ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet37c01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predic... 216 4e-53
2emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4,... 216 4e-53
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 216 4e-53
4dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
5dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
6dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
7gb|AY103838.1| Zea mays PCO113775 mRNA sequence 184 2e-43
8gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein... 155 1e-34
9gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence 113 5e-22
10gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 geno... 113 5e-22
11gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 geno... 113 5e-22
12gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 geno... 113 5e-22
13gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 geno... 113 5e-22
14gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 geno... 113 5e-22
15gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 geno... 113 5e-22
16gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 gen... 113 5e-22
17gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 gen... 113 5e-22
18gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 geno... 113 5e-22
19gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 geno... 113 5e-22
20gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 geno... 113 5e-22
21gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 geno... 113 5e-22
22gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 geno... 113 5e-22
23gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 geno... 113 5e-22
24gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 geno... 113 5e-22
25gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 geno... 113 5e-22
26ref|NM_101449.3| Arabidopsis thaliana structural constituent of ... 70 6e-09
27ref|NM_101450.3| Arabidopsis thaliana LHCB6; chlorophyll binding... 70 6e-09
28gb|BT015552.1| Arabidopsis thaliana At1g15820 mRNA sequence 70 6e-09
29gb|AY081644.1| Arabidopsis thaliana chlorophyll A-B binding prot... 70 6e-09
30gb|AY065113.1| Arabidopsis thaliana Lhcb6 protein (At1g15820; F7... 70 6e-09
31gb|AF332425.1| Arabidopsis thaliana clone C00095 (e) putative ch... 70 6e-09
32emb|BX814656.1|CNS0ADQI Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
33emb|BX814290.1|CNS0ADTW Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
34emb|BX815381.1|CNS0AD00 Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
35emb|BX815093.1|CNS0AD0B Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
36emb|BX815230.1|CNS0ACSL Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
37gb|AF134130.1| Arabidopsis thaliana Lhcb6 protein (Lhcb6) mRNA, ... 70 6e-09
38gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thalian... 70 6e-09
39gb|AY641832.1| Brassica rapa subsp. pekinensis Lhcb6 protein mRN... 62 2e-06
40emb|BX813718.1|CNS0ADUD Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
41emb|BX813594.1|CNS0ADNW Arabidopsis thaliana Full-length cDNA Co... 52 0.001
42emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding p... 50 0.006
43gb|AY103995.1| Zea mays PCO102677 mRNA sequence 50 0.006
44gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of... 46 0.090
45ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra)... 44 0.36
46gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31r... 44 0.36
47gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31r... 44 0.36
48gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDN... 44 0.36
49gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosom... 44 0.36
50gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, c... 44 0.36
51gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosom... 44 0.36
52dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.36
53dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, co... 44 0.36
54ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
55ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
56ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
57ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
58ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
59gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete se... 42 1.4
60dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
61dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
62dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
63dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
64dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
65dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
66dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
67dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
68gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding prot... 42 1.4
69ref|XM_469768.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.6
70gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 40 5.6
71gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 5.6
72gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 5.6
73gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 5.6
74gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genom... 40 5.6
75emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 5.6
76emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ... 40 5.6
77emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA... 40 5.6
78gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.6
79gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, comp... 40 5.6
80gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 5.6
81gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 5.6
82dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
83dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.6
84gb|AF440828.1| Streptomyces avermitilis Imp1 (imp1) gene, partia... 40 5.6
85dbj|AK111876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
86emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chloroph... 40 5.6
87dbj|AK099001.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
88gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome 40 5.6
89emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 5.6
90gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, compl... 40 5.6

>ref|XM_472726.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 638

                                                                    
Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
           ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 637 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 581



to top

>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21,
             complete sequence
          Length = 138969

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Plus

                                                                         
Query: 239   atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
             |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720

                                                                         
Query: 299   tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
             |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 19780

                                                                      
Query: 359   cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
             ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 19781 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 19837



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Plus

                                                                            
Query: 239      atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
                |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945

                                                                            
Query: 299      tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
                |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 22811005

                                                                         
Query: 359      cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
                ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 22811006 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 22811062



to top

>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full
           insert sequence
          Length = 1377

