ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet27f04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial ... 131 2e-27
2ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA 92 1e-15
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
4dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
5dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
6dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 1e-15
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 90 5e-15
8dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic D... 90 5e-15
9dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 5e-15
10emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 72 1e-09
11gb|AY105105.1| Zea mays PCO122403 mRNA sequence 72 1e-09
12emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 70 5e-09
13gb|AY105151.1| Zea mays PCO072293 mRNA sequence 70 5e-09
14gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochr... 46 0.070
15gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome... 46 0.070
16gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochr... 46 0.070
17gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.070
18gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.070
19gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.070
20gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.070
21gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.070
22gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
23gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.070
24gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.070
25gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.070
26gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.070
27gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
28gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
29gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
30gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
31gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
32gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
33gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
34gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
35gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
36gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
37gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.070
38gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome... 46 0.070
39gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.070
40gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.070
41gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.070
42gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.070
43gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.070
44gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.070
45gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.070
46gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.070
47gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochr... 46 0.070
48gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochr... 46 0.070
49gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.070
50gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.070
51gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.070
52gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.070
53gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.070
54gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.070
55gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.070
56gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.070
57gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.070
58gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.070
59gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.070
60gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.070
61gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cy... 46 0.070
62gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) ... 46 0.070
63gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds... 46 0.070
64gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partia... 46 0.070
65gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, m... 44 0.28
66gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 42 1.1
67gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b... 42 1.1
68gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, R... 42 1.1
69dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.1
70dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.1
71dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.1
72dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.1
73emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-7... 42 1.1
74gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complet... 42 1.1
75ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.3
76emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix tr... 40 4.3
77gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, comple... 40 4.3
78gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 4.3
79gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, comple... 40 4.3
80emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chrom... 40 4.3 
>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence
          Length = 766

 Score =  131 bits (66), Expect = 2e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                       
Query: 254 gggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacga 313
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 636 gggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcgcga 577

                         
Query: 314 gtggttatcaccct 327
           |||||||| |||||
Sbjct: 576 gtggttatgaccct 563
to top
>ref|XM_467846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Minus

                                                                        
Query: 180  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 239
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 240  cagccttctgcagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 299
            ||||   || ||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                  
Query: 300  ccacctcggcacgagtggttat 321
            | |||||||||||||| |||||
Sbjct: 938  ctacctcggcacgagttgttat 917
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                            
Query: 180      actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 239
                |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 31716862 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 31716921

                                                                            
Query: 240      cagccttctgcagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 299
                ||||   || ||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 31716922 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 31716981

                                      
Query: 300      ccacctcggcacgagtggttat 321
                | |||||||||||||| |||||
Sbjct: 31716982 ctacctcggcacgagttgttat 31717003
to top
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                         
Query: 180   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 239
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 12660 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 12719

                                                                         
Query: 240   cagccttctgcagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 299
             ||||   || ||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 12720 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 12779

                                   
Query: 300   ccacctcggcacgagtggttat 321
             | |||||||||||||| |||||
Sbjct: 12780 ctacctcggcacgagttgttat 12801
to top
>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                         
Query: 180   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 239
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 96649 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 96708

                                                                         
Query: 240   cagccttctgcagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 299
             ||||   || ||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 96709 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 96768

                                   
Query: 300   ccacctcggcacgagtggttat 321
             | |||||||||||||| |||||
Sbjct: 96769 ctacctcggcacgagttgttat 96790
to top
>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full
            insert sequence
          Length = 1223

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Minus

                                                                        
Query: 180  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 239
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 240  cagccttctgcagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 299
            ||||   || ||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                  
Query: 300  ccacctcggcacgagtggttat 321
            | |||||||||||||| |||||
Sbjct: 938  ctacctcggcacgagttgttat 917
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                           
Query: 254     gggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacga 313
               ||||| |||||||||||||||||||||||| | |||| |||||| |||||||||||||||
Sbjct: 6264221 gggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctcggcacga 6264162

                    
Query: 314     gtggt 318
               |||||
Sbjct: 6264161 gtggt 6264157
to top
>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0516A04
          Length = 145107

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                         
Query: 254   gggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacga 313
             ||||| |||||||||||||||||||||||| | |||| |||||| |||||||||||||||
Sbjct: 58297 gggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctcggcacga 58238

                  
Query: 314   gtggt 318
             |||||
Sbjct: 58237 gtggt 58233
to top
>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full
           insert sequence
          Length = 1274

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 254 gggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacga 313
           ||||| |||||||||||||||||||||||| | |||| |||||| |||||||||||||||
Sbjct: 970 gggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctcggcacga 911

                
Query: 314 gtggt 318
           |||||
Sbjct: 910 gtggt 906
to top
>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35
          Length = 1257

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                        
Query: 197  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctgcaggggg 256
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   || ||| || 
Sbjct: 1057 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 998

