Clone Name	rbaet30c06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin...	105	7e-20
2	gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ...	105	7e-20
3	gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds	100	5e-18
4	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	100	5e-18
5	dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D...	100	5e-18
6	dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	5e-18
7	dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	5e-18
8	emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro...	100	5e-18
9	dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	5e-18
10	gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c...	98	2e-17
11	emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro...	96	7e-17
12	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	96	7e-17
13	dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D...	96	7e-17
14	dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D...	96	7e-17
15	dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	7e-17
16	dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	7e-17
17	dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	7e-17
18	dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	7e-17
19	dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	7e-17
20	dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN...	96	7e-17
21	ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic...	92	1e-15
22	emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl...	90	4e-15
23	gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol...	90	4e-15
24	dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D...	90	4e-15
25	emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ...	90	4e-15
26	dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	4e-15
27	dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	4e-15
28	dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	4e-15
29	dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	4e-15
30	dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	4e-15
31	gb|AY109324.1| Zea mays CL187_1 mRNA sequence	90	4e-15
32	gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein...	90	4e-15
33	ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic...	88	2e-14
34	gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b...	88	2e-14
35	gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene...	88	2e-14
36	gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei...	86	7e-14
37	ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2...	84	3e-13
38	ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2...	84	3e-13
39	ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin...	84	3e-13
40	ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ...	84	3e-13
41	gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom...	84	3e-13
42	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	84	3e-13
43	gb|AY142513.1| Arabidopsis thaliana putative photosystem II type...	84	3e-13
44	gb|AY045806.1| Arabidopsis thaliana putative photosystem II type...	84	3e-13
45	gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	84	3e-13
46	gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	84	3e-13
47	gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro...	84	3e-13
48	gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro...	84	3e-13
49	gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ...	84	3e-13
50	gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ...	84	3e-13
51	gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ...	84	3e-13
52	gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	84	3e-13
53	gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ...	84	3e-13
54	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	84	3e-13
55	emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co...	84	3e-13
56	emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co...	84	3e-13
57	emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co...	84	3e-13
58	emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co...	84	3e-13
59	emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c...	84	3e-13
60	emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting...	84	3e-13
61	dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	3e-13
62	dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	3e-13
63	gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot...	84	3e-13
64	gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll...	82	1e-12
65	gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei...	82	1e-12
66	gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	80	4e-12
67	gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	80	4e-12
68	dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue...	78	2e-11
69	gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/...	78	2e-11
70	gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein...	78	2e-11
71	gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p...	76	7e-11
72	gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L...	74	3e-10
73	emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro...	74	3e-10
74	emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo...	74	3e-10
75	gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch...	74	3e-10
76	emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein	72	1e-09
77	gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence	70	4e-09
78	emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ...	70	4e-09
79	emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b...	70	4e-09
80	emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr...	70	4e-09
81	dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c...	70	4e-09
82	dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN...	70	4e-09
83	ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND...	68	2e-08
84	ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND...	68	2e-08
85	ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ...	68	2e-08
86	gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence	68	2e-08
87	gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)...	68	2e-08
88	gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin...	68	2e-08
89	gb|AY050935.1| Arabidopsis thaliana putative photosystem II type...	68	2e-08
90	gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro...	68	2e-08
91	gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	68	2e-08
92	gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	68	2e-08
93	gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	68	2e-08
94	gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	68	2e-08
95	gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	68	2e-08
96	gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m...	68	2e-08
97	gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	68	2e-08
98	gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	68	2e-08
99	gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	68	2e-08
100	emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co...	68	2e-08
101	emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co...	68	2e-08
102	emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co...	68	2e-08
103	emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co...	68	2e-08
104	emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co...	68	2e-08
105	gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	68	2e-08
106	gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N...	68	2e-08
107	gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s...	68	2e-08
108	gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi...	68	2e-08
109	emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy...	68	2e-08
110	emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy...	68	2e-08
111	emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy...	68	2e-08
112	emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding...	68	2e-08
113	gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p...	68	2e-08
114	gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot...	68	2e-08
115	dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light...	66	6e-08
116	emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll...	66	6e-08
117	gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-...	66	6e-08
118	dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b...	66	6e-08
119	gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence	64	2e-07
120	emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll...	64	2e-07
121	gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	64	2e-07
122	gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/...	64	2e-07
123	emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl...	64	2e-07
124	emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind...	64	2e-07
125	gb|AY112240.1| Zea mays CL187_6 mRNA sequence	64	2e-07
126	gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p...	64	2e-07
