ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet24b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC091930.3| Homo sapiens chromosome 5 clone RP11-2A20, comple... 40 2.0
2gb|AC150392.2| Branchiostoma floridae clone CH302-12P3, complete... 38 7.9
3gb|AC165240.6| Mus musculus chromosome 5, clone RP24-174P7, comp... 38 7.9
4gb|DQ480499.1| Canis familiaris isolate 1 breed Siberian Husky m... 38 7.9
5gb|DQ480498.1| Canis familiaris isolate 1 breed Miniature Schnau... 38 7.9
6gb|DQ480497.1| Canis familiaris isolate 1 breed West Highland Wh... 38 7.9
7gb|DQ480496.1| Canis familiaris isolate 1 breed Irish Soft Coate... 38 7.9
8gb|DQ480495.1| Canis familiaris isolate 1 breed Cocker Spaniel m... 38 7.9
9gb|DQ480491.1| Canis familiaris isolate 1 breed Irish Setter mit... 38 7.9
10gb|AC112929.12| Mus musculus chromosome 14, clone RP23-432A7, co... 38 7.9
11gb|AC129079.5| Mus musculus BAC clone RP24-126J17 from chromosom... 38 7.9
12emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024... 38 7.9
13emb|AL035668.15|HS859D4 Human DNA sequence from clone RP5-859D4 ... 38 7.9
14gb|AY656755.1| Canis familiaris isolate 1 breed Sapsaree mitocho... 38 7.9
15gb|AY656754.1| Canis familiaris isolate 1 breed Chinese Crested ... 38 7.9
16gb|AY656753.1| Canis familiaris isolate 2 breed Irish Setter mit... 38 7.9
17gb|AY656751.1| Canis familiaris isolate 1 breed Gordon Setter mi... 38 7.9
18gb|AY656750.1| Canis familiaris isolate 1 breed Leonberger mitoc... 38 7.9
19gb|AY656749.1| Canis familiaris isolate 2 breed Saint Bernard mi... 38 7.9
20gb|AY656748.1| Canis familiaris isolate 1 breed Airedale Terrier... 38 7.9
21gb|AY656747.1| Canis familiaris isolate 1 breed Welsh Springer S... 38 7.9
22gb|AY656746.1| Canis familiaris isolate 1 breed Standard Schnauz... 38 7.9
23gb|AY656744.1| Canis familiaris isolate 1 breed English Springer... 38 7.9
24gb|AY656742.1| Canis familiaris isolate 1 breed Old English Shee... 38 7.9
25gb|AY656741.1| Canis familiaris isolate 1 breed Irish Setter mit... 38 7.9
26gb|AY656738.1| Canis familiaris isolate 1 breed Jack Russell Ter... 38 7.9
27gb|AY656737.1| Canis familiaris isolate 1 breed Basenji mitochon... 38 7.9
28emb|AL662858.15| Mouse DNA sequence from clone RP23-166O21 on ch... 38 7.9
29emb|AL662909.9| Mouse DNA sequence from clone RP23-189I13 on chr... 38 7.9
30emb|BX649301.3| Zebrafish DNA sequence from clone DKEY-208D13 in... 38 7.9
31gb|AC023194.9| Homo sapiens, clone RP11-216N21, complete sequence 38 7.9
32dbj|AK015558.1| Mus musculus adult male testis cDNA, RIKEN full-... 38 7.9
33dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 38 7.9
34gb|U96639.2|CFU96639 Canis familiaris mitochondrion, complete ge... 38 7.9
35dbj|AP003765.5| Oryza sativa (japonica cultivar-group) genomic D... 38 7.9
36dbj|AP004671.2| Oryza sativa (japonica cultivar-group) genomic D... 38 7.9
37gb|AC154598.2| Mus musculus BAC clone RP23-356P6 from 14, comple... 38 7.9
38gb|AC114624.24| Mus musculus chromosome 5, clone RP24-106K21, co... 38 7.9
39emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chro... 38 7.9 
>gb|AC091930.3| Homo sapiens chromosome 5 clone RP11-2A20, complete sequence
          Length = 167826

