136479 agatggatggatggatggat 136460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 120377 agatggatggatggatggat 120358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 120237 agatggatggatggatggat 120218
>gb|AC005102.1| Homo sapiens BAC clone CTA-356E1 from 7, complete sequence Length = 106508 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 46374 gatggatggatggatggattag 46395
>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15, complete sequence Length = 212742 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 91647 agatggatggatggatggatta 91626 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 91196 cagatggatggatggatggat 91176 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 90952 cagatggatggatggatggat 90932 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 91551 agatggatggatggatggat 91532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 91530 gatggatggatggatggatt 91511 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 91471 agatggatggatggatggat 91452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 91154 gatggatggatggatggatt 91135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 91095 agatggatggatggatggat 91076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 90942 gatggatggatggatggatt 90923 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 90585 agatggatggatggatggat 90566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 90576 gatggatggatggatggatt 90557 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 90012 agatggatggatggatggat 89993 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 80916 gatggatggatggatggatt 80935
>emb|CR450795.8| Zebrafish DNA sequence from clone CH211-203J19 in linkage group 23, complete sequence Length = 162230 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 3755 gatggatggatggatggattag 3776
>emb|BX927247.20| Zebrafish DNA sequence from clone CH211-189K22 in linkage group 6, complete sequence Length = 160349 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 48024 gatggatggatggatggattag 48045 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 139493 agatggatggatggatggat 139474 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 121233 agatggatggatggatggat 121252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 112673 agatggatggatggatggat 112654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 48095 agatggatggatggatggat 48114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 48019 agatggatggatggatggat 48038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 47977 gatggatggatggatggatt 47996 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 47940 agatggatggatggatggat 47959
>emb|CR376778.9| Zebrafish DNA sequence from clone DKEYP-94F12 in linkage group 25, complete sequence Length = 185814 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 47908 cagatggatggatggatggatt 47929
>gb|AC127411.3| Mus musculus BAC clone RP23-60E24 from chromosome 5, complete sequence Length = 217636 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 155703 gatggatggatggatggattag 155682
>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete sequence Length = 213633 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 134551 gatggatggatggatggattag 134572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 135963 gatggatggatggatggatt 135982
>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence Length = 215866 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 78144 gatggatggatggatggattag 78123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 76728 gatggatggatggatggatt 76709
>gb|AC125183.4| Mus musculus BAC clone RP23-297M4 from 5, complete sequence Length = 221622 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 149025 tcagatggatggatggatggat 149004
>gb|AC079888.10| Oryza sativa chromosome 10 BAC OSJNBa0078O01 genomic sequence, complete sequence Length = 146664 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 278 gatggatggatggatggattaggcgg 303 |||||||||||||||||||| ||||| Sbjct: 107414 gatggatggatggatggattgggcgg 107389
>gb|AC118755.7| Homo sapiens chromosome 17, clone RP11-55L4, complete sequence Length = 188765 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatgga 295 |||||||||||||||||||||| Sbjct: 126525 gtcagatggatggatggatgga 126546
>gb|AC142339.1| Pan troglodytes BAC clone RP43-42C16 from 7, complete sequence Length = 181207 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 18767 gatggatggatggatggattag 18788
>emb|BX927062.11| Zebrafish DNA sequence from clone CH211-227N20 in linkage group 13, complete sequence Length = 154186 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 140028 tcagatggatggatggatggat 140007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 131361 gatggatggatggatggatt 131380 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 65865 gatggatggatggatggatt 65884
>emb|AL354919.16| Human DNA sequence from clone RP11-84A19 on chromosome 1 Contains the 5' end of the BAI2 gene for brain-specific angiogenesis inhibitor 2, the gene for a novel protein (FLJ33697, FLJ25348, FLJ39908, FLJ25348, FLJ38510, FLJ38873), a novel gene (FLJ46627) and three CpG islands, complete sequence Length = 124413 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 111608 gatggatggatggatggattag 111629
>emb|AL158212.15| Human DNA sequence from clone RP11-57H14 on chromosome 10 Contains the 5' end of the TCF7L2 gene for transcription factor 7-like 2 (T-cell specific, HMG-box), two novel genes and two CpG islands, complete sequence Length = 166464 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 51242 tcagatggatggatggatggat 51263 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatgga 295 |||||||||||||||||||||| Sbjct: 51181 gtcagatggatggatggatgga 51202 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 50855 cagatggatggatggatggat 50875 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 51140 agatggatggatggatggat 51159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 51000 agatggatggatggatggat 51019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatgg 294 |||||||||||||||||||| Sbjct: 50974 tcagatggatggatggatgg 50993
>emb|AL109826.25|HSJ272H18 Human DNA sequence from clone RP1-272H18 on chromosome 20q12-13.12 Contains an STS and GSSs, complete sequence Length = 50954 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 414 gatggatggatggatggattag 393
>emb|AL078597.11|HSDJ442I1 Human DNA sequence from clone RP3-442I1 on chromosome 6q12-13 Contains the 5' end of a novel gene, complete sequence Length = 138209 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 67201 tcagatggatggatggatggat 67222
>emb|AL031984.13|HS173D1 Human DNA sequence from clone RP1-173D1 on chromosome 1p36.21-36.33 Contains the 5' UTR of the gene for a novel protein (FLJ34970, FLJ20321) and a CpG island, complete sequence Length = 117338 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 63455 gatggatggatggatggattag 63434
>emb|AL023578.1|HS248E1 Human DNA sequence from clone RP1-248E1 on chromosome 6q23.1-23.3 Contains the 3' end of the MOXD1 gene for monooxygenase DBH-like 1 and a eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene, complete sequence Length = 84107 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 78657 gatggatggatggatggattag 78636
>emb|BX465220.18| Zebrafish DNA sequence from clone CH211-226O13 in linkage group 21, complete sequence Length = 209782 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 186476 agatggatggatggatggatta 186455