127	gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl...	64	2e-07
128	gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-...	64	2e-07
129	gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	62	1e-06
130	gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se...	62	1e-06
131	gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy...	62	1e-06
132	gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence	60	4e-06
133	emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co...	60	4e-06
134	dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene...	60	4e-06
135	emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h...	60	4e-06
136	gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p...	60	4e-06
137	gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ...	60	4e-06
138	dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene...	58	2e-05
139	emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA	58	2e-05
140	emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro...	58	2e-05
141	gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-...	58	2e-05
142	gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-...	58	2e-05
143	ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin...	56	6e-05
144	gb|AF339687.1| Arabidopsis thaliana putative photosystem II type...	56	6e-05
145	gb|AF326864.1| Arabidopsis thaliana putative photosystem II type...	56	6e-05
146	gb|AY120776.1| Arabidopsis thaliana putative photosystem II type...	56	6e-05
147	gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430...	56	6e-05
148	emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co...	56	6e-05
149	gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s...	56	6e-05
150	emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind...	56	6e-05
151	emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ...	56	6e-05
152	gb|BT002103.1| Arabidopsis thaliana putative photosystem II type...	56	6e-05
153	gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi...	56	6e-05
154	gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR...	54	2e-04
155	emb|AJ843976.1| Plantago major partial mRNA for light harvesting...	54	2e-04
156	gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding...	54	2e-04
157	emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co...	54	2e-04
158	dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro...	54	2e-04
159	emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl...	52	0.001
160	emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ...	52	0.001
161	gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl...	52	0.001
162	gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p...	52	0.001
163	emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/...	50	0.004
164	emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi...	50	0.004
165	emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/...	50	0.004
166	gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ...	50	0.004
167	gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab...	50	0.004
168	gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p...	46	0.058
169	emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin...	46	0.058
170	gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c...	46	0.058
171	dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv...	46	0.058
172	ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi...	44	0.23
173	gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence	44	0.23
174	gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein...	44	0.23
175	gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds	44	0.23
176	gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl...	44	0.23
177	gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se...	44	0.23
178	gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA...	44	0.23
179	dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	44	0.23
180	gb|AY104614.1| Zea mays PCO084486 mRNA sequence	44	0.23
181	gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p...	44	0.23
182	emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t...	44	0.23
183	gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ...	44	0.23
184	gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b...	44	0.23
185	ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA	42	0.91
186	ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
187	ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
188	ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
189	ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
190	ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
191	ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
192	ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group...	42	0.91
193	ref|NM_001032032.1| Drosophila melanogaster held out wings CG102...	42	0.91
194	gb|AC007114.8| Homo sapiens chromosome 17, clone RP11-166P13, co...	42	0.91
195	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	42	0.91
196	gb|AC008144.5|AC008144 Drosophila melanogaster, chromosome 3R, r...	42	0.91
197	dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D...	42	0.91
198	dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
199	dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
200	dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
201	emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/...	42	0.91
202	dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
203	dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
204	dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
205	dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
206	dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
207	dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
208	dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	0.91
209	gb|AE003737.3| Drosophila melanogaster chromosome 3R, section 75...	42	0.91
210	gb|AF005849.1|AF005849 Drosophila melanogaster anon1F4 pseudogen...	42	0.91
211	gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll...	42	0.91
212	gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g...	42	0.91
213	gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste...	42	0.91
214	dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ...	42	0.91
215	ref|NM_128200.3| Arabidopsis thaliana RCY1; cyclin-dependent pro...	40	3.6
216	gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com...	40	3.6
217	gb|AC163991.3| Mus musculus chromosome 15, clone RP24-119L11, co...	40	3.6
218	gb|AY150419.1| Arabidopsis thaliana putative cyclin (At2g26430) ...	40	3.6
219	gb|AY091085.1| Arabidopsis thaliana putative cyclin (At2g26430) ...	40	3.6
220	emb|CR626890.8| Zebrafish DNA sequence from clone DKEY-83J7 in l...	40	3.6
221	emb|BX324206.6| Zebrafish DNA sequence from clone CH211-66O10 in...	40	3.6
222	gb|AF249734.1| Arabidopsis thaliana ania-6a type cyclin (RCY1) m...	40	3.6
223	emb|BX324151.11| Zebrafish DNA sequence from clone CH211-62C19 i...	40	3.6
224	dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010	40	3.6
225	gb|AC002505.3| Arabidopsis thaliana chromosome 2 clone T9J22 map...	40	3.6
226	ref|XM_686371.1| PREDICTED: Danio rerio similar to endothelial c...	40	3.6
227	gb|AC156618.5| Mus musculus chromosome 3, clone RP24-372J15, com...	40	3.6
228	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	40	3.6
229	emb|BX819076.1|CNS0A9W0 Arabidopsis thaliana Full-length cDNA Co...	40	3.6
230	gb|AC114311.3| Homo sapiens chromosome 5 clone RP11-2N5, complet...	40	3.6
231	gb|AC092915.7| Homo sapiens 3 BAC RP11-585F20 (Roswell Park Canc...	40	3.6
232	gb|AY086218.1| Arabidopsis thaliana clone 22595 mRNA, complete s...	40	3.6
233	dbj|AP004730.2| Oryza sativa (japonica cultivar-group) genomic D...	40	3.6
234	gb|AC010582.6|AC010582 Homo sapiens chromosome 14 clone CTD-2547...	40	3.6
235	emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p...	40	3.6
236	emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c...	40	3.6
237	emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig...	40	3.6
238	emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh...	40	3.6
239	gb|AC102905.9| Mus musculus chromosome 15, clone RP24-303N12, co...	40	3.6
240	emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 i...	40	3.6
241	gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote...	40	3.6
242	emb|AL136040.5|CNS01DVV Human chromosome 14 DNA sequence BAC C-2...	40	3.6
243	gb|AC104874.11| Mus musculus chromosome 3, clone RP23-453I14, co...	40	3.6
244	emb|AL935316.7| Zebrafish DNA sequence from clone CH211-239C9 in...	40	3.6
245	gb|AF005850.1|AF005850 Drosophila yakuba anon1F4 pseudogene, par...	40	3.6
246	dbj|AP004488.1| Lotus japonicus genomic DNA, chromosome 2, clone...	40	3.6
247	emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr...	40	3.6
248	gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p...	40	3.6
249	gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid...	40	3.6

