ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet34h11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase... 40 0.64
2gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Can... 40 0.64
3gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Can... 40 0.64
4emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chr... 38 2.5
5emb|BX321905.19| Zebrafish DNA sequence from clone DKEYP-13F6 in... 38 2.5
6gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, comple... 38 2.5
7emb|AL772300.10| Zebrafish DNA sequence from clone CH211-165G14,... 38 2.5
8gb|AY020640.1| Oryza sativa microsatellite MRG2965 containing (T... 36 9.9
9gb|AC183276.3| Pan troglodytes BAC clone CH251-50A9 from chromos... 36 9.9
10gb|AC113110.17| Mus musculus chromosome 16, clone RP23-328A9, co... 36 9.9
11emb|Z83826.13|HS473B4 Human DNA sequence from clone RP3-473B4 on... 36 9.9
12gb|AY319412.1| Crassostrea virginica multixenobiotic resistance ... 36 9.9
13ref|XM_789528.1| PREDICTED: Strongylocentrotus purpuratus simila... 36 9.9
14emb|AL662858.15| Mouse DNA sequence from clone RP23-166O21 on ch... 36 9.9
15ref|NM_204262.1| Gallus gallus period homolog 2 (Drosophila) (PE... 36 9.9
16gb|AF246956.1| Gallus gallus PERIOD2 (PER2) mRNA, complete cds 36 9.9
17gb|AC104461.2| Homo sapiens chromosome 1 clone RP11-469A15, comp... 36 9.9
18gb|AC097065.2| Homo sapiens chromosome 1 clone RP11-532L16, comp... 36 9.9
19gb|AC018375.8| Homo sapiens, clone RP11-3P24, complete sequence 36 9.9
20gb|AC090893.5| Homo sapiens chromosome 11, clone RP11-390G21, co... 36 9.9
21emb|BX842688.12| Zebrafish DNA sequence from clone DKEY-202E17 i... 36 9.9
22gb|AC009884.8| Homo sapiens chromosome 8, clone RP11-420B22, com... 36 9.9
23dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 36 9.9
24gb|AC018479.2|AC018479 Drosophila melanogaster, chromosome 3R, r... 36 9.9
25gb|AC153896.10| Mus musculus 10 BAC RP23-114D16 (Roswell Park Ca... 36 9.9
26dbj|AP003905.3| Oryza sativa (japonica cultivar-group) genomic D... 36 9.9
27gb|AC008521.5|AC008521 Homo sapiens chromosome 19 clone CTC-461H... 36 9.9
28dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 36 9.9
29gb|AC154499.2| Mus musculus BAC clone RP23-205I1 from 14, comple... 36 9.9
30gb|AC153976.3| Mus musculus 10 BAC RP24-309I5 (Roswell Park Canc... 36 9.9
31emb|Z75103.1|SCYOR195W S.cerevisiae chromosome XV reading frame ... 36 9.9
32gb|AE003697.4| Drosophila melanogaster chromosome 3R, section 35... 36 9.9
33dbj|AB029890.1| Coturnix coturnix japonica qPer2 mRNA for circad... 36 9.9

>ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase (DDB0231482),
           partial mRNA
          Length = 1770

 Score = 40.1 bits (20), Expect = 0.64
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 41  acaaatcttacaagatttca 60
           ||||||||||||||||||||
Sbjct: 339 acaaatcttacaagatttca 358



to top

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 40.1 bits (20), Expect = 0.64
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 18    caccttccatagccactggatatacaaa 45
             ||||||||||||||||||  ||||||||
Sbjct: 41677 caccttccatagccactgtgtatacaaa 41650



to top

>gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162273

 Score = 40.1 bits (20), Expect = 0.64
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 18     caccttccatagccactggatatacaaa 45
              ||||||||||||||||||  ||||||||
Sbjct: 153678 caccttccatagccactgtgtatacaaa 153651



to top

>emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chromosome 10, complete
              sequence
          Length = 166826

