ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet35h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC091463.9| Mus musculus chromosome 16, clone RP23-301D7, com... 42 0.92
2gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 42 0.92
3emb|AL137019.6| Human DNA sequence from clone RP11-143P10 on chr... 42 0.92
4gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, co... 40 3.6
5ref|XM_715464.1| Candida albicans SC5314 putative phospholipase/... 40 3.6
6gb|AC147788.1| Latimeria menadoensis clone VMRC4-19C10, complete... 40 3.6
7gb|AC141890.3| Mus musculus BAC clone RP23-410K18 from chromosom... 40 3.6
8gb|AC125807.9| Homo sapiens 12 BAC RP11-253E3 (Roswell Park Canc... 40 3.6
9gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, comp... 40 3.6
10emb|AL645966.30| Mouse DNA sequence from clone DN-144H19 on chro... 40 3.6
11gb|AC097063.2| Homo sapiens chromosome 1 clone RP11-430H12, comp... 40 3.6
12gb|AC119800.2| Homo sapiens chromosome 1 clone RP4-630A11, compl... 40 3.6
13gb|AC006975.2|AC006975 Homo sapiens PAC clone RP5-1026B21 from X... 40 3.6
14emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 40 3.6
15gb|AC131231.10| Mus musculus chromosome 19, clone RP24-395L19, c... 40 3.6
16emb|BX322561.1|HSE12310 Homo sapiens chromosome 21 from PAC RPCI... 40 3.6
17emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on ch... 40 3.6
18emb|AL645807.4| Mouse DNA sequence from clone CT7-337H6 on chrom... 40 3.6
19gb|AC170864.2| Mus musculus BAC clone RP24-576D1 from chromosome... 40 3.6

>gb|AC091463.9| Mus musculus chromosome 16, clone RP23-301D7, complete sequence
          Length = 232419

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 26    cttctacgagaaaacacaccgaagt 50
             |||||| ||||||||||||||||||
Sbjct: 58233 cttctatgagaaaacacaccgaagt 58209



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 249   ggtgggggtgggagggacggg 269
             |||||||||||||||||||||
Sbjct: 65504 ggtgggggtgggagggacggg 65524



to top

>emb|AL137019.6| Human DNA sequence from clone RP11-143P10 on chromosome 9q31.3-33.1,
             complete sequence
          Length = 181542

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 249   ggtgggggtgggagggacggggtgg 273
             ||||||||||||||||| |||||||
Sbjct: 76273 ggtgggggtgggagggagggggtgg 76297



to top

>gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, complete sequence
          Length = 222869

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   tgggggtgggagggacgggg 270
             ||||||||||||||||||||
Sbjct: 25895 tgggggtgggagggacgggg 25914



to top

>ref|XM_715464.1| Candida albicans SC5314 putative phospholipase/carboxylesterase
           (CaO19_4248), mRNA
          Length = 906

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 52  acaaaatcttgataaagcaacaca 75
           |||||||| |||||||||||||||
Sbjct: 654 acaaaatcctgataaagcaacaca 631



to top

>gb|AC147788.1| Latimeria menadoensis clone VMRC4-19C10, complete sequence
          Length = 168364

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 71    acacaccaaccacacccccacact 94
             ||||| ||||||||||||||||||
Sbjct: 83426 acacaacaaccacacccccacact 83403



to top

>gb|AC141890.3| Mus musculus BAC clone RP23-410K18 from chromosome 7, complete
            sequence
          Length = 169771

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 5    tattttgattcataaataca 24
            ||||||||||||||||||||
Sbjct: 7038 tattttgattcataaataca 7019



to top

>gb|AC125807.9| Homo sapiens 12 BAC RP11-253E3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131995

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 86    ccccacactcagcctgacacacac 109
             ||||||||||||||| ||||||||
Sbjct: 13539 ccccacactcagcctcacacacac 13516



to top

>gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, complete sequence
          Length = 213341

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      tattttgattcataaataca 24
              ||||||||||||||||||||
Sbjct: 180050 tattttgattcataaataca 180031



to top

>emb|AL645966.30| Mouse DNA sequence from clone DN-144H19 on chromosome 3 Contains the 3'
              end of the Il21 gene for interleukin 21, a novel pseudogene
              (D530049N12RIK), a novel gene (C030047M16RIK), the Il2 gene
              for interleukin 2, the Tenr gene for testis nuclear RNA
              binding protein, a NADH dehydrogenase subunit 5 (ND5)
              pseudogene and a putative S1 RNA binding domain protein
              (PS1D) (2810055E05RIK) pseudogene, complete sequence
          Length = 161393

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     cacaccaaccacacccccacactc 95
              |||||| |||||||||||||||||
Sbjct: 140420 cacacccaccacacccccacactc 140397



to top

>gb|AC097063.2| Homo sapiens chromosome 1 clone RP11-430H12, complete sequence
          Length = 183086

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   tgggggtgggagggacgggg 270
             ||||||||||||||||||||
Sbjct: 12482 tgggggtgggagggacgggg 12501



to top

>gb|AC119800.2| Homo sapiens chromosome 1 clone RP4-630A11, complete sequence
          Length = 161112

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 251    tgggggtgggagggacgggg 270
              ||||||||||||||||||||
Sbjct: 123468 tgggggtgggagggacgggg 123487



to top

>gb|AC006975.2|AC006975 Homo sapiens PAC clone RP5-1026B21 from X, complete sequence
          Length = 146410

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    caaccacacccccacactca 96
             ||||||||||||||||||||
Sbjct: 40462 caaccacacccccacactca 40481



to top

>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102
          Length = 340000

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                          
Query: 68     gcaacacaccaa-ccacacccccacact 94
              |||||||||||| |||||||||||||||
Sbjct: 199260 gcaacacaccaaaccacacccccacact 199233



to top

>gb|AC131231.10| Mus musculus chromosome 19, clone RP24-395L19, complete sequence
          Length = 181700

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 251    tgggggtgggagggacgggg 270
              ||||||||||||||||||||
Sbjct: 175068 tgggggtgggagggacgggg 175087



to top

>emb|BX322561.1|HSE12310 Homo sapiens chromosome 21 from PAC RPCI-1 RP1-310E12 map 21q22.3
             region D21S171-LA161, complete sequence
          Length = 131563

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 68    gcaacacaccaa-ccacacccccacact 94
             |||||||||||| |||||||||||||||
Sbjct: 59572 gcaacacaccaaaccacacccccacact 59545



to top

>emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on chromosome 3, complete
              sequence
          Length = 215241

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     cacaccaaccacacccccacactc 95
              |||||| |||||||||||||||||
Sbjct: 171074 cacacccaccacacccccacactc 171051



to top

>emb|AL645807.4| Mouse DNA sequence from clone CT7-337H6 on chromosome 3, complete
             sequence
          Length = 201500

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 72    cacaccaaccacacccccacactc 95
             |||||| |||||||||||||||||
Sbjct: 99543 cacacccaccacacccccacactc 99520



to top

>gb|AC170864.2| Mus musculus BAC clone RP24-576D1 from chromosome 7, complete sequence
          Length = 208952

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     aaagcaacacaccaaccaca 84
              ||||||||||||||||||||
Sbjct: 109202 aaagcaacacaccaaccaca 109183


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,220,657
Number of Sequences: 3902068
Number of extensions: 2220657
Number of successful extensions: 56985
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 56948
Number of HSP's gapped (non-prelim): 69
length of query: 279
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 257
effective length of database: 17,147,199,772
effective search space: 4406830341404
effective search space used: 4406830341404
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top