---

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  105 bits (53), Expect = 7e-20
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 2723 gctcacttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcg 2664

             
Query: 275  g 275
            |
Sbjct: 2663 g 2663

---

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  105 bits (53), Expect = 7e-20
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
            ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1196 ctcacttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 1137

             
Query: 276  c 276
            |
Sbjct: 1136 c 1136

---

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808

             
Query: 274 gg 275
           ||
Sbjct: 807 gg 806

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 23604331 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 23604272

                  
Query: 275      gc 276
                ||
Sbjct: 23604271 gc 23604270



 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                            
Query: 216      ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
                ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 30025136 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 30025077

                 
Query: 276      c 276
                |
Sbjct: 30025076 c 30025076

---

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 67030 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 66971

               
Query: 275   gc 276
             ||
Sbjct: 66970 gc 66969

---

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 859 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 800

             
Query: 275 gc 276
           ||
Sbjct: 799 gc 798

---

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 858 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 799

             
Query: 275 gc 276
           ||
Sbjct: 798 gc 797

---

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 1288 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 1229

              
Query: 275  gc 276
            ||
Sbjct: 1228 gc 1227

---

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 388 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 329

             
Query: 275 gc 276
           ||
Sbjct: 328 gc 327

---

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           |||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 872 ctcatttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 813

            
Query: 276 c 276
           |
Sbjct: 812 c 812

---

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
            |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 1247 tcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1188

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                            
Query: 217      tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
                |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 10793782 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 10793723

---

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                         
Query: 217   tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
             |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 17505 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 17446

---

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                          
Query: 217    tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
              |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 130400 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 130341

---

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 850 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 791

---

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

---

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 857 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 798

---

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

---

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

---

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 836 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 777

---

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                     
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 727

---

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
            ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752

             
Query: 276  c 276
            |
Sbjct: 1751 c 1751

---

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
             ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 13875 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 13934

              
Query: 276   c 276
             |
Sbjct: 13935 c 13935

---

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
             ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 21126 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 21067

              
Query: 276   c 276
             |
Sbjct: 21066 c 21066

---

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 863 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 804

            
Query: 276 c 276
           |
Sbjct: 803 c 803

---

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

            
Query: 276 c 276
           |
Sbjct: 820 c 820

---

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

            
Query: 276 c 276
           |
Sbjct: 820 c 820

---

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

            
Query: 276 c 276
           |
Sbjct: 822 c 822

---

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 865 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 806

            
Query: 276 c 276
           |
Sbjct: 805 c 805

---

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

            
Query: 276 c 276
           |
Sbjct: 822 c 822

---

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
            ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752

             
Query: 276  c 276
            |
Sbjct: 1751 c 1751

---

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337

---

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||
Sbjct: 798 tcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 739

---

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 472 tcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413

---

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
            |||||||||||| ||||||||||||||||| |||||||||||||||  ||||||||||||
Sbjct: 1534 tcacttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475

---

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| |||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 855 gctcactttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtc 797

---

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542

              
Query: 275  gc 276
            ||
Sbjct: 2543 gc 2544

---

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542

              
Query: 275  gc 276
            ||
Sbjct: 2543 gc 2544

---

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796

             
Query: 275 gc 276
           ||
Sbjct: 795 gc 794

---

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 813 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 754

             
Query: 275 gc 276
           ||
Sbjct: 753 gc 752

---

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 78970 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 79029

               
Query: 275   gc 276
             ||
Sbjct: 79030 gc 79031

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 21808846 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21808787

                  
Query: 275      gc 276
                ||
Sbjct: 21808786 gc 21808785

---

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741

             
Query: 275 gc 276
           ||
Sbjct: 740 gc 739

---

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796

             
Query: 275 gc 276
           ||
Sbjct: 795 gc 794

---

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 93201 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 93260