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Plus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 41  ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 160

                                                                    
Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
           ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 161 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 217



to top

>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full
           insert sequence
          Length = 1138

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 700

                                                                    
Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
           ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 699 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 643



to top

>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full
           insert sequence
          Length = 1144

 Score =  216 bits (109), Expect = 4e-53
 Identities = 160/177 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 701

                                                                    
Query: 359 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgagggggtcga 415
           ||||||| |||||||||| ||||||| |||||||||| ||||||||||| |||||||
Sbjct: 700 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgagcgggtcga 644



to top

>gb|AY103838.1| Zea mays PCO113775 mRNA sequence
          Length = 958

 Score =  184 bits (93), Expect = 2e-43
 Identities = 135/149 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||||||||||||||||||||||||||| |||||||||||||| |||  |||||
Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| |
Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 692

                                        
Query: 359 cggtgtcggggatgtagatgccgtccttg 387
           ||  |||||||||||||| ||||||||||
Sbjct: 691 cgacgtcggggatgtagacgccgtccttg 663



to top

>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA,
           complete cds
          Length = 1040

 Score =  155 bits (78), Expect = 1e-34
 Identities = 129/146 (88%)
 Strand = Plus / Minus

                                                                       
Query: 239 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagca 298
           |||| ||||||||||||||  ||||||||||||| || ||||||||||| |||  |||||
Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715

                                                                       
Query: 299 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 358
           ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| |
Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 655

                                     
Query: 359 cggtgtcggggatgtagatgccgtcc 384
           ||  |||||||||||||| |||||||
Sbjct: 654 cgacgtcggggatgtagacgccgtcc 629



to top

>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence
          Length = 757

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 698

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 697 gagcttgtcgacgtcggggatgtagacgccgtccttg 661



to top

>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659



to top

>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659



to top

>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659



to top

>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 351 aagcttctcggtgtcggggatgtagatgccgtccttg 387
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665



to top

>ref|NM_101449.3| Arabidopsis thaliana structural constituent of ribosome AT1G15810
            mRNA, complete cds
          Length = 2301

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                        
Query: 253  ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
            ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 1768 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 1827

                                                           
Query: 313  aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
            || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 1828 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 1874



to top

>ref|NM_101450.3| Arabidopsis thaliana LHCB6; chlorophyll binding AT1G15820 (LHCB6)
           mRNA, complete cds
          Length = 1439

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 866 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 807

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 806 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 760



to top

>gb|BT015552.1| Arabidopsis thaliana At1g15820 mRNA sequence
          Length = 705

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 689 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 630

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 629 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 583



to top

>gb|AY081644.1| Arabidopsis thaliana chlorophyll A-B binding protein (At1g15820)
           mRNA, complete cds
          Length = 877

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 761 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 702

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 701 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 655



to top

>gb|AY065113.1| Arabidopsis thaliana Lhcb6 protein (At1g15820; F7H2.16) mRNA,
           complete cds
          Length = 997

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 853 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 794

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 793 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 747



to top

>gb|AF332425.1| Arabidopsis thaliana clone C00095 (e) putative chlorophyll binding
           protein (At1g15820) mRNA, complete cds
          Length = 777

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 761 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 702

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 701 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 655



to top

>emb|BX814656.1|CNS0ADQI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 969

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 829 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 770

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 769 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 723



to top

>emb|BX814290.1|CNS0ADTW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 832 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 773

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 772 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 726



to top

>emb|BX815381.1|CNS0AD00 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 917

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 833 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 774

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 773 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 727



to top

>emb|BX815093.1|CNS0AD0B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS31ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 974

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 835 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 776

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 775 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 729



to top

>emb|BX815230.1|CNS0ACSL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS44ZD05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 915

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 799 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 740

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 739 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 693



to top

>gb|AF134130.1| Arabidopsis thaliana Lhcb6 protein (Lhcb6) mRNA, complete cds
          Length = 960

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 842 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 783

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 782 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 736



to top

>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 77521

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                         
Query: 253   ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
             ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 59274 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 59333