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete sequence Length = 198595 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 50724 tcagatggatggatggatggat 50703 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 50479 agatggatggatggatggat 50460
>emb|AL590149.9| Zebrafish DNA sequence from clone RP71-36D5 in linkage group 17 Contains the 3' part of a novel gene similar to KIAA0953, a novel gene similar to POMC (propiomelanocortin), a novel gene similar to FCN2 (ficolin 2), a novel gene similar to SNX9 (sorting nexin 9) and a CpG island, complete sequence Length = 167272 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 83050 tcagatggatggatggatggat 83029 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 15046 agatggatggatggatggat 15027
>emb|CR352218.7| Zebrafish DNA sequence from clone DKEYP-118G5 in linkage group 23, complete sequence Length = 124382 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 92820 cagatggatggatggatggatt 92799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 93773 agatggatggatggatggat 93754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 93448 agatggatggatggatggat 93429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 90855 agatggatggatggatggat 90874
>emb|BX908767.8| Zebrafish DNA sequence from clone DKEY-66B12 in linkage group 3, complete sequence Length = 177868 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 169339 tcagatggatggatggatggat 169318
>emb|AL731866.8| Mouse DNA sequence from clone RP23-37F22 on chromosome 11 Contains the 5' end of a variant of the Ccl1 gene for chemokine (C-C motif) ligand 1, complete sequence Length = 105085 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 82139 gatggatggatggatggattag 82160
>emb|CR385021.12| Zebrafish DNA sequence from clone CH211-200N15 in linkage group 16, complete sequence Length = 148046 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 88321 gatggatggatggatggattag 88342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 97647 agatggatggatggatggat 97666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 80012 agatggatggatggatggat 80031
>emb|BX511062.12| Zebrafish DNA sequence from clone CH211-266M11 in linkage group 17, complete sequence Length = 131970 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 104324 tcagatggatggatggatggat 104303
>emb|CR394529.7| Zebrafish DNA sequence from clone CH211-121F17 in linkage group 24, complete sequence Length = 75984 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 59028 gatggatggatggatggattag 59049 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 59015 agatggatggatggatggat 59034
>emb|BX119926.20| Zebrafish DNA sequence from clone CH211-42C8 in linkage group 14, complete sequence Length = 174863 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 170156 gatggatggatggatggattag 170177
>emb|CR318673.9| Zebrafish DNA sequence from clone CH211-132J7 in linkage group 14, complete sequence Length = 164281 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 52103 gatggatggatggatggattag 52124
>gb|AC084388.1| Mus musculus clone RP23-132G6, complete sequence Length = 208754 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 56524 agatggatggatggatggatta 56503 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 56408 cagatggatggatggatggat 56388
>emb|BX296567.23| Zebrafish DNA sequence from clone DKEY-261P22 in linkage group 15, complete sequence Length = 224041 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 100958 agatggatggatggatggatta 100937
>emb|BX663525.6| Zebrafish DNA sequence from clone DKEY-97A13 in linkage group 2, complete sequence Length = 261927 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 256770 gatggatggatggatggattag 256749 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 257644 agatggatggatggatggat 257625 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 257310 agatggatggatggatggat 257291 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 256821 agatggatggatggatggat 256802
>gb|AC068640.29| Homo sapiens 12 BAC RP11-105I4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 99930 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 95168 gatggatggatggatggattag 95147
>gb|AC073683.3| Mus musculus chromosome 17 clone RP23-124G7, complete sequence Length = 213137 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 76170 gatggatggatggatggattag 76191
>gb|AC013652.8| Homo sapiens chromosome 15, clone RP11-462P6, complete sequence Length = 189761 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 92080 tcagatggatggatggatggat 92059
>gb|AF469966.1| Oncorhynchus mykiss microsatellite OMM1179 sequence Length = 375 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 295 tcagatggatggatggatggat 274
>gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 216030 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 91017 tcagatggatggatggatggat 91038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 162779 agatggatggatggatggat 162798 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 91048 gatggatggatggatggatt 91067
>emb|BX537262.7| Zebrafish DNA sequence from clone DKEY-111N6 in linkage group 1, complete sequence Length = 97035 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 74651 gatggatggatggatggattag 74630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 74684 agatggatggatggatggat 74665
>emb|BX323989.4| Zebrafish DNA sequence from clone DKEY-101O12 in linkage group 23, complete sequence Length = 198365 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 123814 gatggatggatggatggattag 123793 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 124066 agatggatggatggatggat 124047 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 123843 agatggatggatggatggat 123824 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 97114 agatggatggatggatggat 97095
>gb|AC151718.5| Mus musculus BAC clone RP23-142J2 from chromosome 7, complete sequence Length = 213292 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 127316 gatggatggatggatggattag 127337 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 3319 agatggatggatggatggat 3300
>emb|BX323593.12| Zebrafish DNA sequence from clone DKEY-107I18 in linkage group 14, complete sequence Length = 198776 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 179645 gatggatggatggatggattag 179624
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 278 gatggatggatggatggattaggcgg 303 |||||||||||||||||||| ||||| Sbjct: 18603603 gatggatggatggatggattgggcgg 18603578 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 18724931 aggcggaggcggaggaggag 18724912 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 15591765 agatggatggatggatggat 15591746 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 4068784 agatggatggatggatggat 4068803
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 2426320 tcagatggatggatggatggat 2426299 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 271 gccgtcagatggatggatggatgga 295 |||||| |||||||||||||||||| Sbjct: 3176375 gccgtctgatggatggatggatgga 3176399 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 1005098 gatggatggatggatggatta 1005118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 28214492 gatggatggatggatggatt 28214511 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 27874586 aggcggaggcggaggaggag 27874567 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 61325 agatggatggatggatggat 61306