               
Query: 275   gc 276
             ||
Sbjct: 93261 gc 93262



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
             ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 96106 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 96055

---

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 81001 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 80942

               
Query: 275   gc 276
             ||
Sbjct: 80941 gc 80940



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
             ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 78096 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 78147

---

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741

             
Query: 275 gc 276
           ||
Sbjct: 740 gc 739

---

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

             
Query: 275 gc 276
           ||
Sbjct: 791 gc 790

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 21801875 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21801816

                  
Query: 275      gc 276
                ||
Sbjct: 21801815 gc 21801814

---

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 171 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 112

             
Query: 275 gc 276
           ||
Sbjct: 111 gc 110

---

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 832 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 773

             
Query: 275 gc 276
           ||
Sbjct: 772 gc 771

---

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 835 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 776

             
Query: 275 gc 276
           ||
Sbjct: 775 gc 774

---

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 84  gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 143

             
Query: 275 gc 276
           ||
Sbjct: 144 gc 145

---

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 1100 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 1041

              
Query: 275  gc 276
            ||
Sbjct: 1040 gc 1039

---

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                     
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||| ||||||||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 973 acttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916

---

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 845 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 786

             
Query: 275 gc 276
           ||
Sbjct: 785 gc 784

---

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 420 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 361

             
Query: 275 gc 276
           ||
Sbjct: 360 gc 359

---

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||||||||||
Sbjct: 834 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 775

             
Query: 275 gc 276
           ||
Sbjct: 774 gc 773

---

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||||||||||||||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 828 tcacttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtc 772

---

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 841 ctcacttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 782

            
Query: 276 c 276
           |
Sbjct: 781 c 781

---

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||
Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739

---

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||
Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739

---

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 231 cgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 653

---

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||| ||||||||||||||| | |||||||||||||||||||| |||||
Sbjct: 852 gctcactttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtc 794

---

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||||||||| ||||||||||||||| | |||||||| ||||||||||| |||||
Sbjct: 825 gctcacttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767

---

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||| || |||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 808 acttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggc 751

---

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||||||||||||| | ||||||||||||||||| ||||||||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808

---

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||||||||||||| | ||||||||||||||||| ||||||||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817

---

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           ||||||||||||| || |||||||||||  | ||||| ||||||||||||||||||||||
Sbjct: 811 ctcacttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcgg 752

            
Query: 276 c 276
           |
Sbjct: 751 c 751

---

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||||||||||||| |||||||||||||||||  |||||||||
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtc 522

---

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||| |||||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggc 760

---

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           || ||||| ||||| ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 634 gcwcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 582

---

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
            |||||| ||||| ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 2376 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326

---

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
            |||||| ||||| ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 2377 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327

---

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||| ||||||||||| ||||| ||||| |||||||||||||| |||||
Sbjct: 377 gctcactttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319

---

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| |||||||| ||||| |||||  |||||||||||||||||||||| |||||
Sbjct: 814 gctcacttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtc 756

---

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           |||||||||||| ||||||||||||||| | | |||||||||||||  |||||||||||
Sbjct: 824 tcacttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcgg 766

---

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823

---

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800

             
Query: 275 gc 276
           ||
Sbjct: 799 gc 798

---

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814

             
Query: 275 gc 276
           ||
Sbjct: 813 gc 812

---

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 634 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585

---

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800

             
Query: 275 gc 276
           ||
Sbjct: 799 gc 798

---

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 806 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 757

---

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823

---

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800

             
Query: 275 gc 276
           ||
Sbjct: 799 gc 798

---

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 806 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 747

             
Query: 275 gc 276
           ||
Sbjct: 746 gc 745

---

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 806 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 747

             
Query: 275 gc 276
           ||
Sbjct: 746 gc 745

---

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800

             
Query: 275 gc 276
           ||
Sbjct: 799 gc 798

---

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799

             
Query: 275 gc 276
           ||
Sbjct: 798 gc 797

---

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823

---

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823

---

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 852 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 793

             
Query: 275 gc 276
           ||
Sbjct: 792 gc 791

---

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799

             
Query: 275 gc 276
           ||
Sbjct: 798 gc 797

---

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823

---

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 176 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 127

---

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 841 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 792

---

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||| ||||| ||||||||||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggc 771

---

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||||||||||||| | ||||| |||||||||| ||| ||||||
Sbjct: 842 gctcactttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcg 783

             
Query: 275 gc 276
           ||
Sbjct: 782 gc 781

---

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 56/62 (90%), Gaps = 1/62 (1%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| ||||| ||||| ||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 834 gctcactttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcg 776

             
Query: 275 gc 276
           ||
Sbjct: 775 gc 774

---

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 752 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 703

---

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 22544 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 22485

               
Query: 275   gc 276
             ||
Sbjct: 22484 gc 22483



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
             |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 19898 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 19839

               
Query: 275   gc 276
             ||
Sbjct: 19838 gc 19837



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                               
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
             |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 16109 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 16158