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     ttccatagccactggatat 40
              |||||||||||||||||||
Sbjct: 131264 ttccatagccactggatat 131246



to top

>emb|BX321905.19| Zebrafish DNA sequence from clone DKEYP-13F6 in linkage group 9, complete
              sequence
          Length = 164006

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      aacacaacatacaattaca 19
              |||||||||||||||||||
Sbjct: 151062 aacacaacatacaattaca 151044



to top

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 23    tccatagccactggatatacaaa 45
             ||||||||||||| |||||||||
Sbjct: 95161 tccatagccactgcatatacaaa 95183



to top

>emb|AL772300.10| Zebrafish DNA sequence from clone CH211-165G14, complete sequence
          Length = 155951

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     aacacaacatacaattaca 19
             |||||||||||||||||||
Sbjct: 96792 aacacaacatacaattaca 96810



to top

>gb|AY020640.1| Oryza sativa microsatellite MRG2965 containing (TA)X12, closest to
           marker C166, genomic sequence
          Length = 224

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   aacacaacatacaattacacct 22
           |||||||||||||||| |||||
Sbjct: 169 aacacaacatacaattccacct 148



to top

>gb|AC183276.3| Pan troglodytes BAC clone CH251-50A9 from chromosome 19, complete
             sequence
          Length = 180204

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 31    cactggatatacaaatct 48
             ||||||||||||||||||
Sbjct: 13255 cactggatatacaaatct 13238



to top

>gb|AC113110.17| Mus musculus chromosome 16, clone RP23-328A9, complete sequence
          Length = 240173

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 37     atatacaaatcttacaagattt 58
              ||||| ||||||||||||||||
Sbjct: 111276 atataaaaatcttacaagattt 111297



to top

>emb|Z83826.13|HS473B4 Human DNA sequence from clone RP3-473B4 on chromosome X Contains the 3'
             end of the LOC159091 gene, two novel genes, a
             high-mobility group protein pseudogene and three CpG
             islands, complete sequence
          Length = 177180

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 46    tcttacaagatttcaaac 63
             ||||||||||||||||||
Sbjct: 33637 tcttacaagatttcaaac 33620



to top

>gb|AY319412.1| Crassostrea virginica multixenobiotic resistance protein (MXR)
           mRNA, partial cds
          Length = 912

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 28  agccactggatatacaaatctt 49
           ||||||||||||| ||||||||
Sbjct: 392 agccactggatattcaaatctt 371



to top

>ref|XM_789528.1| PREDICTED: Strongylocentrotus purpuratus similar to Pumilio homolog 1
            (LOC589897), mRNA
          Length = 7881

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 38   tatacaaatcttacaaga 55
            ||||||||||||||||||
Sbjct: 6494 tatacaaatcttacaaga 6477



to top

>emb|AL662858.15| Mouse DNA sequence from clone RP23-166O21 on chromosome 11, complete
             sequence
          Length = 195612

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 37    atatacaaatcttacaag 54
             ||||||||||||||||||
Sbjct: 62722 atatacaaatcttacaag 62705



to top

>ref|NM_204262.1| Gallus gallus period homolog 2 (Drosophila) (PER2), mRNA
          Length = 4035

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 21   cttccatagccactggat 38
            ||||||||||||||||||
Sbjct: 1601 cttccatagccactggat 1584



to top

>gb|AF246956.1| Gallus gallus PERIOD2 (PER2) mRNA, complete cds
          Length = 4035

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 21   cttccatagccactggat 38
            ||||||||||||||||||
Sbjct: 1601 cttccatagccactggat 1584



to top

>gb|AC104461.2| Homo sapiens chromosome 1 clone RP11-469A15, complete sequence
          Length = 165496

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 46  tcttacaagatttcaaac 63
           ||||||||||||||||||
Sbjct: 837 tcttacaagatttcaaac 820



to top

>gb|AC097065.2| Homo sapiens chromosome 1 clone RP11-532L16, complete sequence
          Length = 176861

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 46    tcttacaagatttcaaac 63
             ||||||||||||||||||
Sbjct: 88216 tcttacaagatttcaaac 88199



to top

>gb|AC018375.8| Homo sapiens, clone RP11-3P24, complete sequence
          Length = 149951