                                                            
Query: 313   aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
             || | ||||||||| ||||| ||||  || |||| ||| ||||||||
Sbjct: 59334 agcctcgagtgcttaatctctgccaatttcagcctctccagcttctc 59380



to top

>gb|AY641832.1| Brassica rapa subsp. pekinensis Lhcb6 protein mRNA, partial cds
          Length = 856

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| || ||||| ||||| ||||| || ||||||||||| ||||| |||||||| || 
Sbjct: 750 ccgagaggtgtcttcccctgcccggcttcaaagtaaaagatcagcattgcaagcattgct 691

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || |  |||||||| ||||| |||| ||| | |||||| ||||||||
Sbjct: 690 agcctagagtgcttaatctccgccaacttcaaccgctccagcttctc 644



to top

>emb|BX813718.1|CNS0ADUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB36ZC04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 973

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 815 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 756

                                                          
Query: 313 aggcgcgagtgcttgatctcggccaccttgagccgctcaagcttctc 359
           || | ||||||||| || || ||||  || |||| ||| ||||||||
Sbjct: 755 agcctcgagtgcttaatttctgccaatttcagcctctccagcttctc 709



to top

>emb|BX813594.1|CNS0ADNW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 950

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 253 ccgagcggcgtcttgccctgtccggcctcgaagtaaaagatgagcatggcaagcatggcg 312
           ||||| ||||| || ||||| |||||||| ||||||||||| | |||||||| ||| |||
Sbjct: 834 ccgagaggcgttttcccctgcccggcctcaaagtaaaagatcaacatggcaaccattgcg 775

             
Query: 313 ag 314
           ||
Sbjct: 774 ag 773



to top

>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29
          Length = 1162

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||||| |||||||||||| |||| ||  ||||||||
Sbjct: 760 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 716



to top

>gb|AY103995.1| Zea mays PCO102677 mRNA sequence
          Length = 1225

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||||| |||||||||||| |||| ||  ||||||||
Sbjct: 805 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 761



to top

>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome
          Length = 10294

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 249  cgcgccgagcggcgtcttgccct 271
            |||||||||||||||||||||||
Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291



to top

>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  taaaagaagtcacggacacaga 126
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273



to top

>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2728

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  taaaagaagtcacggacacaga 126
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170



to top

>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2748

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  taaaagaagtcacggacacaga 126
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170



to top

>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531
            IMAGE:30475340), complete cds
          Length = 2020

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  taaaagaagtcacggacacaga 126
            ||||||||||||||||||||||
Sbjct: 1016 taaaagaagtcacggacacaga 995



to top

>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete
             sequence
          Length = 198595

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 105   taaaagaagtcacggacacaga 126
             ||||||||||||||||||||||
Sbjct: 22923 taaaagaagtcacggacacaga 22902



to top

>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds
          Length = 2151

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 105 taaaagaagtcacggacacaga 126
           ||||||||||||||||||||||
Sbjct: 874 taaaagaagtcacggacacaga 853



to top

>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete
             sequence
          Length = 189362

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 105   taaaagaagtcacggacacaga 126
             ||||||||||||||||||||||
Sbjct: 22495 taaaagaagtcacggacacaga 22516



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 329     tctcggccaccttgagccgctc 350
               ||||||||||||||||||||||
Sbjct: 3855385 tctcggccaccttgagccgctc 3855406



to top

>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  taaaagaagtcacggacacaga 126
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273



to top

>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1156

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747



to top

>ref|XM_478692.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742



to top

>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749



to top

>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749



to top

>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763



to top

>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence
          Length = 51685

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  atcccattcaatccatgcgtc 179
            |||||||||||||||||||||
Sbjct: 5637 atcccattcaatccatgcgtc 5617



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                             
Query: 306      catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
                |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 22263178 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 22263222



to top

>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 306   catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
             |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 68424 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 68468



to top

>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full
           insert sequence
          Length = 1234

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749



to top

>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full
           insert sequence
          Length = 1152

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742



to top

>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full
           insert sequence
          Length = 1169

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 800 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 756



to top

>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full
           insert sequence
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749



to top

>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full
           insert sequence
          Length = 1156

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747



to top

>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full
           insert sequence
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763



to top

>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA,
           complete cds
          Length = 1178