---

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814

             
Query: 275 gc 276
           ||
Sbjct: 813 gc 812

---

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||||||| ||||||||| | |||||||||||||||
Sbjct: 874 tcacttgccgggaacgaaattggtggcgtaggcccaggcgttgttg 829

---

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
            |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 1023 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 974

---

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
            |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 1012 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 953

              
Query: 275  gc 276
            ||
Sbjct: 952  gc 951

---

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 951 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 892

             
Query: 275 gc 276
           ||
Sbjct: 891 gc 890

---

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                        
Query: 212  tgagctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacgggg 271
            |||||| | |||||||| ||||||||||||||| | ||||| |||||||||||||| |||
Sbjct: 1685 tgagcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactggg 1626

              
Query: 272  tc 273
            ||
Sbjct: 1625 tc 1624



 Score = 42.1 bits (21), Expect = 0.91
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                             
Query: 68   ttagtgtacacacaccaactcatcatctcgact 100
            |||||||||| || |||||||||||||||||||
Sbjct: 1833 ttagtgtaca-acgccaactcatcatctcgact 1802

---

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           ||||||||||||||||||||| |||||| ||||||| |||||||||
Sbjct: 849 tcacttgccgggaacgaagttagtggcgtaagcccaagcgttgttg 804

---

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||||||||| || || ||||||||| | |||||||||||||||  ||||||||||
Sbjct: 841 gctcacttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcg 782

             
Query: 275 gc 276
           ||
Sbjct: 781 gc 780

---

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| ||||||||||||||| | |||||||| |||||||| |||||||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840

---

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
            |||||||| ||||| ||||||||||||||  | ||||||||||||||||||||
Sbjct: 1044 gctcactttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992

---

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtc 295

---

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||||||||||||||| | |||||||||||||||   |||||||||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggc 787

---

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 762 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703

---

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||| ||||||||||||||  | ||||||||||||||| | |||||||||||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829

---

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 804 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745

---

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 233 aagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792

---

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||| |||||||| |||||| | |||||||||||||||  ||||||||||||
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 769

---

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 221  ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
            |||||||| ||||||||||||||  | ||||||||||||||| | |||||||||||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907

---

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||| |||||||| |||||| | |||||||||||||||  ||||||||||||
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 417

---

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| |||||||| |||||||||||  | ||||| |||||||||||||| ||||||||
Sbjct: 852 tcactttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793

---

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| || ||||||||||||||  | ||||||||||||||||| |||||||||||
Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggggtcggc 230

---

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggc 292

---

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 230 acgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||||||||||| || |||||||| |||||||||||||| |||||
Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggc 615

---

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||| || ||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 219 gctcactttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||||| ||||| || ||||| |||||||| ||||| ||||||||||| || |||||
Sbjct: 8571 tcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtc 8627

---

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcgg 275
           |||||||| |||||||| |||||| | |||||||||||||||  |||||||||||
Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcgg 52

---

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtc 786

---

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 55/62 (88%), Gaps = 1/62 (1%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 843 gctcactttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcg 785

             
Query: 275 gc 276
           ||
Sbjct: 784 gc 783

---

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 221  ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
            |||||||||||||||||||||||| | ||||| |||||||||
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807

---

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||| ||||| || || |||||||||||| | |||||||||||||||||||| |||||
Sbjct: 839 ctcatttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtc 782

---

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| || ||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtc 742

---

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtc 932

---

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 224  ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
            ||||||||||||||||||||| | ||||| |||||||||   |||||||||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggc 2965

---

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           |||||| |||||||| |||||||||||| |||||||||| |||||
Sbjct: 964 tcactttccgggaacaaagttggtggcgtaagcccaggcattgtt 920

---

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| ||||| ||||||||| | |||||||| |||||||| |||||||||||
Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggc 833

---

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || |||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtc 295

---

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || |||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtc 295

---

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813

---

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751

---

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813

---

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813

---

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 870 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 819

---

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 522 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 471

---

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813

---

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
            |||||| |||||||| ||||| ||||| |||||||| |||||||||||
Sbjct: 1704 tcactttccgggaacaaagtttgtggcaaaagcccatgcgttgttgtt 1657

---

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
            ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 1102 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 1051

---

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           ||||||| ||||| ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751

---

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||||||| |||||||| ||||| ||||| || ||||| ||||||||||| || |||||
Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783

---

>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial
           sequence; nuclear gene for chloroplast product
          Length = 255

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           ||||||| ||||| ||||||||||||||  |||||||||| ||||||
Sbjct: 186 ctcacttcccgggcacgaagttggtggcataagcccaggcattgttg 140

---

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 46/51 (90%), Gaps = 1/51 (1%)
 Strand = Plus / Minus

                                                              
Query: 224 ccgggaacgaagttggtggcgaaag-cccaggcgttgttgttgacggggtc 273
           |||||||||||||| ||||| |||| |||| ||||||||||| ||||||||
Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtc 634