                                                                        
Query: 257  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 316
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 997  acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 938

                
Query: 317  gtta 320
            ||||
Sbjct: 937  gtta 934
to top
>gb|AY105105.1| Zea mays PCO122403 mRNA sequence
          Length = 1401

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                        
Query: 197  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctgcaggggg 256
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   || ||| || 
Sbjct: 1151 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 1092

                                                                        
Query: 257  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 316
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 1091 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 1032

                
Query: 317  gtta 320
            ||||
Sbjct: 1031 gtta 1028
to top
>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33
          Length = 1277

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 316
           ||||||||||||||||||||||||||||| ||||  || ||||||||||| || || |||
Sbjct: 950 acgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctcagcgcgggtg 891

                      
Query: 317 gttatcaccct 327
           || || |||||
Sbjct: 890 gtgatgaccct 880
to top
>gb|AY105151.1| Zea mays PCO072293 mRNA sequence
          Length = 1369

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 316
           ||||||||||||||||||||||||||||| ||||  || ||||||||||| || || |||
Sbjct: 967 acgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctcagcgcgggtg 908

                      
Query: 317 gttatcaccct 327
           || || |||||
Sbjct: 907 gtgatgaccct 897
to top
>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 129 atctcttattcctccatcaaaca 151
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 465

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 129 atctcttattcctccatcaaac 150
           ||||||||||||||||||||||
Sbjct: 185 atctcttattcctccatcaaac 206
to top
>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 252    gggggacgctgttcctcttct 272
              |||||||||||||||||||||
Sbjct: 157842 gggggacgctgttcctcttct 157822
to top
>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene,
           partial cds; mitochondrial
          Length = 427

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 131 ctcttattcctccatcaaaca 151
           |||||||||||||||||||||
Sbjct: 144 ctcttattcctccatcaaaca 164
to top
>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete
             Sequence, complete sequence
          Length = 171061

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 252   gggggacgctgttcctcttct 272
             |||||||||||||||||||||
Sbjct: 36422 gggggacgctgttcctcttct 36402
to top
>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230026C11 product:hypothetical
            Beta tubulin containing protein, full insert sequence
          Length = 1819

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 252  gggggacgctgttcctcttct 272
            |||||||||||||||||||||
Sbjct: 1159 gggggacgctgttcctcttct 1139
to top
>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34324
          Length = 629

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 131 ctcttattcctccatcaaaca 151
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476
to top
>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34130
          Length = 625

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 131 ctcttattcctccatcaaaca 151
           |||||||||||||||||||||
Sbjct: 452 ctcttattcctccatcaaaca 472
to top
>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE21982
          Length = 629

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 131 ctcttattcctccatcaaaca 151
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476
to top
>emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-799P8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 174788

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 145   tcaaacataaggtagatcaaacata 169
             |||||||| ||||||||||||||||
Sbjct: 56048 tcaaacattaggtagatcaaacata 56024
to top
>gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complete sequence
          Length = 206831

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 14     tatttctgcagcttaaatgacgaaa 38
              ||||| |||||||||||||||||||
Sbjct: 165234 tatttatgcagcttaaatgacgaaa 165210
to top
>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain
            containing 1 (LOC575181), mRNA
          Length = 7881

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 285  ttatcaccttcaggtccacc 304
            ||||||||||||||||||||
Sbjct: 5800 ttatcaccttcaggtccacc 5781
to top
>emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix transcription factor (foxd3a
           gene)
          Length = 3240

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 96  aaacaacacactcgccagttttat 119
           |||||||||||||||| |||||||
Sbjct: 478 aaacaacacactcgcctgttttat 455
to top
>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence
          Length = 116976

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tctgctcccagaagtgcaag 201
             ||||||||||||||||||||
Sbjct: 94606 tctgctcccagaagtgcaag 94587
to top
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 235     ggaaacagccttctgcaggg 254
               ||||||||||||||||||||
Sbjct: 2552474 ggaaacagccttctgcaggg 2552455
to top
>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence
          Length = 38997

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   tctcttattcctccatcaaa 149
             ||||||||||||||||||||
Sbjct: 21072 tctcttattcctccatcaaa 21091
to top
>emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chromosome 4, complete
             sequence
          Length = 110623

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 226   tgtgtccttggaaacagccttctg 249
             ||||||||||| ||||||||||||
Sbjct: 65004 tgtgtccttgggaacagccttctg 64981


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,125,425
Number of Sequences: 3902068
Number of extensions: 3125425
Number of successful extensions: 82840
Number of sequences better than 10.0: 80
Number of HSP's better than 10.0 without gapping: 80
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82717
Number of HSP's gapped (non-prelim): 118
length of query: 328
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 306
effective length of database: 17,147,199,772
effective search space: 5247043130232
effective search space used: 5247043130232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top