ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet35f07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL691431.20| Mouse DNA sequence from clone RP23-257P7 on chr... 42 0.11
2emb|AL513184.7| Human DNA sequence from clone RP11-386H19 on chr... 40 0.45
3emb|AL137016.11| Human DNA sequence from clone RP4-595A18 on chr... 40 0.45
4emb|AL512562.1|SPAPB1A10 S.pombe chromosome I BAC pB1A10 40 0.45
5dbj|BS000177.1| Pan troglodytes chromosome 22 clone:PTB-118H03, ... 40 0.45
6dbj|BS000176.1| Pan troglodytes chromosome 22 clone:RP43-006O21,... 40 0.45
7gb|AC118018.20| Mus musculus chromosome 17, clone RP23-458D20, c... 38 1.8
8gb|AC123694.11| Mus musculus chromosome 10, clone RP23-326O5, co... 38 1.8
9gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 38 1.8
10gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 38 1.8
11gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromo... 38 1.8
12gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 38 1.8
13gb|AF117829.3| Homo sapiens chromosome 8 multiple clones map q21... 38 1.8
14gb|CP000001.1| Bacillus cereus E33L, complete genome 38 1.8
15emb|AL355512.22| Human DNA sequence from clone RP11-525A16 on ch... 38 1.8
16emb|AL356495.15| Human DNA sequence from clone RP11-206L1 on chr... 38 1.8
17emb|BX511062.12| Zebrafish DNA sequence from clone CH211-266M11 ... 38 1.8
18gb|AC006304.4| Arabidopsis thaliana chromosome 2 clone T1O16 map... 38 1.8
19dbj|AK165097.1| Mus musculus 2 days pregnant adult female ovary ... 38 1.8
20gb|AC007175.1|AC007175 Drosophila melanogaster, chromosome 2R, r... 38 1.8
21dbj|AK034897.1| Mus musculus 12 days embryo embryonic body betwe... 38 1.8
22gb|AC158596.7| Mus musculus 10 BAC RP23-188F7 (Roswell Park Canc... 38 1.8
23gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Can... 38 1.8
24gb|AC007880.2| Homo sapiens BAC clone RP11-323F11 from 2, comple... 38 1.8
25gb|AC004459.1|AC004459 Homo sapiens BAC clone CTA-273G1 from 8q2... 38 1.8
26emb|BX901929.9| Zebrafish DNA sequence from clone DKEY-11K24 in ... 38 1.8
27gb|AE003453.3| Drosophila melanogaster chromosome 2R, section 61... 38 1.8
28dbj|AP001001.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 1.8
29dbj|AP000813.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 1.8
30gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 38 1.8
31gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 38 1.8
32gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 38 1.8
33gb|AC153955.3| Mus musculus 10 BAC RP24-167A12 (Roswell Park Can... 38 1.8
34gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 36 7.1
35gb|AC166108.4| Mus musculus BAC clone RP23-192E10 from chromosom... 36 7.1
36gb|BC046502.1| Mus musculus myosin IF, mRNA (cDNA clone MGC:2530... 36 7.1
37gb|AC105166.16| Mus musculus chromosome 5, clone RP24-311D15, co... 36 7.1
38gb|AC024878.1| Caenorhabditis elegans cosmid Y97E10AL, complete ... 36 7.1
39gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, co... 36 7.1
40gb|AC132122.2| Mus musculus chromosome 7 clone RP24-78F23, compl... 36 7.1
41emb|AJ566974.1|GHI566974 Gossypium hirsutum microsatellite DNA m... 36 7.1
42gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, com... 36 7.1
43ref|XM_449804.1| Candida glabrata CBS138 hypothetical protein (C... 36 7.1
44gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome... 36 7.1
45gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosom... 36 7.1
46ref|XM_814178.1| Trypanosoma cruzi strain CL Brener hypothetical... 36 7.1
47ref|XM_809500.1| Trypanosoma cruzi strain CL Brener hypothetical... 36 7.1
48gb|AC101813.5| Mus musculus chromosome 1, clone RP24-315D8, comp... 36 7.1