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 306 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 350
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747



to top

>ref|XM_469768.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1724

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 ctcgccaccgaggccgaggg 409
           ||||||||||||||||||||
Sbjct: 757 ctcgccaccgaggccgaggg 776



to top

>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    tatatattacatggtacata 52
             ||||||||||||||||||||
Sbjct: 53057 tatatattacatggtacata 53076



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     ccgagcgcgccgagcggcgt 263
               ||||||||||||||||||||
Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420



to top

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 390   ctcgccaccgaggccgaggg 409
             ||||||||||||||||||||
Sbjct: 58714 ctcgccaccgaggccgaggg 58695



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 390      ctcgccaccgaggccgaggg 409
                ||||||||||||||||||||
Sbjct: 30636507 ctcgccaccgaggccgaggg 30636488



to top

>gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete
              sequence
          Length = 157970

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 390    ctcgccaccgaggccgaggg 409
              ||||||||||||||||||||
Sbjct: 125885 ctcgccaccgaggccgaggg 125904



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     ccgagcgcgccgagcggcgt 263
               ||||||||||||||||||||
Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382



to top

>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   aaatcatcttatagaccgag 248
             ||||||||||||||||||||
Sbjct: 55520 aaatcatcttatagaccgag 55539



to top

>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   aaatcatcttatagaccgag 248
             ||||||||||||||||||||
Sbjct: 42512 aaatcatcttatagaccgag 42531



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gaccgagcgcgccgagcggc 261
              ||||||||||||||||||||
Sbjct: 404087 gaccgagcgcgccgagcggc 404068



to top

>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence
          Length = 143534

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     actatatattacatggtaca 50
              ||||||||||||||||||||
Sbjct: 110106 actatatattacatggtaca 110125



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 354     cttctcggtgtcggggatgtagatgccg 381
               |||| |||||||||||||||||| ||||
Sbjct: 2052833 cttcgcggtgtcggggatgtagaggccg 2052860



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     ccgagcgcgccgagcggcgt 263
               ||||||||||||||||||||
Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 390      ctcgccaccgaggccgaggg 409
                ||||||||||||||||||||
Sbjct: 30727929 ctcgccaccgaggccgaggg 30727910



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 388     gtctcgccaccgaggccgag 407
               ||||||||||||||||||||
Sbjct: 8759993 gtctcgccaccgaggccgag 8759974



to top

>gb|AF440828.1| Streptomyces avermitilis Imp1 (imp1) gene, partial cds; Imp2 (imp2)
            gene, complete cds; and unknown genes
          Length = 7996

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 388  gtctcgccaccgaggccgag 407
            ||||||||||||||||||||
Sbjct: 7684 gtctcgccaccgaggccgag 7665



to top

>dbj|AK111876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046K17, full
           insert sequence
          Length = 1571

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 ctcgccaccgaggccgaggg 409
           ||||||||||||||||||||
Sbjct: 696 ctcgccaccgaggccgaggg 715



to top

>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein
          Length = 470

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 306 catggcgaggcgcgagtgcttgatctcggcca 337
           |||||||||||| | |||||||||||| ||||
Sbjct: 107 catggcgaggcgggcgtgcttgatctccgcca 76



to top

>dbj|AK099001.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013102B14, full
           insert sequence
          Length = 1570

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 ctcgccaccgaggccgaggg 409
           ||||||||||||||||||||
Sbjct: 710 ctcgccaccgaggccgaggg 729



to top

>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 342     gagccgctcaagcttctcgg 361
               ||||||||||||||||||||
Sbjct: 1360159 gagccgctcaagcttctcgg 1360140



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 388    gtctcgccaccgaggccgagggggtcga 415
              ||||||||||||| |||||| |||||||
Sbjct: 509954 gtctcgccaccgaagccgagcgggtcga 509981



to top

>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence
          Length = 160030

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    tatatattacatggtacata 52
             ||||||||||||||||||||
Sbjct: 14348 tatatattacatggtacata 14329


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,204,059
Number of Sequences: 3902068
Number of extensions: 4204059
Number of successful extensions: 61741
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60866
Number of HSP's gapped (non-prelim): 875
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top