ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet31a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX936330.13| Zebrafish DNA sequence from clone CH211-266J17 ... 40 1.2
2gb|AY697300.1| Euphorbia ringspot virus polyprotein gene, partia... 38 4.8
3gb|AC137703.42| Medicago truncatula clone mth2-11d24, complete s... 38 4.8
4emb|AL360175.18| Human DNA sequence from clone RP11-524K22 on ch... 38 4.8
5gb|AC114933.2| Homo sapiens chromosome 5 clone CTD-2023M8, compl... 38 4.8
6dbj|AB079784.1| Ciona savignyi mitochondrial DNA, complete genome 38 4.8
7gb|U15802.1|PTU15802 Paramecium tetraurelia cell cycle control C... 38 4.8

>emb|BX936330.13| Zebrafish DNA sequence from clone CH211-266J17 in linkage group 19,
             complete sequence
          Length = 79553

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    ctttcaatcaaatcaaacaa 30
             ||||||||||||||||||||
Sbjct: 39724 ctttcaatcaaatcaaacaa 39743



to top

>gb|AY697300.1| Euphorbia ringspot virus polyprotein gene, partial cds
          Length = 2147

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 32  cgaacgaaacaatcattga 50
           |||||||||||||||||||
Sbjct: 836 cgaacgaaacaatcattga 854



to top

>gb|AC137703.42| Medicago truncatula clone mth2-11d24, complete sequence
          Length = 127446

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     ccctttcaatcaaatcaaa 27
             |||||||||||||||||||
Sbjct: 65206 ccctttcaatcaaatcaaa 65188



to top

>emb|AL360175.18| Human DNA sequence from clone RP11-524K22 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 58166

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     ccctttcaatcaaatcaaa 27
             |||||||||||||||||||
Sbjct: 24841 ccctttcaatcaaatcaaa 24823



to top

>gb|AC114933.2| Homo sapiens chromosome 5 clone CTD-2023M8, complete sequence
          Length = 177958

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 63    gggcagttcgttacagcagtacg 85
             ||||||||| |||||||||||||
Sbjct: 58732 gggcagttctttacagcagtacg 58710



to top

>dbj|AB079784.1| Ciona savignyi mitochondrial DNA, complete genome
          Length = 14737

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 9    ccctttcaatcaaatcaaa 27
            |||||||||||||||||||
Sbjct: 9288 ccctttcaatcaaatcaaa 9270



to top

>gb|U15802.1|PTU15802 Paramecium tetraurelia cell cycle control CDC2 (cdc2) gene,
          complete cds
          Length = 1092

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 12 tttcaatcaaatcaaacaa 30
          |||||||||||||||||||
Sbjct: 29 tttcaatcaaatcaaacaa 11


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 659,465
Number of Sequences: 3902068
Number of extensions: 659465
Number of successful extensions: 46205
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46197
Number of HSP's gapped (non-prelim): 8
length of query: 107
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 86
effective length of database: 17,151,101,840
effective search space: 1474994758240
effective search space used: 1474994758240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top