49emb|AL109936.11|HSJ1057J7 Human DNA sequence from clone RP5-1057... 36 7.1
50emb|AL096792.5|HS1067P23 Human DNA sequence from clone RP5-1067P... 36 7.1
51emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp... 36 7.1
52gb|AC161766.2| Mus musculus BAC clone RP23-39O12 from chromosome... 36 7.1
53gb|AC163355.2| Mus musculus BAC clone RP23-11P15 from chromosome... 36 7.1
54emb|AL592464.24| Human DNA sequence from clone RP11-740P5 on chr... 36 7.1
55gb|AC023644.6| Homo sapiens chromosome 8, clone RP11-257P3, comp... 36 7.1
56emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in... 36 7.1
57gb|DQ073430.1| Thermotoga sp. RQ2 RQ2_R5 region, complete sequence 36 7.1
58gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosom... 36 7.1
59gb|AC159903.3| Pan troglodytes BAC clone CH251-459A3 from chromo... 36 7.1
60gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold 36 7.1
61dbj|AK153908.1| Mus musculus 2 days neonate thymus thymic cells ... 36 7.1
62gb|AC068714.9| Homo sapiens chromosome 15 clone RP11-315O8 map 1... 36 7.1
63gb|AC090512.3|AC090512 Homo sapiens chromosome 15 clone RP11-134... 36 7.1
64dbj|AK021181.1| Mus musculus ES cells cDNA, RIKEN full-length en... 36 7.1
65dbj|AK036840.1| Mus musculus adult female vagina cDNA, RIKEN ful... 36 7.1
66emb|BX537268.5| Zebrafish DNA sequence from clone DKEY-48A12 in ... 36 7.1
67gb|AC020709.4|AC020709 Homo sapiens clone RP11-425F18, complete ... 36 7.1
68gb|AC158300.4| Mus musculus chromosome 7, clone RP24-226N16, com... 36 7.1
69gb|AC080091.5| Homo sapiens BAC clone RP11-802G5 from 2, complet... 36 7.1
70dbj|AK131188.1| Mus musculus mRNA for mFLJ00395 protein 36 7.1
71gb|AC026201.3|AC026201 Homo sapiens chromosome 11 clone RP11-546... 36 7.1
72gb|AC021998.4|AC021998 Homo sapiens chromosome 11 clone RP11-116... 36 7.1
73gb|AC006030.2| Homo sapiens BAC clone RP11-1P9 from 2, complete ... 36 7.1
74dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 36 7.1
75emb|AL844528.13| Mouse DNA sequence from clone RP23-139H14 on ch... 36 7.1
76emb|BX284612.22| Mouse DNA sequence from clone RP23-332H17 on ch... 36 7.1
77dbj|BS000102.1| Pan troglodytes chromosome 22 clone:RP43-107D21,... 36 7.1
78gb|AC153890.8| Mus musculus BAC RP23-403C13 (Roswell Park Cance... 36 7.1
79emb|Z68105.1|CEF13E6 Caenorhabditis elegans Cosmid F13E6, comple... 36 7.1
80dbj|AP001693.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 36 7.1
81gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, com... 36 7.1
82gb|AC154608.3| Mus musculus BAC clone RP23-334N8 from chromosome... 36 7.1
83dbj|AP006215.1| Homo sapiens genomic DNA, chromosome 11, clone:R... 36 7.1
84gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 36 7.1
85gb|CP000223.1| Drosophila melanogaster genomic scaffold 21100002... 36 7.1
86gb|AE017226.1| Treponema denticola ATCC 35405, complete genome 36 7.1
87ref|NM_053214.1| Mus musculus myosin IF (Myo1f), mRNA 36 7.1
88emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chro... 36 7.1
89dbj|AP006103.1| Lotus japonicus genomic DNA, chromosome 1, clone... 36 7.1
90gb|AC167980.2| Mus musculus BAC clone RP23-28M3 from chromosome ... 36 7.1
91dbj|AP001340.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 36 7.1
92dbj|AP005210.2| Homo sapiens genomic DNA, chromosome 18, clone:R... 36 7.1 
>emb|AL691431.20| Mouse DNA sequence from clone RP23-257P7 on chromosome 4 Contains the 5'
              end of a novel gene (2810031P15Rik), a ribosomal protein
              L10 (Rpl10) pseudogene, a ribosomal protein S6 (Rps6)
              pseudogene and two CpG islands, complete sequence
          Length = 199847

