ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet26e08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC087639.7| Homo sapiens chromosome 15, clone RP11-696L21, co... 44 0.33
2emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in... 42 1.3
3gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.3
4emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 m... 40 5.1
5emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 40 5.1
6emb|AL133493.3|HS53I10 Homo sapiens chromosome 21sequence from B... 40 5.1
7emb|BX322561.1|HSE12310 Homo sapiens chromosome 21 from PAC RPCI... 40 5.1
8emb|AL591366.15| Mouse DNA sequence from clone RP23-80N1 on chro... 40 5.1

>gb|AC087639.7| Homo sapiens chromosome 15, clone RP11-696L21, complete sequence
          Length = 190015

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 36    aagatcaaaacacgaaatttagccat 61
             ||||||||||||| ||||||||||||
Sbjct: 44715 aagatcaaaacacaaaatttagccat 44690



to top

>emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in linkage group 18,
             complete sequence
          Length = 152387

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 275   gcacacacccactaacctaac 295
             |||||||||||||||||||||
Sbjct: 31229 gcacacacccactaacctaac 31209



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 352    ccatgcacatgccacgtacgg 372
              |||||||||||||||||||||
Sbjct: 802361 ccatgcacatgccacgtacgg 802381



to top

>emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 map 22q22.3, complete
              sequence
          Length = 185080

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     ttgatttacttaagaaaaag 38
              ||||||||||||||||||||
Sbjct: 144552 ttgatttacttaagaaaaag 144571



to top

>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     ttgatttacttaagaaaaag 38
              ||||||||||||||||||||
Sbjct: 220071 ttgatttacttaagaaaaag 220090



to top

>emb|AL133493.3|HS53I10 Homo sapiens chromosome 21sequence from BAC GS1-53I10, complete
             sequence
          Length = 223201

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ttgatttacttaagaaaaag 38
             ||||||||||||||||||||
Sbjct: 19042 ttgatttacttaagaaaaag 19061



to top

>emb|BX322561.1|HSE12310 Homo sapiens chromosome 21 from PAC RPCI-1 RP1-310E12 map 21q22.3
             region D21S171-LA161, complete sequence
          Length = 131563

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ttgatttacttaagaaaaag 38
             ||||||||||||||||||||
Sbjct: 80369 ttgatttacttaagaaaaag 80388



to top

>emb|AL591366.15| Mouse DNA sequence from clone RP23-80N1 on chromosome 11, complete
             sequence
          Length = 117612

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   gtgccactgccatgccatgc 208
             ||||||||||||||||||||
Sbjct: 21636 gtgccactgccatgccatgc 21617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,660,571
Number of Sequences: 3902068
Number of extensions: 2660571
Number of successful extensions: 42993
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42978
Number of HSP's gapped (non-prelim): 15
length of query: 385
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 363
effective length of database: 17,147,199,772
effective search space: 6224433517236
effective search space used: 6224433517236
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top