>gb|AC096845.2| Takifugu rubripes clone 214J14, complete sequence
          Length = 134105

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 67     gatggggtaattaatattataa 88
              ||||||||||||||||||||||
Sbjct: 104017 gatggggtaattaatattataa 104038

>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 76      attaatattataaaggacatg 96
               |||||||||||||||||||||
Sbjct: 1408714 attaatattataaaggacatg 1408734

>gb|AC099573.15| Mus musculus chromosome 7, clone RP23-28E6, complete sequence
          Length = 212811

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 68   atggggtaattaatattataa 88
            |||||||||||||||||||||
Sbjct: 2491 atggggtaattaatattataa 2511

>emb|CR523451.1| Gallus gallus finished cDNA, clone ChEST983b18
          Length = 1508

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 acctgaaccgaacgacaataa 304
           |||||||||||||||||||||
Sbjct: 880 acctgaaccgaacgacaataa 860

>gb|AC151899.7| Mus musculus BAC clone RP24-170L4 from chromosome 7, complete sequence
          Length = 168239

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     atggggtaattaatattataa 88
              |||||||||||||||||||||
Sbjct: 128006 atggggtaattaatattataa 127986

>gb|AF214008.1|AF214008 Brassica napus cytochrome p450-dependent monooxygenase (BNF5H2) mRNA,
            complete cds
          Length = 1884

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 158  gtcgctcatgtcgagctctgttggtttcatgccatcgggta 198
            ||||||||| || |||||  |||||||||||||||| ||||
Sbjct: 1539 gtcgctcatatcaagctcgcttggtttcatgccatcaggta 1499

>gb|AF214007.1|AF214007 Brassica napus cytochrome p450-dependent monooxygenase (BNF5H1) mRNA,
            complete cds
          Length = 1880

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 158  gtcgctcatgtcgagctctgttggtttcatgccatcgggta 198
            ||||||||| || |||||  |||||||||||||||| ||||
Sbjct: 1526 gtcgctcatatcaagctcgcttggtttcatgccatcaggta 1486

>ref|NM_119790.2| Arabidopsis thaliana FAH1 (FERULATE-5-HYDROXYLASE 1); ferulate
            5-hydroxylase AT4G36220 (FAH1) mRNA, complete cds
          Length = 1819

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1499 tcatgtcgagctcacttggtttcatcccatcaggta 1464

>emb|AL161589.2|ATCHRIV85 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 85
          Length = 198750

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 163   tcatgtcgagctctgttggtttcatgccatcgggta 198
             |||||||||||||  |||||||||| ||||| ||||
Sbjct: 18972 tcatgtcgagctcacttggtttcatcccatcaggta 19007

>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
             project)
          Length = 94695

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 163   tcatgtcgagctctgttggtttcatgccatcgggta 198
             |||||||||||||  |||||||||| ||||| ||||
Sbjct: 42251 tcatgtcgagctcacttggtttcatcccatcaggta 42286

>emb|AJ295585.1|ATH295585 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            WS-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916

>emb|AJ295584.1|ATH295584 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            MR-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916

>emb|AJ295583.1|ATH295583 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            KAS-1 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916

>emb|AJ295582.1|ATH295582 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            ITA-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916

>emb|AJ295581.1|ATH295581 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CVI-0 ecotype
          Length = 2191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1951 tcatgtcgagctcacttggtttcatcccatcaggta 1916

>emb|AJ295579.1|ATH295579 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            PER-1 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>emb|AJ295578.1|ATH295578 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CHA-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>emb|AJ295569.1|ATH295569 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            COL-2 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>emb|AJ295568.1|ATH295568 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            LA-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>emb|AJ295567.1|ATH295567 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            YO-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>emb|AJ295566.1|ATH295566 Arabidopsis thaliana fah1 gene for ferulate-5-hydroxylase, exons 1-3
            CAN-0 ecotype
          Length = 2196

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1956 tcatgtcgagctcacttggtttcatcccatcaggta 1921

>gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosome 17, complete
            sequence
          Length = 176161

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 78   taatattataaaggacatgt 97
            ||||||||||||||||||||
Sbjct: 8092 taatattataaaggacatgt 8073

>emb|BX936290.16| Zebrafish DNA sequence from clone DKEY-188L8 in linkage group 22,
             complete sequence
          Length = 79381

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 76    attaatattataaaggacat 95
             ||||||||||||||||||||
Sbjct: 48741 attaatattataaaggacat 48722

>gb|AF068574.1|AF068574 Arabidopsis thaliana ferulate-5-hydroxylase (F5H) gene, complete cds
          Length = 8700

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 4442 tcatgtcgagctcacttggtttcatcccatcaggta 4407

>gb|U38416.1|ATU38416 Arabidopsis thaliana ferulate-5-hydroxylase (FAH1) mRNA, complete cds
          Length = 1838

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 163  tcatgtcgagctctgttggtttcatgccatcgggta 198
            |||||||||||||  |||||||||| ||||| ||||
Sbjct: 1499 tcatgtcgagctcacttggtttcatcccatcaggta 1464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,167,986
Number of Sequences: 3902068
Number of extensions: 2167986
Number of successful extensions: 36585
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36547
Number of HSP's gapped (non-prelim): 38
length of query: 342
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 320
effective length of database: 17,147,199,772
effective search space: 5487103927040
effective search space used: 5487103927040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)