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      attggacacaggtgaaaatgg 21
              |||||||||||||||||||||
Sbjct: 173628 attggacacaggtgaaaatgg 173648
to top
>emb|AL513184.7| Human DNA sequence from clone RP11-386H19 on chromosome 6 Contains part
             of the UTRN gene for utrophin (homologous to dystrophin),
             complete sequence
          Length = 81461

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    tgaaaatggaagcaaaattt 32
             ||||||||||||||||||||
Sbjct: 75416 tgaaaatggaagcaaaattt 75397
to top
>emb|AL137016.11| Human DNA sequence from clone RP4-595A18 on chromosome Xq26.3-27.2,
             complete sequence
          Length = 117847

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    tgaaaatggaagcaaaattt 32
             ||||||||||||||||||||
Sbjct: 81993 tgaaaatggaagcaaaattt 82012
to top
>emb|AL512562.1|SPAPB1A10 S.pombe chromosome I BAC pB1A10
          Length = 36484

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    gaaaatggaagcaaaatttg 33
             ||||||||||||||||||||
Sbjct: 16387 gaaaatggaagcaaaatttg 16368
to top
>dbj|BS000177.1| Pan troglodytes chromosome 22 clone:PTB-118H03, map 22, complete
             sequences
          Length = 267172

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atggaagcaaaatttgcttc 37
             ||||||||||||||||||||
Sbjct: 48796 atggaagcaaaatttgcttc 48777
to top
>dbj|BS000176.1| Pan troglodytes chromosome 22 clone:RP43-006O21, map 22, complete
              sequences
          Length = 146754

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atggaagcaaaatttgcttc 37
              ||||||||||||||||||||
Sbjct: 138957 atggaagcaaaatttgcttc 138938
to top
>gb|AC118018.20| Mus musculus chromosome 17, clone RP23-458D20, complete sequence
          Length = 182043

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 22     aagcaaaatttgcttccaagagc 44
              ||||| |||||||||||||||||
Sbjct: 128002 aagcagaatttgcttccaagagc 128024
to top
>gb|AC123694.11| Mus musculus chromosome 10, clone RP23-326O5, complete sequence
          Length = 214111

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    aaaatggaagcaaaatttg 33
             |||||||||||||||||||
Sbjct: 99866 aaaatggaagcaaaatttg 99848
to top
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 2029121 aaaatggaagcaaaatttg 2029103
to top
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 1979212 aaaatggaagcaaaatttg 1979194
to top
>gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromosome 3, complete
              sequence
          Length = 191366

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 9      caggtgaaaatggaagcaaaatt 31
              |||||||||||||||| ||||||
Sbjct: 122571 caggtgaaaatggaagtaaaatt 122549
to top
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 1979158 aaaatggaagcaaaatttg 1979140
to top
>gb|AF117829.3| Homo sapiens chromosome 8 multiple clones map q21.3, complete sequence
          Length = 320187

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     gcaaaatttgcttccaaga 42
              |||||||||||||||||||
Sbjct: 103736 gcaaaatttgcttccaaga 103754
to top
>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 2040451 aaaatggaagcaaaatttg 2040433
to top
>emb|AL355512.22| Human DNA sequence from clone RP11-525A16 on chromosome 10 Contains the
             DUSP5 gene for dual specificity phosphatase 5 (HVH3), two
             novel genes, a high-mobility group box 3 (HMGB3)
             pseudogene and a CpG island, complete sequence
          Length = 199785

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aggtgaaaatggaagcaaa 28
             |||||||||||||||||||
Sbjct: 89763 aggtgaaaatggaagcaaa 89781
to top
>emb|AL356495.15| Human DNA sequence from clone RP11-206L1 on chromosome 13 Contains the
             5' end of the TRPC4 gene for transient receptor potential
             cation channel, subfamily C, member 4, a heat shock 60kD
             protein 1 (chaperonin) (HSPD1) pseudogene and a CpG
             island, complete sequence
          Length = 173774