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 1957743 tcagatggatggatggatggat 1957722 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 ggcggaggcggaggaggagc 318 |||||||||||||||||||| Sbjct: 26181628 ggcggaggcggaggaggagc 26181647 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 17271202 gatggatggatggatggatt 17271183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 12957346 aggcggaggcggaggaggag 12957365 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 11555505 agatggatggatggatggat 11555486 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 4217373 gatggatggatggatggatt 4217354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 3877938 aggcggaggcggaggaggag 3877919 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 3839882 aggcggaggcggaggaggag 3839863 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 1741816 gatggatggatggatggatt 1741835
>gb|AC122688.5| Homo sapiens 12 BAC RP11-158L12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 178315 Score = 44.1 bits (22), Expect = 0.35 Identities = 28/30 (93%) Strand = Plus / Plus Query: 267 gccggccgtcagatggatggatggatggat 296 |||||| | ||||||||||||||||||||| Sbjct: 93123 gccggctggcagatggatggatggatggat 93152
>gb|AC158540.2| Pan troglodytes BAC clone CH251-315F23 from chromosome unknown, complete sequence Length = 200678 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 80551 gatggatggatggatggattag 80530
>gb|AC158117.2| Pan troglodytes BAC clone CH251-437A17 from chromosome unknown, complete sequence Length = 154069 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 78420 gatggatggatggatggattag 78441
>gb|AC132265.4| Mus musculus BAC clone RP24-373J20 from chromosome 10, complete sequence Length = 178780 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 119505 gatggatggatggatggattag 119526
>gb|AC151828.3| Mus musculus BAC clone RP24-444L19 from chromosome 10, complete sequence Length = 222344 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 26060 gatggatggatggatggattag 26081
>gb|AC127279.3| Mus musculus BAC clone RP24-247K4 from chromosome 10, complete sequence Length = 185573 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 18961 tcagatggatggatggatggat 18940
>gb|AC016720.9| Homo sapiens BAC clone RP11-326G23 from 2, complete sequence Length = 154318 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 35814 gatggatggatggatggattag 35793
>gb|AC055711.18| Homo sapiens 3 BAC RP11-67E18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154850 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 18398 tcagatggatggatggatggat 18419 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 18409 gatggatggatggatggatt 18428 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 18369 agatggatggatggatggat 18388
>gb|AC087501.16| Homo sapiens chromosome 17, clone RP11-565F19, complete sequence Length = 192197 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 274 gtcagatggatggatggatgga 295 |||||||||||||||||||||| Sbjct: 100619 gtcagatggatggatggatgga 100640
>emb|BX649358.3| Zebrafish DNA sequence from clone CH211-69P6 in linkage group 13, complete sequence Length = 181307 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 49016 agatggatggatggatggatta 48995
>gb|AC009387.27| Homo sapiens 12 BAC RP11-110L15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 99867 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 95102 gatggatggatggatggattag 95081
>dbj|AP003526.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548D03 Length = 156709 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 86523 tcagatggatggatggatggat 86502
>emb|AL805898.11| Mouse DNA sequence from clone RP23-432F24 on chromosome 4, complete sequence Length = 215828 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 99660 agatggatggatggatggatta 99639
>emb|BX548165.11| Mouse DNA sequence from clone RP24-89M13 on chromosome 11, complete sequence Length = 51451 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 41577 gatggatggatggatggattag 41598 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 24136 cagatggatggatggatggat 24116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 41568 agatggatggatggatggat 41587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 41129 gatggatggatggatggatt 41148
>dbj|AP004381.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0025F03 Length = 138042 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 102290 tcagatggatggatggatggat 102269
>emb|BX072582.6| Zebrafish DNA sequence from clone DKEY-222O19 in linkage group 11, complete sequence Length = 194918 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 75411 gatggatggatggatggattag 75432 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 76064 agatggatggatggatggat 76083
>gb|AC006531.1|AC006531 Homo sapiens chromosome 16 clone 113K5, complete sequence Length = 167525 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 140759 agatggatggatggatggatta 140738
>gb|AC154756.2| Mus musculus BAC clone RP23-114J15 from 13, complete sequence Length = 189515 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 88386 tcagatggatggatggatggat 88407
>emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 in linkage group 20, complete sequence Length = 182841 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 132592 tcagatggatggatggatggat 132613 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 132903 agatggatggatggatggat 132922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 132879 agatggatggatggatggat 132898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 132827 agatggatggatggatggat 132846 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 132623 gatggatggatggatggatt 132642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 49478 agatggatggatggatggat 49497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 49150 agatggatggatggatggat 49169 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 44932 agatggatggatggatggat 44913 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 42347 agatggatggatggatggat 42328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 42062 agatggatggatggatggat 42043 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 20285 agatggatggatggatggat 20304
>gb|AC130216.4| Mus musculus BAC clone RP23-218G9 from 10, complete sequence Length = 182204 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 43494 tcagatggatggatggatggat 43515
>emb|CR769778.10| Zebrafish DNA sequence from clone CH211-147N12 in linkage group 18, complete sequence Length = 162450 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 7628 tcagatggatggatggatggat 7649 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 8283 cagatggatggatggatggat 8303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 44309 agatggatggatggatggat 44290 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 42902 gatggatggatggatggatt 42883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 42340 agatggatggatggatggat 42321 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 42312 agatggatggatggatggat 42293 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 42284 agatggatggatggatggat 42265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 8903 gatggatggatggatggatt 8922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 8095 agatggatggatggatggat 8114
