| Clone Name | rbaet37c01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 638 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 637 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 581
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21, complete sequence Length = 138969 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Plus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 19780 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 19781 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 19837
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Plus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 22811005 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 22811006 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 22811062
>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full insert sequence Length = 1377 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Plus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 41 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 160 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 161 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 217
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full insert sequence Length = 1138 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 700 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 699 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 643
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full insert sequence Length = 1144 Score = 216 bits (109), Expect = 4e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 701 Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415 ||||||| |||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 700 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 644
>gb|AY103838.1| Zea mays PCO113775 mRNA sequence Length = 958 Score = 184 bits (93), Expect = 2e-43 Identities = 135/149 (90%) Strand = Plus / Minus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| ||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| | Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 692 Query: 359 cggtgtcggggatgtagatgccgtccttg 387 || |||||||||||||| |||||||||| Sbjct: 691 cgacgtcggggatgtagacgccgtccttg 663
>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA, complete cds Length = 1040 Score = 155 bits (78), Expect = 1e-34 Identities = 129/146 (88%) Strand = Plus / Minus Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298 |||| |||||||||||||| ||||||||||||| || ||||||||||| ||| ||||| Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715 Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358 ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| | Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 655 Query: 359 cggtgtcggggatgtagatgccgtcc 384 || |||||||||||||| ||||||| Sbjct: 654 cgacgtcggggatgtagacgccgtcc 629
>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence Length = 757 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 698 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 697 gagcttgtcgacgtcggggatgtagacgccgtccttg 661
>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence Length = 755 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence Length = 755 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence Length = 755 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence Length = 761 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387 ||||| ||| |||||||||||||| |||||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
>ref|NM_101449.3| Arabidopsis thaliana structural constituent of ribosome AT1G15810 mRNA, complete cds Length = 2301 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Plus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 1768 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 1827 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 1828 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 1874
>ref|NM_101450.3| Arabidopsis thaliana LHCB6; chlorophyll binding AT1G15820 (LHCB6) mRNA, complete cds Length = 1439 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 866 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 807 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 806 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 760
>gb|BT015552.1| Arabidopsis thaliana At1g15820 mRNA sequence Length = 705 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 689 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 630 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 629 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 583
>gb|AY081644.1| Arabidopsis thaliana chlorophyll A-B binding protein (At1g15820) mRNA, complete cds Length = 877 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 761 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 702 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 701 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 655
>gb|AY065113.1| Arabidopsis thaliana Lhcb6 protein (At1g15820; F7H2.16) mRNA, complete cds Length = 997 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 853 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 794 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 793 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 747
>gb|AF332425.1| Arabidopsis thaliana clone C00095 (e) putative chlorophyll binding protein (At1g15820) mRNA, complete cds Length = 777 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 761 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 702 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 701 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 655
>emb|BX814656.1|CNS0ADQI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZF03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 969 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 829 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 770 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 769 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 723
>emb|BX814290.1|CNS0ADTW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZD05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 937 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 832 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 773 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 772 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 726
>emb|BX815381.1|CNS0AD00 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZD06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 917 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 833 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 774 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 773 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 727
>emb|BX815093.1|CNS0AD0B Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS31ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 974 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 835 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 776 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 775 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 729
>emb|BX815230.1|CNS0ACSL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS44ZD05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 915 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 799 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 740 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 739 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 693
>gb|AF134130.1| Arabidopsis thaliana Lhcb6 protein (Lhcb6) mRNA, complete cds Length = 960 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 842 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 783 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 782 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 736
>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 77521 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Plus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 59274 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 59333 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| ||||| |||| || |||| ||| |||||||| Sbjct: 59334 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 59380
>gb|AY641832.1| Brassica rapa subsp. pekinensis Lhcb6 protein mRNA, partial cds Length = 856 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| || ||||| ||||| ||||| || ||||||||||| ||||| |||||||| || Sbjct: 750 ccgagaggtgtcttcccctgcccggcttcaaagtaaaagatcagcattgcaagcattgct 691 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | |||||||| ||||| |||| ||| | |||||| |||||||| Sbjct: 690 agcctagagtgcttaatctccgccaacttcaaccgctccagcttctc 644
>emb|BX813718.1|CNS0ADUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB36ZC04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 815 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 756 Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359 || | ||||||||| || || |||| || |||| ||| |||||||| Sbjct: 755 agcctcgagtgcttaatttctgccaatttcagcctctccagcttctc 709