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    tgaaaatggaagcaaaatt 31
             |||||||||||||||||||
Sbjct: 69045 tgaaaatggaagcaaaatt 69063
to top
>emb|BX511062.12| Zebrafish DNA sequence from clone CH211-266M11 in linkage group 17,
              complete sequence
          Length = 131970

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     aagcaaaatttgcttccaa 40
              |||||||||||||||||||
Sbjct: 129772 aagcaaaatttgcttccaa 129790
to top
>gb|AC006304.4| Arabidopsis thaliana chromosome 2 clone T1O16 map mi398, complete
             sequence
          Length = 89281

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    aaatggaagcaaaatttgc 34
             |||||||||||||||||||
Sbjct: 27161 aaatggaagcaaaatttgc 27179
to top
>dbj|AK165097.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330007M18
           product:hypothetical protein, full insert sequence
          Length = 1606

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 15  aaaatggaagcaaaatttg 33
           |||||||||||||||||||
Sbjct: 935 aaaatggaagcaaaatttg 917
to top
>gb|AC007175.1|AC007175 Drosophila melanogaster, chromosome 2R, region 57D3-57E2, BAC clones
              DS01261 and BACR48K03, complete sequence
          Length = 188633

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     aaaatggaagcaaaatttg 33
              |||||||||||||||||||
Sbjct: 116847 aaaatggaagcaaaatttg 116829
to top
>dbj|AK034897.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430058N20 product:inferred: RIKEN cDNA 4733401N12
            gene, full insert sequence
          Length = 2871

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   aaaatggaagcaaaatttg 33
            |||||||||||||||||||
Sbjct: 2803 aaaatggaagcaaaatttg 2785
to top
>gb|AC158596.7| Mus musculus 10 BAC RP23-188F7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 207673

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    gtgaaaatggaagcaaaat 30
             |||||||||||||||||||
Sbjct: 51024 gtgaaaatggaagcaaaat 51006
to top
>gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161141

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 9     caggtgaaaatggaagcaaaatt 31
             |||||||||||||||| ||||||
Sbjct: 39999 caggtgaaaatggaagtaaaatt 40021
to top
>gb|AC007880.2| Homo sapiens BAC clone RP11-323F11 from 2, complete sequence
          Length = 122223

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    gcaaaatttgcttccaaga 42
             |||||||||||||||||||
Sbjct: 49726 gcaaaatttgcttccaaga 49708
to top
>gb|AC004459.1|AC004459 Homo sapiens BAC clone CTA-273G1 from 8q21, complete sequence
          Length = 41798

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 24   gcaaaatttgcttccaaga 42
            |||||||||||||||||||
Sbjct: 5722 gcaaaatttgcttccaaga 5740
to top
>emb|BX901929.9| Zebrafish DNA sequence from clone DKEY-11K24 in linkage group 4,
             complete sequence
          Length = 70937

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 8     acaggtgaaaatggaagcaaaat 30
             |||||||||||||||||| ||||
Sbjct: 19425 acaggtgaaaatggaagctaaat 19403
to top
>gb|AE003453.3| Drosophila melanogaster chromosome 2R, section 61 of 73 of the complete
              sequence
          Length = 305143

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     aaaatggaagcaaaatttg 33
              |||||||||||||||||||
Sbjct: 285244 aaaatggaagcaaaatttg 285226
to top
>dbj|AP001001.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-677I18, complete
             sequence
          Length = 182429

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    aaaatggaagcaaaatttg 33
             |||||||||||||||||||
Sbjct: 18477 aaaatggaagcaaaatttg 18459
to top
>dbj|AP000813.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-822P4, complete
              sequence
          Length = 210816

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     aaaatggaagcaaaatttg 33
              |||||||||||||||||||
Sbjct: 116223 aaaatggaagcaaaatttg 116205
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 2059577 aaaatggaagcaaaatttg 2059559
to top
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 1979088 aaaatggaagcaaaatttg 1979070
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 15      aaaatggaagcaaaatttg 33
               |||||||||||||||||||
Sbjct: 2108119 aaaatggaagcaaaatttg 2108101
to top
>gb|AC153955.3| Mus musculus 10 BAC RP24-167A12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154271