>gb|AC124395.5| Mus musculus BAC clone RP24-342J3 from 13, complete sequence Length = 147971 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 132142 tcagatggatggatggatggat 132121
>emb|BX950204.17| Zebrafish DNA sequence from clone DKEY-252P7 in linkage group 18, complete sequence Length = 133263 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 30127 gatggatggatggatggattag 30148 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 29746 cagatggatggatggatggat 29766 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 29604 cagatggatggatggatggat 29624 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 50797 agatggatggatggatggat 50816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 30114 agatggatggatggatggat 30133 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 29641 agatggatggatggatggat 29660
>emb|BX914207.15| Zebrafish DNA sequence from clone DKEY-158P11 in linkage group 4, complete sequence Length = 92140 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 4687 tcagatggatggatggatggat 4666 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 69218 gatggatggatggatggatta 69198 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 14133 agatggatggatggatggat 14152
>emb|BX927103.12| Zebrafish DNA sequence from clone DKEY-262M23 in linkage group 18, complete sequence Length = 185008 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 85642 gatggatggatggatggattag 85663 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 123319 agatggatggatggatggat 123338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 123223 gatggatggatggatggatt 123242 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 85593 agatggatggatggatggat 85612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 85210 agatggatggatggatggat 85229 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 85086 agatggatggatggatggat 85105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 85029 agatggatggatggatggat 85048
>emb|CR381630.12| Zebrafish DNA sequence from clone CH211-234G24 in linkage group 18, complete sequence Length = 152854 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 77212 cagatggatggatggatggatt 77191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 124964 gatggatggatggatggatt 124983 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 110074 agatggatggatggatggat 110055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 108228 agatggatggatggatggat 108247 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105851 agatggatggatggatggat 105870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105607 agatggatggatggatggat 105626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105475 agatggatggatggatggat 105494 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105307 agatggatggatggatggat 105326 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105020 agatggatggatggatggat 105039 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 76309 gatggatggatggatggatt 76290
>emb|CR376851.5| Zebrafish DNA sequence from clone DKEY-48N5 in linkage group 22, complete sequence Length = 51574 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 46874 gatggatggatggatggattag 46895
>emb|AL592289.22| Zebrafish DNA sequence from clone XX-1CSE, complete sequence Length = 85307 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 44160 cagatggatggatggatggatt 44181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 52665 agatggatggatggatggat 52646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 52576 agatggatggatggatggat 52557 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 44758 agatggatggatggatggat 44777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 29296 agatggatggatggatggat 29315 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 27520 agatggatggatggatggat 27501 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 25684 agatggatggatggatggat 25665
>emb|AL845330.16| Zebrafish DNA sequence from clone DKEY-286J15 in linkage group 22, complete sequence Length = 175991 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 88482 cagatggatggatggatggatt 88461 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 88643 cagatggatggatggatggat 88623 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 88288 cagatggatggatggatggat 88268 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 88126 cagatggatggatggatggat 88106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 88831 agatggatggatggatggat 88812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 88677 agatggatggatggatggat 88658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 88637 gatggatggatggatggatt 88618 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 88516 agatggatggatggatggat 88497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 88322 agatggatggatggatggat 88303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 88282 gatggatggatggatggatt 88263 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 88172 agatggatggatggatggat 88153 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 87923 agatggatggatggatggat 87904
>emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in linkage group 19, complete sequence Length = 179493 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 163853 tcagatggatggatggatggat 163832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 164327 agatggatggatggatggat 164308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 163635 agatggatggatggatggat 163616 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105400 agatggatggatggatggat 105419 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 105256 agatggatggatggatggat 105275 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 104968 agatggatggatggatggat 104987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 100674 agatggatggatggatggat 100693 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 100526 agatggatggatggatggat 100545 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 100242 agatggatggatggatggat 100261
>emb|CR848841.19| Zebrafish DNA sequence from clone DKEY-202I12 in linkage group 16, complete sequence Length = 205755 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggatt 297 |||||||||||||||||||||| Sbjct: 80426 cagatggatggatggatggatt 80447 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 80327 agatggatggatggatggat 80346
>gb|AC153578.4| Mus musculus 6 BAC RP23-218P2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 228417 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 175727 gatggatggatggatggattag 175748
>emb|AL935322.13| Zebrafish DNA sequence from clone CH211-239B20, complete sequence Length = 163431 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 63466 agatggatggatggatggatta 63445 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 63008 cagatggatggatggatggat 62988 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 110052 agatggatggatggatggat 110033
>emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in linkage group 18, complete sequence Length = 152902 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 40699 gatggatggatggatggattag 40678 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 64668 agatggatggatggatggat 64649 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 60748 agatggatggatggatggat 60767