---

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           |||||| ||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 843 tcactttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793

---

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 55/63 (87%), Gaps = 1/63 (1%)
 Strand = Plus / Plus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagccc-aggcgttgttgttgacggggtc 273
           |||||||| |||||||| |||||||| ||||| |||| | |||||||||||||| || ||
Sbjct: 49  gctcactttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatc 108

              
Query: 274 ggc 276
           |||
Sbjct: 109 ggc 111

---

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 232  gaagttggtggcgaaagcccaggcgttgttg 262
            ||||||||||||| |||||||||||||||||
Sbjct: 1379 gaagttggtggcgtaagcccaggcgttgttg 1349

---

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||||||| ||||||||  | |||||||| ||||||
Sbjct: 707 tcacttgccgggaacgaaattggtggcataggcccaggcattgttg 662

---

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||| ||||||||| | |||||||| ||||||
Sbjct: 586 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 545

---

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||| ||||||||| | |||||||| ||||||
Sbjct: 737 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 696

---

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||| |||||  ||| ||||||||||||||| ||||||||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtc 742

---

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| |||||||| |||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 815 tcactttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759

---

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           |||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 873 tcactttccaggaacgaagttggtggcaaaggcccaggcattgtt 829

---

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| |||||||| ||||| |||||  ||| ||||||||||||||| || |||||
Sbjct: 859 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtc 803

---

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||||| |||||||| ||||| |||||  ||||||| || ||||||||||| |||||
Sbjct: 1552 tcactttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtc 1496

---

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||||| |||||||| ||||| |||||  ||| ||||||||||||||| || |||||
Sbjct: 1779 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtc 1723

---

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||| ||||| ||||||||||| || |||||||| || |||||||| || |||||
Sbjct: 805 actttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtc 751

---

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219  acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||| ||||| || ||||| |||||  | ||||||||||||||||| ||||||||
Sbjct: 1303 actttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 1249

---

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 227 ggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| |||||||||||  ||||||||||||| ||||| || |||||
Sbjct: 877 ggaacaaagttggtggcataagcccaggcgttattgttcaccgggtc 831

---

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219  acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||| ||||| || ||||| |||||  | ||||||||||||||||| ||||||||
Sbjct: 2706 actttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 2652

---

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 849 ccggggacgaagttggtggcgtaagcccaagcattgtt 812

---

>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence
          Length = 510

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 402 ccggggacgaagttggtggcgtaagcccaagcattgtt 365

---

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||| ||||||||||||||||| || || ||||| || ||||||||
Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgtt 829

---

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 794 ccggggacgaagttggtggcgtaagcccaagcattgtt 757

---

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 843 ccggggacgaagttggtggcgtaagcccaagcattgtt 806

---

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 843 ccggggacgaagttggtggcgtaagcccaagcattgtt 806

---

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 799 ccggggacgaagttggtggcgtaagcccaagcattgtt 762

---

>dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGF10
          Length = 84702

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 224   ccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
             ||||| ||||||||||||||| ||||||| || |||||
Sbjct: 31775 ccggggacgaagttggtggcgtaagcccaagcattgtt 31738

---

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 255 cgttgttgttgacggggtcggc 276
           ||||||||||||||||||||||
Sbjct: 955 cgttgttgttgacggggtcggc 934

---

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| || ||||| |||||  ||| ||||||||||||||| ||||||||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtc 742

---

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 44/50 (88%), Gaps = 1/50 (2%)
 Strand = Plus / Plus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||| || ||||| |||||||||||| || |||||||||| ||||||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaag-cgttgttgttaacggggtc 54

---

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||||| ||||| |||||| | | ||||||||||||||| || |||||
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtc 295

---

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||||| |||||||| ||||| |||||  | ||||| || ||||||||||| |||||
Sbjct: 624 ctcactttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtc 567

---

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 776

---

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800

---

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800

---

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 802

---

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 807

---

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 840

---

>ref|NM_001032032.1| Drosophila melanogaster held out wings CG10293-RC, transcript variant
            C (how), mRNA
          Length = 4030

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 107  cacatgcaaaatctatcagtc 127
            |||||||||||||||||||||
Sbjct: 3603 cacatgcaaaatctatcagtc 3623

---

>gb|AC007114.8| Homo sapiens chromosome 17, clone RP11-166P13, complete sequence
          Length = 148781

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 28     aatctgaaaaataaccagata 48
              |||||||||||||||||||||
Sbjct: 112377 aatctgaaaaataaccagata 112397

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                         
Query: 236      ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
                ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 22434813

---

>gb|AC008144.5|AC008144 Drosophila melanogaster, chromosome 3R, region 93F-93F, BAC clone
             BACR04F21, complete sequence
          Length = 171226

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   cacatgcaaaatctatcagtc 127
             |||||||||||||||||||||
Sbjct: 66845 cacatgcaaaatctatcagtc 66825