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    gtgaaaatggaagcaaaat 30
             |||||||||||||||||||
Sbjct: 50676 gtgaaaatggaagcaaaat 50694
to top
>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence
          Length = 199262

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 4      ggacacaggtgaaaatggaagc 25
              ||||||||| ||||||||||||
Sbjct: 180747 ggacacaggggaaaatggaagc 180726
to top
>gb|AC166108.4| Mus musculus BAC clone RP23-192E10 from chromosome 1, complete sequence
          Length = 188836

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    aaaatggaagcaaaattt 32
             ||||||||||||||||||
Sbjct: 16069 aaaatggaagcaaaattt 16052
to top
>gb|BC046502.1| Mus musculus myosin IF, mRNA (cDNA clone MGC:25309 IMAGE:4167558),
            complete cds
          Length = 3833

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 3653 attggacacaggagaaaatgga 3632
to top
>gb|AC105166.16| Mus musculus chromosome 5, clone RP24-311D15, complete sequence
          Length = 145019

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      caggtgaaaatggaagca 26
              ||||||||||||||||||
Sbjct: 112677 caggtgaaaatggaagca 112660
to top
>gb|AC024878.1| Caenorhabditis elegans cosmid Y97E10AL, complete sequence
          Length = 6237

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   gtgaaaatggaagcaaaa 29
            ||||||||||||||||||
Sbjct: 1437 gtgaaaatggaagcaaaa 1420
to top
>gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, complete sequence
          Length = 245165

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 29     atttgcttccaagagctt 46
              ||||||||||||||||||
Sbjct: 163235 atttgcttccaagagctt 163252
to top
>gb|AC132122.2| Mus musculus chromosome 7 clone RP24-78F23, complete sequence
          Length = 203549

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    tttgcttccaagagcttc 47
             ||||||||||||||||||
Sbjct: 60504 tttgcttccaagagcttc 60521
to top
>emb|AJ566974.1|GHI566974 Gossypium hirsutum microsatellite DNA mGhCIR025, clone CIR025
          Length = 250

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 16 aaatggaagcaaaatttg 33
          ||||||||||||||||||
Sbjct: 69 aaatggaagcaaaatttg 86
to top
>gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, complete sequence
          Length = 203086

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    aaaatttgcttccaagag 43
             ||||||||||||||||||
Sbjct: 10427 aaaatttgcttccaagag 10444
to top
>ref|XM_449804.1| Candida glabrata CBS138 hypothetical protein (CAGL0M10527g) partial
            mRNA
          Length = 7494

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 26   aaaatttgcttccaagag 43
            ||||||||||||||||||
Sbjct: 3052 aaaatttgcttccaagag 3035
to top
>gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome 12, complete sequence
          Length = 134858

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 4     ggacacaggtgaaaatggaagc 25
             ||||||||| ||||||||||||
Sbjct: 37235 ggacacaggggaaaatggaagc 37214
to top
>gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosome 7, complete sequence
          Length = 161973

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tttgcttccaagagcttc 47
              ||||||||||||||||||
Sbjct: 138612 tttgcttccaagagcttc 138629
to top
>ref|XM_814178.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506357.130) partial mRNA
          Length = 7830

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 33   gcttccaagagcttcaat 50
            ||||||||||||||||||
Sbjct: 6489 gcttccaagagcttcaat 6472
to top
>ref|XM_809500.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508891.130) partial mRNA
          Length = 1783

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 33  gcttccaagagcttcaat 50
           ||||||||||||||||||
Sbjct: 442 gcttccaagagcttcaat 425
to top
>gb|AC101813.5| Mus musculus chromosome 1, clone RP24-315D8, complete sequence
          Length = 159286

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    aaaatggaagcaaaattt 32
             ||||||||||||||||||
Sbjct: 24786 aaaatggaagcaaaattt 24769
to top
>emb|AL109936.11|HSJ1057J7 Human DNA sequence from clone RP5-1057J7 on chromosome 1 Contains a
             ribosomal protein L29 (RPL29) pseudogene, the HNRPR gene
             for heterogeneous nuclear ribonucleoprotein R, the ZNF436
             gene for zinc finger protein 436 (KIAA1710, FLJ35045), a
             novel gene (LOC148898), the 3' end of the TCEA3 gene for
             transcription elongation factor A (SII) 3 and a CpG
             island, complete sequence
          Length = 150285