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 71    aaatgtcatttcaaactggcattg 94
             ||||||||||| ||||||||||||
Sbjct: 83090 aaatgtcatttaaaactggcattg 83113
to top
>gb|AC150392.2| Branchiostoma floridae clone CH302-12P3, complete sequence
          Length = 180902

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   caagactcacacagcaaca 134
             |||||||||||||||||||
Sbjct: 40838 caagactcacacagcaaca 40856
to top
>gb|AC165240.6| Mus musculus chromosome 5, clone RP24-174P7, complete sequence
          Length = 196437

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    tatcacatggatttagcag 66
             |||||||||||||||||||
Sbjct: 38504 tatcacatggatttagcag 38522
to top
>gb|DQ480499.1| Canis familiaris isolate 1 breed Siberian Husky mitochondrion, complete
             genome
          Length = 16730

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|DQ480498.1| Canis familiaris isolate 1 breed Miniature Schnauzer mitochondrion,
             complete genome
          Length = 16732

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|DQ480497.1| Canis familiaris isolate 1 breed West Highland White Terrier
             mitochondrion, complete genome
          Length = 16730

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|DQ480496.1| Canis familiaris isolate 1 breed Irish Soft Coated Wheaten Terrier
             mitochondrion, complete genome
          Length = 16729

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11964 tcatttcaaactggcattg 11982
to top
>gb|DQ480495.1| Canis familiaris isolate 1 breed Cocker Spaniel mitochondrion, complete
             genome
          Length = 16730

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|DQ480491.1| Canis familiaris isolate 1 breed Irish Setter mitochondrion, complete
             genome
          Length = 16730

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AC112929.12| Mus musculus chromosome 14, clone RP23-432A7, complete sequence
          Length = 181674

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    aaactggcattgtcatgtc 101
             |||||||||||||||||||
Sbjct: 41929 aaactggcattgtcatgtc 41911
to top
>gb|AC129079.5| Mus musculus BAC clone RP24-126J17 from chromosome 7, complete sequence
          Length = 180663

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   caagactcacacagcaaca 134
             |||||||||||||||||||
Sbjct: 88148 caagactcacacagcaaca 88166
to top
>emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024N4 on chromosome 1p32.1-33
             Contains two novel genes, a novel pseudogene, a novel gene
             (LOC200010), a novel gene similar to connexin and one CpG
             island, complete sequence
          Length = 181678

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   caagactcacacagcaaca 134
             |||||||||||||||||||
Sbjct: 95011 caagactcacacagcaaca 95029
to top
>emb|AL035668.15|HS859D4 Human DNA sequence from clone RP5-859D4 on chromosome 20p12.1-13 Contains
              the BMP2 gene for bone morphogenetic protein 2, a novel
              gene and a CpG island, complete sequence
          Length = 173308

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     acaaatgtcatttcaaact 87
              |||||||||||||||||||
Sbjct: 103094 acaaatgtcatttcaaact 103112
to top
>gb|AY656755.1| Canis familiaris isolate 1 breed Sapsaree mitochondrion, complete
             genome
          Length = 16740

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656754.1| Canis familiaris isolate 1 breed Chinese Crested mitochondrion,
             complete genome
          Length = 16680

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656753.1| Canis familiaris isolate 2 breed Irish Setter mitochondrion, complete
             genome
          Length = 16617

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656751.1| Canis familiaris isolate 1 breed Gordon Setter mitochondrion, complete
             genome
          Length = 16642

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656750.1| Canis familiaris isolate 1 breed Leonberger mitochondrion, complete
             genome
          Length = 16700

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656749.1| Canis familiaris isolate 2 breed Saint Bernard mitochondrion, complete
             genome
          Length = 16700

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656748.1| Canis familiaris isolate 1 breed Airedale Terrier mitochondrion,
             complete genome
          Length = 16702

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656747.1| Canis familiaris isolate 1 breed Welsh Springer Spaniel mitochondrion,
             complete genome
          Length = 16770

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656746.1| Canis familiaris isolate 1 breed Standard Schnauzer mitochondrion,
             complete genome
          Length = 16741