>emb|BX813594.1|CNS0ADNW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZA04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 52.0 bits (26), Expect = 0.001 Identities = 53/62 (85%) Strand = Plus / Minus Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312 ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| ||| Sbjct: 834 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 775 Query: 313 ag 314 || Sbjct: 774 ag 773
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29 Length = 1162 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||||| |||||||||||| |||| || |||||||| Sbjct: 760 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 716
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence Length = 1225 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||||| |||||||||||| |||| || |||||||| Sbjct: 805 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 761
>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome Length = 10294 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 249 cgcgccgagcggcgtcttgccct 271 ||||||||||||||||||||||| Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291
>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA Length = 3680 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 1294 taaaagaagtcacggacacaga 1273
>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete cds Length = 2728 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 1191 taaaagaagtcacggacacaga 1170
>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete cds Length = 2748 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 1191 taaaagaagtcacggacacaga 1170
>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531 IMAGE:30475340), complete cds Length = 2020 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 1016 taaaagaagtcacggacacaga 995
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete sequence Length = 198595 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 22923 taaaagaagtcacggacacaga 22902
>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds Length = 2151 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 874 taaaagaagtcacggacacaga 853
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete sequence Length = 189362 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 22495 taaaagaagtcacggacacaga 22516
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 329 tctcggccaccttgagccgctc 350 |||||||||||||||||||||| Sbjct: 3855385 tctcggccaccttgagccgctc 3855406
>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds Length = 3680 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 taaaagaagtcacggacacaga 126 |||||||||||||||||||||| Sbjct: 1294 taaaagaagtcacggacacaga 1273
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1156 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1152 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1162 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1183 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1221 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence Length = 51685 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 atcccattcaatccatgcgtc 179 ||||||||||||||||||||| Sbjct: 5637 atcccattcaatccatgcgtc 5617
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Plus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 22263178 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 22263222
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0567H04 Length = 181420 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Plus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 68424 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 68468
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full insert sequence Length = 1234 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full insert sequence Length = 1152 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full insert sequence Length = 1169 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 800 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 756
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full insert sequence Length = 1183 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full insert sequence Length = 1156 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full insert sequence Length = 1221 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA, complete cds Length = 1178 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>ref|XM_469768.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1724 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 757 ctcgccaccgaggccgaggg 776
>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete sequence Length = 199215 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 tatatattacatggtacata 52 |||||||||||||||||||| Sbjct: 53057 tatatattacatggtacata 53076
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 244 ccgagcgcgccgagcggcgt 263 |||||||||||||||||||| Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420
>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence Length = 574126 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 58714 ctcgccaccgaggccgaggg 58695
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 30636507 ctcgccaccgaggccgaggg 30636488
>gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete sequence Length = 157970 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 125885 ctcgccaccgaggccgaggg 125904
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 244 ccgagcgcgccgagcggcgt 263 |||||||||||||||||||| Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55 Length = 194916 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 229 aaatcatcttatagaccgag 248 |||||||||||||||||||| Sbjct: 55520 aaatcatcttatagaccgag 55539
>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project) Length = 95266 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 229 aaatcatcttatagaccgag 248 |||||||||||||||||||| Sbjct: 42512 aaatcatcttatagaccgag 42531
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 gaccgagcgcgccgagcggc 261 |||||||||||||||||||| Sbjct: 404087 gaccgagcgcgccgagcggc 404068
>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence Length = 143534 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 actatatattacatggtaca 50 |||||||||||||||||||| Sbjct: 110106 actatatattacatggtaca 110125
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 40.1 bits (20), Expect = 5.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 354 cttctcggtgtcggggatgtagatgccg 381 |||| |||||||||||||||||| |||| Sbjct: 2052833 cttcgcggtgtcggggatgtagaggccg 2052860
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 244 ccgagcgcgccgagcggcgt 263 |||||||||||||||||||| Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 30727929 ctcgccaccgaggccgaggg 30727910
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 gtctcgccaccgaggccgag 407 |||||||||||||||||||| Sbjct: 8759993 gtctcgccaccgaggccgag 8759974
>gb|AF440828.1| Streptomyces avermitilis Imp1 (imp1) gene, partial cds; Imp2 (imp2) gene, complete cds; and unknown genes Length = 7996 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 gtctcgccaccgaggccgag 407 |||||||||||||||||||| Sbjct: 7684 gtctcgccaccgaggccgag 7665
>dbj|AK111876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046K17, full insert sequence Length = 1571 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 696 ctcgccaccgaggccgaggg 715
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein Length = 470 Score = 40.1 bits (20), Expect = 5.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 306 catggcgaggcgcgagtgcttgatctcggcca 337 |||||||||||| | |||||||||||| |||| Sbjct: 107 catggcgaggcgggcgtgcttgatctccgcca 76
>dbj|AK099001.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013102B14, full insert sequence Length = 1570 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ctcgccaccgaggccgaggg 409 |||||||||||||||||||| Sbjct: 710 ctcgccaccgaggccgaggg 729
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 342 gagccgctcaagcttctcgg 361 |||||||||||||||||||| Sbjct: 1360159 gagccgctcaagcttctcgg 1360140
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 40.1 bits (20), Expect = 5.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 388 gtctcgccaccgaggccgagggggtcga 415 ||||||||||||| |||||| ||||||| Sbjct: 509954 gtctcgccaccgaagccgagcgggtcga 509981
>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence Length = 160030 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 tatatattacatggtacata 52 |||||||||||||||||||| Sbjct: 14348 tatatattacatggtacata 14329 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,204,059 Number of Sequences: 3902068 Number of extensions: 4204059 Number of successful extensions: 61741 Number of sequences better than 10.0: 90 Number of HSP's better than 10.0 without gapping: 90 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 60866 Number of HSP's gapped (non-prelim): 875 length of query: 415 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 393 effective length of database: 17,147,199,772 effective search space: 6738849510396 effective search space used: 6738849510396 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)