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 16    aaatggaagcaaaatttgcttc 37
             |||||||||||||||| |||||
Sbjct: 31486 aaatggaagcaaaattggcttc 31507
to top
>emb|AL096792.5|HS1067P23 Human DNA sequence from clone RP5-1067P23 on chromosome 20 Contains
             STSs and GSSs, complete sequence
          Length = 101342

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    gtgaaaatggaagcaaaa 29
             ||||||||||||||||||
Sbjct: 87891 gtgaaaatggaagcaaaa 87874
to top
>emb|CR380959.1| Candida glabrata strain CBS138 chromosome M complete sequence
          Length = 1400893

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 26      aaaatttgcttccaagag 43
               ||||||||||||||||||
Sbjct: 1056863 aaaatttgcttccaagag 1056880
to top
>gb|AC161766.2| Mus musculus BAC clone RP23-39O12 from chromosome 12, complete sequence
          Length = 224641

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 3      tggacacaggtgaaaatggaag 24
              ||||||||||||||||| ||||
Sbjct: 122478 tggacacaggtgaaaattgaag 122499
to top
>gb|AC163355.2| Mus musculus BAC clone RP23-11P15 from chromosome 16, complete sequence
          Length = 225547

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     aatttgcttccaagagct 45
              ||||||||||||||||||
Sbjct: 213191 aatttgcttccaagagct 213208
to top
>emb|AL592464.24| Human DNA sequence from clone RP11-740P5 on chromosome 1, complete
              sequence
          Length = 120028

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 27     aaatttgcttccaagagc 44
              ||||||||||||||||||
Sbjct: 107530 aaatttgcttccaagagc 107547
to top
>gb|AC023644.6| Homo sapiens chromosome 8, clone RP11-257P3, complete sequence
          Length = 60057

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 12    gtgaaaatggaagcaaaatttg 33
             |||||||||| |||||||||||
Sbjct: 34426 gtgaaaatgggagcaaaatttg 34405
to top
>emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in linkage group 8,
              complete sequence
          Length = 171750

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     aaaatggaagcaaaattt 32
              ||||||||||||||||||
Sbjct: 123293 aaaatggaagcaaaattt 123276
to top
>gb|DQ073430.1| Thermotoga sp. RQ2 RQ2_R5 region, complete sequence
          Length = 9107

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 22   aagcaaaatttgcttcca 39
            ||||||||||||||||||
Sbjct: 7851 aagcaaaatttgcttcca 7868
to top
>gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosome 12, complete sequence
          Length = 216485

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 4      ggacacaggtgaaaatggaagc 25
              ||||||||| ||||||||||||
Sbjct: 114247 ggacacaggggaaaatggaagc 114268
to top
>gb|AC159903.3| Pan troglodytes BAC clone CH251-459A3 from chromosome unknown, complete
             sequence
          Length = 216963

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     ggacacaggtgaaaatgg 21
             ||||||||||||||||||
Sbjct: 42424 ggacacaggtgaaaatgg 42441
to top
>gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold
          Length = 444202

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 16     aaatggaagcaaaatttg 33
              ||||||||||||||||||
Sbjct: 362135 aaatggaagcaaaatttg 362152
to top
>dbj|AK153908.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430004L16
            product:myosin IF, full insert sequence
          Length = 3801

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 3639 attggacacaggagaaaatgga 3618
to top
>gb|AC068714.9| Homo sapiens chromosome 15 clone RP11-315O8 map 15q15, complete sequence
          Length = 200690

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 10     aggtgaaaatggaagcaaaatt 31
              ||||||||||||||| ||||||
Sbjct: 199077 aggtgaaaatggaagtaaaatt 199056
to top
>gb|AC090512.3|AC090512 Homo sapiens chromosome 15 clone RP11-134K12 map 15q21.1, complete
            sequence
          Length = 161737