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 278 gatggatggatggatggattaggcgg 303 |||||||||||||||||||| ||||| Sbjct: 18614456 gatggatggatggatggattgggcgg 18614431 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 18735784 aggcggaggcggaggaggag 18735765 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 15600006 agatggatggatggatggat 15599987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 4069605 agatggatggatggatggat 4069624
>gb|AC137708.16| Mus musculus chromosome 3, clone RP24-277H8, complete sequence Length = 154779 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 120075 gatggatggatggatggattag 120054
>emb|AL953903.8| Zebrafish DNA sequence from clone CH211-249G19, complete sequence Length = 180436 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 173730 agatggatggatggatggatta 173709 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatta 298 |||||||||||||||||||||| Sbjct: 173511 agatggatggatggatggatta 173490 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 173325 gatggatggatggatggatta 173305 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 173685 agatggatggatggatggat 173666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 279 atggatggatggatggatta 298 |||||||||||||||||||| Sbjct: 173234 atggatggatggatggatta 173215 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 154918 agatggatggatggatggat 154899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 153045 agatggatggatggatggat 153064
>emb|AL662994.3|OSJN00192 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0006L01, complete sequence Length = 162227 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 99337 tcagatggatggatggatggat 99358 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 99263 tcagatggatggatggatggat 99284
>gb|AC115633.4| Mus musculus BAC clone RP24-361I15 from 16, complete sequence Length = 135437 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 56832 gatggatggatggatggattag 56853
>gb|AC122284.5| Mus musculus BAC clone RP23-246A5 from 6, complete sequence Length = 189521 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 94118 gatggatggatggatggattag 94097
>emb|CR936437.14| Zebrafish DNA sequence from clone CH211-197I23 in linkage group 3, complete sequence Length = 96056 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 17562 gatggatggatggatggattag 17541 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 16512 agatggatggatggatggat 16493
>gb|AC162461.6| Mus musculus chromosome 5, clone RP23-265I19, complete sequence Length = 233632 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 205962 gatggatggatggatggattag 205941 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 205678 gatggatggatggatggatta 205658 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 88560 cagatggatggatggatggat 88580
>emb|AL662911.21| Mouse DNA sequence from clone RP23-110F21 on chromosome 4, complete sequence Length = 165515 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 129602 tcagatggatggatggatggat 129581
>emb|AL806512.9| Mouse DNA sequence from clone RP23-354A20 on chromosome 4, complete sequence Length = 211131 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tcagatggatggatggatggat 296 |||||||||||||||||||||| Sbjct: 186366 tcagatggatggatggatggat 186387
>emb|AL606487.15| Mouse DNA sequence from clone RP23-342L24 on chromosome 11, complete sequence Length = 136540 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 247 ttcttttttctctttttgtggc 268 |||||||||||||||||||||| Sbjct: 96154 ttcttttttctctttttgtggc 96175
>emb|AL713840.1|CNS07YOU Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 425A1 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 128620 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggattag 299 |||||||||||||||||||||| Sbjct: 55283 gatggatggatggatggattag 55262
>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence Length = 214638 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 26626 cagatggatggatggatggat 26606
>gb|AC119804.12| Mus musculus chromosome 7, clone RP23-144D10, complete sequence Length = 208232 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 171092 agatggatggatggatggatt 171072
>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence Length = 187760 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 166735 cagatggatggatggatggat 166755
>gb|AC137970.10| Mus musculus chromosome 3, clone RP23-438E13, complete sequence Length = 212827 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 125539 cagatggatggatggatggat 125559
>gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, complete sequence Length = 187046 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 8294 cagatggatggatggatggat 8274
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 27071 cagatggatggatggatggat 27091 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 26617 cagatggatggatggatggat 26637 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 26920 agatggatggatggatggat 26939
>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete sequence Length = 187080 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 127408 cagatggatggatggatggat 127428 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 128200 agatggatggatggatggat 128219 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 127372 agatggatggatggatggat 127391 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 127219 agatggatggatggatggat 127238
>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence Length = 214694 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 53374 cagatggatggatggatggat 53394
>gb|AC098644.4| Takifugu rubripes clone 205P11, complete sequence Length = 89481 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 48306 cagatggatggatggatggat 48326 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 48034 cagatggatggatggatggat 48054 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 50889 agatggatggatggatggat 50908 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatgga 295 |||||||||||||||||||| Sbjct: 48174 cagatggatggatggatgga 48193
>gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, complete sequence Length = 235928 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 225646 cagatggatggatggatggat 225626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 89982 agatggatggatggatggat 90001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 63379 agatggatggatggatggat 63398
>gb|AC169036.3| Mus musculus BAC clone RP23-382O15 from chromosome 5, complete sequence Length = 215306 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 71763 cagatggatggatggatggat 71743
>gb|AC154516.2| Mus musculus BAC clone RP24-83D23 from chromosome 14, complete sequence Length = 216566 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 99812 cagatggatggatggatggat 99832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 27143 agatggatggatggatggat 27162
>gb|AC166289.4| Mus musculus chromosome 7, clone RP24-132A16, complete sequence Length = 172931 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 166804 cagatggatggatggatggat 166784
>gb|AC117203.4| Mus musculus BAC clone RP23-251N4 from chromosome 10, complete sequence Length = 231532 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 77743 cagatggatggatggatggat 77763
>gb|AC123720.32| Mus musculus chromosome 10, clone RP23-413G8, complete sequence Length = 192037 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 64824 gatggatggatggatggatta 64804
