>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete
             sequence
          Length = 211315

 Score = 40.1 bits (20), Expect = 0.86
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 55    tacattgcccacagctagggagag 78
             |||||||| |||||||||||||||
Sbjct: 81357 tacattgctcacagctagggagag 81380

>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome
          Length = 3544776

 Score = 40.1 bits (20), Expect = 0.86
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      aatccttccatccattcgct 28
              ||||||||||||||||||||
Sbjct: 519053 aatccttccatccattcgct 519034

>gb|AC140722.11| Medicago truncatula clone mth2-14e20, complete sequence
          Length = 97982

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    ggctcaattaatttacatt 60
             |||||||||||||||||||
Sbjct: 43665 ggctcaattaatttacatt 43647

>emb|AL731553.12| Human DNA sequence from clone RP11-56M3 on chromosome 10 Contains a
             nudix (nucleoside diphosphate linked moiety X)-type
             pseudogene, complete sequence
          Length = 99089

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 37    ccttgggctcaattaattt 55
             |||||||||||||||||||
Sbjct: 63002 ccttgggctcaattaattt 62984

>emb|AL360236.26| Human DNA sequence from clone RP11-380M3 on chromosome 6 Contains a
             novel pseudogene, part of the KCNQ5 gene for potassium
             voltage-gated channel KQT-like subfamily member 5, and a
             phosphoglycerate mutase 1 (brain) (PGAM1) pseudogene,
             complete sequence
          Length = 154998

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    ccttgggctcaattaattt 55
             |||||||||||||||||||
Sbjct: 42084 ccttgggctcaattaattt 42102

>gb|AC018977.9| Homo sapiens chromosome 10 clone RP11-386C23, complete sequence
          Length = 222810

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 49    ttaatttacattgcccaca 67
             |||||||||||||||||||
Sbjct: 93612 ttaatttacattgcccaca 93630

>emb|AL158077.15| Human DNA sequence from clone RP11-471J7 on chromosome 9 Contains the
             5' end of the SLC24A2 gene for solute carrier family 24
             (sodium/potassium/calcium exchanger), member 2 (NCKX2) and
             a CpG island, complete sequence
          Length = 159900

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 41    gggctcaattaatttacattgcc 63
             ||||| |||||||||||||||||
Sbjct: 90856 gggcttaattaatttacattgcc 90878

>emb|AL109940.18|HSJ421D16 Human DNA sequence from clone RP3-421D16 on chromosome 6q26-27 Contains
             part of the gene for smooth muscle cell associated protein
             2 (SMAP2) or secreted modular calcium binding protein 2
             (SMOC2) and two CpG islands, complete sequence
          Length = 110603

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 58    attgcccacagctagggagaggg 80
             ||||| |||||||||||||||||
Sbjct: 77044 attgctcacagctagggagaggg 77022


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 717,985
Number of Sequences: 3902068
Number of extensions: 717985
Number of successful extensions: 48834
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48810
Number of HSP's gapped (non-prelim): 24
length of query: 82
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 61
effective length of database: 17,151,101,840
effective search space: 1046217212240
effective search space used: 1046217212240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)