---

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 236   ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
             ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 95880

---

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| ||||| || |||||||||||| | | |||||| |||||||| || |||||
Sbjct: 871 tcactttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtc 815

---

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 776

---

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800

---

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800

---

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805

---

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 801

---

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 236 ttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||||||| |  ||||||||||||||  ||||||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 807

---

>gb|AE003737.3| Drosophila melanogaster chromosome 3R, section 75 of 118 of the complete
              sequence
          Length = 178251

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    cacatgcaaaatctatcagtc 127
              |||||||||||||||||||||
Sbjct: 119539 cacatgcaaaatctatcagtc 119559

---

>gb|AF005849.1|AF005849 Drosophila melanogaster anon1F4 pseudogene, partial sequence
          Length = 2329

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 107  cacatgcaaaatctatcagtc 127
            |||||||||||||||||||||
Sbjct: 1902 cacatgcaaaatctatcagtc 1922

---

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           ||||||||||||| | ||||| || ||||| ||||| || |||||||| || |||||
Sbjct: 860 tcacttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804

---

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| |||||||||||||| |    ||| |||||||||||||| ||||||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggc 942

---

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
           |||||| ||||| || |||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 992 tcactttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtc 936

---

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtc 273
            |||||| |||||||| ||||| |||||  | ||||| ||||||||||| || |||||
Sbjct: 1870 tcactttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtc 1926

---

>ref|NM_128200.3| Arabidopsis thaliana RCY1; cyclin-dependent protein kinase regulator
            AT2G26430 (RCY1) mRNA, complete cds
          Length = 1583

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1318 agaagaatgatgccttgatttatctgaa 1291

---

>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence
          Length = 236143

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 149    agcatccatcagcaatgaag 168
              ||||||||||||||||||||
Sbjct: 112171 agcatccatcagcaatgaag 112152

---

>gb|AC163991.3| Mus musculus chromosome 15, clone RP24-119L11, complete sequence
          Length = 152173

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   catgcagcacagcagcatcc 155
             ||||||||||||||||||||
Sbjct: 34686 catgcagcacagcagcatcc 34667

---

>gb|AY150419.1| Arabidopsis thaliana putative cyclin (At2g26430) mRNA, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1200 agaagaatgatgccttgatttatctgaa 1173

---

>gb|AY091085.1| Arabidopsis thaliana putative cyclin (At2g26430) mRNA, complete cds
          Length = 1537

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1314 agaagaatgatgccttgatttatctgaa 1287

---

>emb|CR626890.8| Zebrafish DNA sequence from clone DKEY-83J7 in linkage group 15,
             complete sequence
          Length = 211127

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   cagcacagcagcatccatca 159
             ||||||||||||||||||||
Sbjct: 84374 cagcacagcagcatccatca 84393

---

>emb|BX324206.6| Zebrafish DNA sequence from clone CH211-66O10 in linkage group 15,
              complete sequence
          Length = 164638

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    cagcacagcagcatccatca 159
              ||||||||||||||||||||
Sbjct: 139671 cagcacagcagcatccatca 139690

---

>gb|AF249734.1| Arabidopsis thaliana ania-6a type cyclin (RCY1) mRNA, complete cds
          Length = 1433

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1213 agaagaatgatgccttgatttatctgaa 1186

---

>emb|BX324151.11| Zebrafish DNA sequence from clone CH211-62C19 in linkage group 15,
             complete sequence
          Length = 182149

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   cagcacagcagcatccatca 159
             ||||||||||||||||||||
Sbjct: 30941 cagcacagcagcatccatca 30960

---

>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     tgtacacacaccaactcatc 91
              ||||||||||||||||||||
Sbjct: 133595 tgtacacacaccaactcatc 133576

---

>gb|AC002505.3| Arabidopsis thaliana chromosome 2 clone T9J22 map B68, complete
             sequence
          Length = 115851

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 8     agaagaaagatgccttgattaatctgaa 35
             ||||||| |||||||||||| |||||||
Sbjct: 29149 agaagaatgatgccttgatttatctgaa 29176

---

>ref|XM_686371.1| PREDICTED: Danio rerio similar to endothelial cell adhesion
           molecule (LOC563007), mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cagcacagcagcatccatca 159
           ||||||||||||||||||||
Sbjct: 223 cagcacagcagcatccatca 204

---

>gb|AC156618.5| Mus musculus chromosome 3, clone RP24-372J15, complete sequence
          Length = 171545

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 133   agacatgcagcacagcagca 152
             ||||||||||||||||||||
Sbjct: 23011 agacatgcagcacagcagca 22992

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 138      tgcagcacagcagcatccat 157
                ||||||||||||||||||||
Sbjct: 18990787 tgcagcacagcagcatccat 18990768

---

>emb|BX819076.1|CNS0A9W0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB43ZG05 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1513

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1313 agaagaatgatgccttgatttatctgaa 1286