>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence Length = 183264 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43857 cagatggatggatggatggat 43837 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43762 cagatggatggatggatggat 43742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43694 cagatggatggatggatggat 43674 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 155852 agatggatggatggatggat 155833 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 143989 agatggatggatggatggat 144008 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 43744 gatggatggatggatggatt 43725 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 43590 agatggatggatggatggat 43571 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatgga 295 |||||||||||||||||||| Sbjct: 10665 cagatggatggatggatgga 10684 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 4986 agatggatggatggatggat 4967
>gb|AC152353.1| Pan troglodytes chromosome X clone RP43-001P01 map human ortholog p22.31, complete sequence Length = 218326 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 113560 gatggatggatggatggatta 113580
>gb|AC164539.4| Mus musculus chromosome 1, clone wi1-168J17, complete sequence Length = 43396 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 27279 cagatggatggatggatggat 27299 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 27255 cagatggatggatggatggat 27275
>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence Length = 216652 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 180547 cagatggatggatggatggat 180567
>gb|AC150432.2| Branchiostoma floridae clone CH302-9D15, complete sequence Length = 173785 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 83735 cagatggatggatggatggat 83715 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 83546 agatggatggatggatggat 83527
>gb|AC125267.18| Mus musculus chromosome 10, clone RP24-483E18, complete sequence Length = 203922 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 11224 cagatggatggatggatggat 11204 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 10999 agatggatggatggatggat 10980
>gb|AC134409.12| Mus musculus chromosome 5, clone RP24-355F10, complete sequence Length = 141528 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 138706 cagatggatggatggatggat 138686
>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence Length = 181717 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 127252 cagatggatggatggatggat 127232
>gb|AC132489.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete sequence Length = 146677 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggagc 318 ||||||||||||||||||||| Sbjct: 101484 aggcggaggcggaggaggagc 101504
>gb|AY771996.1| Homo sapiens interleukin 12 receptor, beta 1 (IL12RB1) gene, complete cds Length = 30584 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 4307 gatggatggatggatggatta 4327
>gb|AC119915.12| Mus musculus chromosome 7, clone RP24-244N16, complete sequence Length = 168834 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 142097 cagatggatggatggatggat 142077
>gb|AC158974.8| Mus musculus chromosome 15, clone RP24-252G18, complete sequence Length = 170539 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 125915 cagatggatggatggatggat 125895 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 113470 agatggatggatggatggatt 113450 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 113442 agatggatggatggatggat 113423
>gb|U82757.1|HSU82757 Human 11p13 sequence upstream from Wilms tumor suppressor (WT1) gene, cosmid C2.1, complete sequence Length = 25966 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 11362 gatggatggatggatggatta 11382
>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence Length = 1590432 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 481742 cagatggatggatggatggat 481722
>gb|AC005351.1| Homo sapiens chromosome 5, BAC clone 78c6 (LBNL H191), complete sequence Length = 47812 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 6222 gatggatggatggatggatta 6242
>gb|AC087325.9| Trypanosoma brucei chromosome 4 clone RPCI93-29M18, complete sequence Length = 123258 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 33988 cagatggatggatggatggat 33968
>gb|AC154871.13| Mus musculus chromosome 1, clone RP23-354B17, complete sequence Length = 211644 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 104327 cagatggatggatggatggat 104307 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 47094 agatggatggatggatggat 47075
>gb|AC140724.4| Mus musculus chromosome 8, clone RP24-291N1, complete sequence Length = 159182 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 151422 cagatggatggatggatggat 151402
>gb|AC130561.11| Rattus norvegicus BAC CH230-161F3 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 161423 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 58782 cagatggatggatggatggat 58802
>gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 198520 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 22775 cagatggatggatggatggat 22795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 22793 gatggatggatggatggatt 22812
>gb|AC165424.2| Mus musculus BAC clone RP24-68L23 from chromosome 17, complete sequence Length = 178781 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 148275 agatggatggatggatggatt 148295 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 148323 agatggatggatggatggat 148342
>gb|AC166357.3| Mus musculus BAC clone RP23-360N1 from chromosome 7, complete sequence Length = 220916 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 140464 cagatggatggatggatggat 140484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 41603 agatggatggatggatggat 41584
>gb|AC137676.11| Mus musculus chromosome 5, clone RP23-1N19, complete sequence Length = 187726 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 45631 cagatggatggatggatggat 45651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 129123 agatggatggatggatggat 129142
>gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, complete sequence Length = 200362 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 29668 cagatggatggatggatggat 29688
>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence Length = 179251 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 174327 cagatggatggatggatggat 174347
>gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's Hospital Oakland Research Institute) complete sequence Length = 231202 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 193748 cagatggatggatggatggat 193728 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 193501 cagatggatggatggatggat 193481
>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 231716 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 87237 cagatggatggatggatggat 87257
>gb|AC126403.7| Mus musculus chromosome 15, clone RP24-483E7, complete sequence Length = 152384 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 38556 cagatggatggatggatggat 38576
>gb|AC123722.8| Mus musculus chromosome 5, clone RP23-424O22, complete sequence Length = 205851 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 171432 cagatggatggatggatggat 171452
>gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome 17, complete sequence Length = 201331 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 359 cagatggatggatggatggat 379
>gb|AC134472.4| Mus musculus BAC clone RP23-123E16 from chromosome 18, complete sequence Length = 185134 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 100902 cagatggatggatggatggat 100882