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 10   aggtgaaaatggaagcaaaatt 31
            ||||||||||||||| ||||||
Sbjct: 5771 aggtgaaaatggaagtaaaatt 5750
to top
>dbj|AK021181.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
            clone:C330006B10 product:myosin If, full insert sequence
          Length = 1313

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 1151 attggacacaggagaaaatgga 1130
to top
>dbj|AK036840.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched
            library, clone:9930017F19 product:MYOSIN IF (MYOSIN-IE)
            (FRAGMENT) homolog [Homo sapiens], full insert sequence
          Length = 3667

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 3499 attggacacaggagaaaatgga 3478
to top
>emb|BX537268.5| Zebrafish DNA sequence from clone DKEY-48A12 in linkage group 1,
             complete sequence
          Length = 138906

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     cacaggtgaaaatggaag 24
             ||||||||||||||||||
Sbjct: 85367 cacaggtgaaaatggaag 85350
to top
>gb|AC020709.4|AC020709 Homo sapiens clone RP11-425F18, complete sequence
          Length = 184104

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 27    aaatttgcttccaagagc 44
             ||||||||||||||||||
Sbjct: 97731 aaatttgcttccaagagc 97748
to top
>gb|AC158300.4| Mus musculus chromosome 7, clone RP24-226N16, complete sequence
          Length = 161504

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     aatttgcttccaagagct 45
              ||||||||||||||||||
Sbjct: 138400 aatttgcttccaagagct 138417
to top
>gb|AC080091.5| Homo sapiens BAC clone RP11-802G5 from 2, complete sequence
          Length = 158813

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      ggacacaggtgaaaatgg 21
              ||||||||||||||||||
Sbjct: 129624 ggacacaggtgaaaatgg 129607
to top
>dbj|AK131188.1| Mus musculus mRNA for mFLJ00395 protein
          Length = 2520

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 2358 attggacacaggagaaaatgga 2337
to top
>gb|AC026201.3|AC026201 Homo sapiens chromosome 11 clone RP11-546N8 map 11q, complete sequence
          Length = 202218

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 22     aagcaaaatttgcttccaagag 43
              ||||| ||||||||||||||||
Sbjct: 172576 aagcagaatttgcttccaagag 172555
to top
>gb|AC021998.4|AC021998 Homo sapiens chromosome 11 clone RP11-116N3 map 11, complete sequence
          Length = 142446

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 22    aagcaaaatttgcttccaagag 43
             ||||| ||||||||||||||||
Sbjct: 62176 aagcagaatttgcttccaagag 62197
to top
>gb|AC006030.2| Homo sapiens BAC clone RP11-1P9 from 2, complete sequence
          Length = 89352

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    aaaatggaagcaaaattt 32
             ||||||||||||||||||
Sbjct: 42192 aaaatggaagcaaaattt 42209
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 11      ggtgaaaatggaagcaaa 28
               ||||||||||||||||||
Sbjct: 5153429 ggtgaaaatggaagcaaa 5153412
to top
>emb|AL844528.13| Mouse DNA sequence from clone RP23-139H14 on chromosome 2, complete
              sequence
          Length = 132715

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      ggacacaggtgaaaatgg 21
              ||||||||||||||||||
Sbjct: 111043 ggacacaggtgaaaatgg 111060
to top
>emb|BX284612.22| Mouse DNA sequence from clone RP23-332H17 on chromosome 2, complete
             sequence
          Length = 132718

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    aaaatggaagcaaaattt 32
             ||||||||||||||||||
Sbjct: 52743 aaaatggaagcaaaattt 52760
to top
>dbj|BS000102.1| Pan troglodytes chromosome 22 clone:RP43-107D21, map 22, complete
             sequences
          Length = 65478

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    aaaatggaagcaaaatttgctt 36
             ||||||||||| ||||||||||
Sbjct: 37213 aaaatggaagccaaatttgctt 37234
to top
>gb|AC153890.8| Mus musculus  BAC RP23-403C13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 202932