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 43    aaatcttacaagatttca 60
             ||||||||||||||||||
Sbjct: 77352 aaatcttacaagatttca 77335



to top

>gb|AC090893.5| Homo sapiens chromosome 11, clone RP11-390G21, complete sequence
          Length = 191524

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 43    aaatcttacaagatttca 60
             ||||||||||||||||||
Sbjct: 36811 aaatcttacaagatttca 36828



to top

>emb|BX842688.12| Zebrafish DNA sequence from clone DKEY-202E17 in linkage group 19,
              complete sequence
          Length = 254720

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 36     gatatacaaatcttacaa 53
              ||||||||||||||||||
Sbjct: 206873 gatatacaaatcttacaa 206890



to top

>gb|AC009884.8| Homo sapiens chromosome 8, clone RP11-420B22, complete sequence
          Length = 161443

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    agccactggatatacaaa 45
             ||||||||||||||||||
Sbjct: 35814 agccactggatatacaaa 35797



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 1       aacacaacatacaattacacct 22
               |||||||||||||||| |||||
Sbjct: 3234301 aacacaacatacaatttcacct 3234280



to top

>gb|AC018479.2|AC018479 Drosophila melanogaster, chromosome 3R, region 87D-87D, BAC clone
              BACR09O13, complete sequence
          Length = 174677

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 37     atatacaaatcttacaag 54
              ||||||||||||||||||
Sbjct: 107624 atatacaaatcttacaag 107607



to top

>gb|AC153896.10| Mus musculus 10 BAC RP23-114D16 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206003

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      aacatacaattacacctt 23
              ||||||||||||||||||
Sbjct: 191435 aacatacaattacacctt 191452



to top

>dbj|AP003905.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1177_E11
          Length = 92375

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     aacacaacatacaattacacct 22
             |||||||||||||||| |||||
Sbjct: 90381 aacacaacatacaatttcacct 90360



to top

>gb|AC008521.5|AC008521 Homo sapiens chromosome 19 clone CTC-461H2, complete sequence
          Length = 147514

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 31    cactggatatacaaatct 48
             ||||||||||||||||||
Sbjct: 96002 cactggatatacaaatct 96019



to top

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0438H08
          Length = 148626

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     aacacaacatacaattacacct 22
             |||||||||||||||| |||||
Sbjct: 11868 aacacaacatacaatttcacct 11847



to top

>gb|AC154499.2| Mus musculus BAC clone RP23-205I1 from 14, complete sequence
          Length = 202019

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 44    aatcttacaagatttcaa 61
             ||||||||||||||||||
Sbjct: 81742 aatcttacaagatttcaa 81759



to top

>gb|AC153976.3| Mus musculus 10 BAC RP24-309I5 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 146772

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     aacatacaattacacctt 23
             ||||||||||||||||||
Sbjct: 33939 aacatacaattacacctt 33956



to top

>emb|Z75103.1|SCYOR195W S.cerevisiae chromosome XV reading frame ORF YOR195w
          Length = 3049

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 32   actggatatacaaatctt 49
            ||||||||||||||||||
Sbjct: 2594 actggatatacaaatctt 2577



to top

>gb|AE003697.4| Drosophila melanogaster chromosome 3R, section 35 of 118 of the complete
              sequence
          Length = 221239

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 37     atatacaaatcttacaag 54
              ||||||||||||||||||
Sbjct: 119313 atatacaaatcttacaag 119296



to top

>dbj|AB029890.1| Coturnix coturnix japonica qPer2 mRNA for circadian clock protein
            PER2, complete cds
          Length = 5113

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 21   cttccatagccactggat 38
            ||||||||||||||||||
Sbjct: 2022 cttccatagccactggat 2005


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 560,608
Number of Sequences: 3902068
Number of extensions: 560608
Number of successful extensions: 40694
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40648
Number of HSP's gapped (non-prelim): 46
length of query: 66
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 45
effective length of database: 17,151,101,840
effective search space: 771799582800
effective search space used: 771799582800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top