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 70989 cagatggatggatggatggat 70969 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 53452 agatggatggatggatggat 53433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 18937 agatggatggatggatggat 18918
>gb|AC147377.4| Mus musculus BAC clone RP23-156K23 from chromosome 5, complete sequence Length = 236084 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 111771 gatggatggatggatggatta 111791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 64208 agatggatggatggatggat 64227
>gb|AC186368.1| Pan troglodytes chromosome 7 clone CH251-329G12, complete sequence Length = 146205 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 83626 cagatggatggatggatggat 83646
>gb|AC117586.10| Mus musculus chromosome 3, clone RP23-166M8, complete sequence Length = 215166 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 121406 cagatggatggatggatggat 121426
>gb|AC105062.13| Mus musculus chromosome 7, clone RP24-528E17, complete sequence Length = 162502 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 97725 gatggatggatggatggatta 97745
>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete sequence Length = 174754 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 45001 cagatggatggatggatggat 44981
>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome 19 Length = 413528 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 262159 cagatggatggatggatggat 262179
>gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08, complete sequence Length = 142196 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 52860 cagatggatggatggatggat 52840
>gb|AC129219.3| Mus musculus BAC clone RP24-474C15 from chromosome 14, complete sequence Length = 195935 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 177492 cagatggatggatggatggat 177512 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 104823 agatggatggatggatggat 104842
>gb|AC132460.3| Mus musculus BAC clone RP23-31O23 from chromosome 17, complete sequence Length = 203971 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 41417 cagatggatggatggatggat 41397
>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence Length = 172606 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 45405 cagatggatggatggatggat 45385
>gb|AC136641.3| Mus musculus BAC clone RP23-313G19 from chromosome 7, complete sequence Length = 215208 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 61700 cagatggatggatggatggat 61720 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 61761 agatggatggatggatggat 61780
>gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete sequence Length = 366816 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 189825 gatggatggatggatggatta 189845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 30754 agatggatggatggatggat 30773
>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence Length = 189304 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 40407 cagatggatggatggatggat 40387
>gb|AC183431.1| Mus musculus BAC clone RP24-128G23 from chromosome y, complete sequence Length = 158633 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 86459 cagatggatggatggatggat 86439
>gb|AC139377.4| Mus musculus chromosome 5 clone RP24-291G12, complete sequence Length = 191100 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 57594 agatggatggatggatggatt 57574
>gb|AC149031.1| Rhinolophus ferrumequinum clone VMRC7-44G7, complete sequence Length = 192138 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 176752 cagatggatggatggatggat 176772
>gb|AC144824.2| Danio rerio clone CH211-172M22, complete sequence Length = 127576 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 62945 cagatggatggatggatggat 62925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 75021 agatggatggatggatggat 75002 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 63074 agatggatggatggatggat 63055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 62668 agatggatggatggatggat 62649 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 62368 agatggatggatggatggat 62349
>gb|AC120347.7| Mus musculus chromosome 13, clone RP23-262I3, complete sequence Length = 227644 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 45967 cagatggatggatggatggat 45947
>gb|AF252827.5| Homo sapiens chromosome 8 clone RP11-166E20 map q24.13, complete sequence Length = 165347 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 128819 cagatggatggatggatggat 128839
>gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-203F1, complete sequence Length = 148170 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 63173 cagatggatggatggatggat 63193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 63030 agatggatggatggatggat 63049
>gb|AC140051.10| Mus musculus chromosome 12, clone RP23-296J15, complete sequence Length = 205123 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 148984 cagatggatggatggatggat 148964
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 119576 agatggatggatggatggatt 119596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 184110 agatggatggatggatggat 184091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 119470 gatggatggatggatggatt 119489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 81198 agatggatggatggatggat 81217
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold Length = 1996640 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 1886808 cagatggatggatggatggat 1886788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 1886762 gatggatggatggatggatt 1886743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 1264284 agatggatggatggatggat 1264265
>gb|AC125274.12| Mus musculus chromosome 15, clone RP24-157F9, complete sequence Length = 188060 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43581 cagatggatggatggatggat 43561 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggatt 297 ||||||||||||||||||||| Sbjct: 31136 agatggatggatggatggatt 31116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 31108 agatggatggatggatggat 31089
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatta 298 ||||||||||||||||||||| Sbjct: 9978559 gatggatggatggatggatta 9978539 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 35848203 agatggatggatggatggat 35848184 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 32801337 aggcggaggcggaggaggag 32801356 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 32712971 agatggatggatggatggat 32712990 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 26437181 agatggatggatggatggat 26437162 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 279 atggatggatggatggatta 298 |||||||||||||||||||| Sbjct: 26284855 atggatggatggatggatta 26284874 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 11622952 agatggatggatggatggat 11622933 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 11522137 gatggatggatggatggatt 11522156 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 11301310 agatggatggatggatggat 11301329 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 aggcggaggcggaggaggag 317 |||||||||||||||||||| Sbjct: 79256 aggcggaggcggaggaggag 79237
>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence Length = 193489 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 155197 cagatggatggatggatggat 155217 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 155657 agatggatggatggatggat 155676 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 155445 agatggatggatggatggat 155464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 155421 agatggatggatggatggat 155440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 155313 agatggatggatggatggat 155332