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    aaaatttgcttccaagag 43
             ||||||||||||||||||
Sbjct: 12216 aaaatttgcttccaagag 12199
to top
>emb|Z68105.1|CEF13E6 Caenorhabditis elegans Cosmid F13E6, complete sequence
          Length = 39320

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tgaaaatggaagcaaaat 30
             ||||||||||||||||||
Sbjct: 35234 tgaaaatggaagcaaaat 35251
to top
>dbj|AP001693.1| Homo sapiens genomic DNA, chromosome 21q, section 37/105
          Length = 340000

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    aaaatggaagcaaaatttgctt 36
             ||||||||||| ||||||||||
Sbjct: 72615 aaaatggaagccaaatttgctt 72636
to top
>gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, complete sequence
          Length = 196053

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 31    ttgcttccaagagcttca 48
             ||||||||||||||||||
Sbjct: 95921 ttgcttccaagagcttca 95938
to top
>gb|AC154608.3| Mus musculus BAC clone RP23-334N8 from chromosome 16, complete
            sequence
          Length = 212928

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 28   aatttgcttccaagagct 45
            ||||||||||||||||||
Sbjct: 7473 aatttgcttccaagagct 7490
to top
>dbj|AP006215.1| Homo sapiens genomic DNA, chromosome 11, clone:RP11-729P6, complete
              sequence
          Length = 189310

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 22     aagcaaaatttgcttccaagag 43
              ||||| ||||||||||||||||
Sbjct: 148197 aagcagaatttgcttccaagag 148218
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130,
              chromosome I, complete sequence
          Length = 4277185

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 19     tggaagcaaaatttgcttccaa 40
              |||||||||||| |||||||||
Sbjct: 985319 tggaagcaaaatgtgcttccaa 985298
to top
>gb|CP000223.1| Drosophila melanogaster genomic scaffold 211000022280790
          Length = 626829

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 16     aaatggaagcaaaatttg 33
              ||||||||||||||||||
Sbjct: 192836 aaatggaagcaaaatttg 192853
to top
>gb|AE017226.1| Treponema denticola ATCC 35405, complete genome
          Length = 2843201

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 21     gaagcaaaatttgcttcc 38
              ||||||||||||||||||
Sbjct: 307699 gaagcaaaatttgcttcc 307682
to top
>ref|NM_053214.1| Mus musculus myosin IF (Myo1f), mRNA
          Length = 3833

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    attggacacaggtgaaaatgga 22
            |||||||||||| |||||||||
Sbjct: 3653 attggacacaggagaaaatgga 3632
to top
>emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chromosome 17, complete
             sequence
          Length = 171164

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     attggacacaggtgaaaatgga 22
             |||||||||||| |||||||||
Sbjct: 79347 attggacacaggagaaaatgga 79326
to top
>dbj|AP006103.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT11J24, TM0185,
             complete sequence
          Length = 121047

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tgaaaatggaagcaaaat 30
             ||||||||||||||||||
Sbjct: 78035 tgaaaatggaagcaaaat 78052
to top
>gb|AC167980.2| Mus musculus BAC clone RP23-28M3 from chromosome 9, complete sequence
          Length = 221376

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 29     atttgcttccaagagctt 46
              ||||||||||||||||||
Sbjct: 168444 atttgcttccaagagctt 168427
to top
>dbj|AP001340.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B2289H10,
            LL56-APP region, complete sequence
          Length = 58771

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 15   aaaatggaagcaaaatttgctt 36
            ||||||||||| ||||||||||
Sbjct: 9424 aaaatggaagccaaatttgctt 9445
to top
>dbj|AP005210.2| Homo sapiens genomic DNA, chromosome 18, clone:RP11-146G7, complete
             sequence
          Length = 180737

 Score = 36.2 bits (18), Expect = 7.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    gaaaatggaagcaaaatt 31
             ||||||||||||||||||
Sbjct: 49328 gaaaatggaagcaaaatt 49345


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 657,111
Number of Sequences: 3902068
Number of extensions: 657111
Number of successful extensions: 175129
Number of sequences better than 10.0: 92
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 174337
Number of HSP's gapped (non-prelim): 792
length of query: 52
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 32
effective length of database: 17,155,003,908
effective search space: 548960125056
effective search space used: 548960125056
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top