---

>gb|AC114311.3| Homo sapiens chromosome 5 clone RP11-2N5, complete sequence
          Length = 96123

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    ttgattaatctgaaaaataa 41
             ||||||||||||||||||||
Sbjct: 50377 ttgattaatctgaaaaataa 50396

---

>gb|AC092915.7| Homo sapiens 3 BAC RP11-585F20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 187215

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    tctttttagtgtacacacac 82
             ||||||||||||||||||||
Sbjct: 75284 tctttttagtgtacacacac 75303

---

>gb|AY086218.1| Arabidopsis thaliana clone 22595 mRNA, complete sequence
          Length = 1583

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 8    agaagaaagatgccttgattaatctgaa 35
            ||||||| |||||||||||| |||||||
Sbjct: 1318 agaagaatgatgccttgatttatctgaa 1291

---

>dbj|AP004730.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0009J19
          Length = 156988

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   tgcagcacagcagcatccat 157
             ||||||||||||||||||||
Sbjct: 83457 tgcagcacagcagcatccat 83438

---

>gb|AC010582.6|AC010582 Homo sapiens chromosome 14 clone CTD-2547F10, complete sequence
          Length = 191549

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      gaagaagaaagatgccttga 25
              ||||||||||||||||||||
Sbjct: 102507 gaagaagaaagatgccttga 102526

---

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
            |||||| ||||| || ||||| || ||| ||| ||| ||||||||||| || ||||||||
Sbjct: 1034 tcactttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggc 975

---

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 216  ctcacttgccgggaacgaagttggtggc 243
            ||||||| |||||||| |||||||||||
Sbjct: 2118 ctcactttccgggaacaaagttggtggc 2091

---

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| || |||||||| || ||| | ||||||||||||||| | || ||||||||
Sbjct: 848 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggc 793

---

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           ||||| || |||||||| || ||| | ||||||||||||||| | || ||||||||
Sbjct: 845 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggc 790

---

>gb|AC102905.9| Mus musculus chromosome 15, clone RP24-303N12, complete sequence
          Length = 153799

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    catgcagcacagcagcatcc 155
              ||||||||||||||||||||
Sbjct: 130651 catgcagcacagcagcatcc 130632

---

>emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 in linkage group 9,
             complete sequence
          Length = 211682

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 137   atgcagcacagcagcatccatcag 160
             |||||||||| |||||||||||||
Sbjct: 25016 atgcagcacatcagcatccatcag 25039

---

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||| |||||||| ||||| |||||| | | ||| |||||||||||
Sbjct: 231 tcactttccgggaacaaagtttgtggcgtaggaccaagcgttgttgtt 184

---

>emb|AL136040.5|CNS01DVV Human chromosome 14 DNA sequence BAC C-2506P8 of library CalTech-D from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 199420

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     gaagaagaaagatgccttga 25
             ||||||||||||||||||||
Sbjct: 97531 gaagaagaaagatgccttga 97512

---

>gb|AC104874.11| Mus musculus chromosome 3, clone RP23-453I14, complete sequence
          Length = 182940

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    agacatgcagcacagcagca 152
              ||||||||||||||||||||
Sbjct: 165644 agacatgcagcacagcagca 165625

---

>emb|AL935316.7| Zebrafish DNA sequence from clone CH211-239C9 in linkage group 3,
             complete sequence
          Length = 174887

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   cagcacagcagcatccatca 159
             ||||||||||||||||||||
Sbjct: 83612 cagcacagcagcatccatca 83631

---

>gb|AF005850.1|AF005850 Drosophila yakuba anon1F4 pseudogene, partial sequence
          Length = 1611

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 107  cacatgcaaaatctatcagt 126
            ||||||||||||||||||||
Sbjct: 1118 cacatgcaaaatctatcagt 1137

---

>dbj|AP004488.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT02F05, TM0020,
             complete sequence
          Length = 80920

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    atctgaaaaataaccagata 48
             ||||||||||||||||||||
Sbjct: 66789 atctgaaaaataaccagata 66808

---

>emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chromosome 3, complete
             sequence
          Length = 132775

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   agcatccatcagcaatgaag 168
             ||||||||||||||||||||
Sbjct: 83804 agcatccatcagcaatgaag 83785

---

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           |||||||| ||||| ||||| || ||||| || |||||||||||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgac 748

---

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgacggggtcggc 276
           |||||| |||||||| |||||||| ||  | | ||| ||||||||||| || ||||||||
Sbjct: 688 tcactttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggc 629


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,581,678
Number of Sequences: 3902068
Number of extensions: 2581678
Number of successful extensions: 49364
Number of sequences better than 10.0: 249
Number of HSP's better than 10.0 without gapping: 246
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 48949
Number of HSP's gapped (non-prelim): 415
length of query: 276
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 254
effective length of database: 17,147,199,772
effective search space: 4355388742088
effective search space used: 4355388742088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---