>gb|AC164306.3| Mus musculus BAC clone RP23-190A21 from chromosome 17, complete sequence Length = 206180 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 36666 cagatggatggatggatggat 36686 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 191029 agatggatggatggatggat 191010 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 189346 agatggatggatggatggat 189327
>gb|AC156937.4| Mus musculus BAC clone RP23-355I5 from chromosome 8, complete sequence Length = 198479 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 92365 cagatggatggatggatggat 92385 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 92689 agatggatggatggatggat 92708 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 92514 agatggatggatggatggat 92533
>gb|AC110235.13| Mus musculus chromosome 9, clone RP23-100M12, complete sequence Length = 220755 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 70 cagatggatggatggatggat 50 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 184364 gatggatggatggatggatt 184383
>gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome 12, complete sequence Length = 176949 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 32425 cagatggatggatggatggat 32405 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 124078 agatggatggatggatggat 124059 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 32475 agatggatggatggatggat 32456
>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 264561 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 176758 cagatggatggatggatggat 176778 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 177082 agatggatggatggatggat 177101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 177062 agatggatggatggatggat 177081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 135685 agatggatggatggatggat 135704
>gb|AC144825.2| Danio rerio clone CH211-178A5, complete sequence Length = 53370 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 753 cagatggatggatggatggat 773
>gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosome 5, complete sequence Length = 173460 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 135016 cagatggatggatggatggat 134996 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 134921 cagatggatggatggatggat 134901 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 134853 cagatggatggatggatggat 134833 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 37229 cagatggatggatggatggat 37209 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 134903 gatggatggatggatggatt 134884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 134749 agatggatggatggatggat 134730 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatgga 295 |||||||||||||||||||| Sbjct: 101824 cagatggatggatggatgga 101843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 96145 agatggatggatggatggat 96126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 1864 agatggatggatggatggat 1845
>gb|AC175494.3| Mus musculus BAC clone RP24-75G20 from chromosome y, complete sequence Length = 229858 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 45558 cagatggatggatggatggat 45578 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 158929 agatggatggatggatggat 158910
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 116258 cagatggatggatggatggat 116278 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 168310 agatggatggatggatggat 168329 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 133795 agatggatggatggatggat 133814
>gb|AC121992.3| Mus musculus BAC clone RP24-300I17 from chromosome 12, complete sequence Length = 139943 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 120170 cagatggatggatggatggat 120190
>gb|AC101762.7| Mus musculus chromosome 7, clone RP24-315G8, complete sequence Length = 185445 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 172024 cagatggatggatggatggat 172004
>gb|AC005056.2| Homo sapiens BAC clone CTB-51J22 from 7, complete sequence Length = 98188 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43663 cagatggatggatggatggat 43683 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 gatggatggatggatggatt 297 |||||||||||||||||||| Sbjct: 44233 gatggatggatggatggatt 44252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 44052 agatggatggatggatggat 44071 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 43936 agatggatggatggatggat 43955
>gb|AC004851.2| Homo sapiens PAC clone RP4-665P5 from 7, complete sequence Length = 71627 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 49746 cagatggatggatggatggat 49726
>emb|CR382386.8| Zebrafish DNA sequence from clone DKEY-111O10 in linkage group 14, complete sequence Length = 162528 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 26318 cagatggatggatggatggat 26338
>gb|AC095326.9| Rattus norvegicus 1 BAC CH230-89E14 (Children's Hospital Oakland Research Institute) complete sequence Length = 219914 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 149627 cagatggatggatggatggat 149647
>gb|AC145344.2| Mus musculus BAC clone RP24-134P13 from chromosome Y, complete sequence Length = 183987 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 94675 cagatggatggatggatggat 94655
>gb|AC144581.3| Mus musculus BAC clone RP24-341C2 from chromosome Y, complete sequence Length = 162743 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 112903 cagatggatggatggatggat 112923
>gb|AC109495.4| Homo sapiens chromosome 16 clone RP11-916L7, complete sequence Length = 120065 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 43220 cagatggatggatggatggat 43240
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 143676 cagatggatggatggatggat 143696 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 143226 cagatggatggatggatggat 143246 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 143525 agatggatggatggatggat 143544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 40551 agatggatggatggatggat 40570
>gb|AF281658.1| Mus musculus zinc-alpha2-glycoprotein gene, complete cds Length = 8621 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 1343 cagatggatggatggatggat 1363
>gb|DQ483439.1| Gymnogyps californianus clone 142H microsatellite sequence Length = 2273 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 2041 cagatggatggatggatggat 2021
>gb|DQ483416.1| Gymnogyps californianus clone 119H microsatellite sequence Length = 470 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 cagatggatggatggatggat 296 ||||||||||||||||||||| Sbjct: 213 cagatggatggatggatggat 233 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 agatggatggatggatggat 296 |||||||||||||||||||| Sbjct: 180 agatggatggatggatggat 199 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,954,450 Number of Sequences: 3902068 Number of extensions: 3954450 Number of successful extensions: 444708 Number of sequences better than 10.0: 6464 Number of HSP's better than 10.0 without gapping: 6517 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 227701 Number of HSP's gapped (non-prelim): 191605 length of query: 409 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 387 effective length of database: 17,147,199,772 effective search space: 6635966311764 effective search space used: 6635966311764 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)