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656744.1| Canis familiaris isolate 1 breed English Springer Spaniel
             mitochondrion, complete genome
          Length = 16730

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656742.1| Canis familiaris isolate 1 breed Old English Sheepdog mitochondrion,
             complete genome
          Length = 16760

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656741.1| Canis familiaris isolate 1 breed Irish Setter mitochondrion, complete
             genome
          Length = 16710

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656738.1| Canis familiaris isolate 1 breed Jack Russell Terrier mitochondrion,
             complete genome
          Length = 16712

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11965 tcatttcaaactggcattg 11983
to top
>gb|AY656737.1| Canis familiaris isolate 1 breed Basenji mitochondrion, complete genome
          Length = 16761

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11966 tcatttcaaactggcattg 11984
to top
>emb|AL662858.15| Mouse DNA sequence from clone RP23-166O21 on chromosome 11, complete
              sequence
          Length = 195612

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     caacaaatgtcatttcaaa 85
              |||||||||||||||||||
Sbjct: 142644 caacaaatgtcatttcaaa 142662
to top
>emb|AL662909.9| Mouse DNA sequence from clone RP23-189I13 on chromosome 11 Contains the
              5' end of the Odz2 gene for odd Oz/ten-m homolog 2
              (Drosophila) and a CpG island, complete sequence
          Length = 201564

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     catggatttagcagcaaca 71
              |||||||||||||||||||
Sbjct: 110884 catggatttagcagcaaca 110902
to top
>emb|BX649301.3| Zebrafish DNA sequence from clone DKEY-208D13 in linkage group 10,
              complete sequence
          Length = 149467

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     ctggcattgtcatgtccgt 104
              |||||||||||||||||||
Sbjct: 125446 ctggcattgtcatgtccgt 125464
to top
>gb|AC023194.9| Homo sapiens, clone RP11-216N21, complete sequence
          Length = 175834

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 62    agcagcaacaaatgtcatttcaa 84
             |||||||||||| ||||||||||
Sbjct: 38507 agcagcaacaaaagtcatttcaa 38485
to top
>dbj|AK015558.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4930472D12 product:unclassifiable, full
            insert sequence
          Length = 1431

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 64   cagcaacaaatgtcatttc 82
            |||||||||||||||||||
Sbjct: 989  cagcaacaaatgtcatttc 1007
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 68       aacaaatgtcatttcaaac 86
                |||||||||||||||||||
Sbjct: 26654571 aacaaatgtcatttcaaac 26654589
to top
>gb|U96639.2|CFU96639 Canis familiaris mitochondrion, complete genome
          Length = 16727

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tcatttcaaactggcattg 94
             |||||||||||||||||||
Sbjct: 11962 tcatttcaaactggcattg 11980
to top
>dbj|AP003765.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1003_C06
          Length = 143168

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 68   aacaaatgtcatttcaaac 86
            |||||||||||||||||||
Sbjct: 1428 aacaaatgtcatttcaaac 1446
to top
>dbj|AP004671.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0524G08
          Length = 146690

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    aacaaatgtcatttcaaac 86
             |||||||||||||||||||
Sbjct: 72175 aacaaatgtcatttcaaac 72193
to top
>gb|AC154598.2| Mus musculus BAC clone RP23-356P6 from 14, complete sequence
          Length = 206646

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 83     aaactggcattgtcatgtc 101
              |||||||||||||||||||
Sbjct: 196640 aaactggcattgtcatgtc 196622
to top
>gb|AC114624.24| Mus musculus chromosome 5, clone RP24-106K21, complete sequence
          Length = 197077

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    tatcacatggatttagcag 66
             |||||||||||||||||||
Sbjct: 91771 tatcacatggatttagcag 91753
to top
>emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chromosome X, complete
             sequence
          Length = 200224

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    agcagcaacaaatgtcatt 80
             |||||||||||||||||||
Sbjct: 87299 agcagcaacaaatgtcatt 87317


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,258,193
Number of Sequences: 3902068
Number of extensions: 1258193
Number of successful extensions: 81138
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81066
Number of HSP's gapped (non-prelim): 72
length of query: 164
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 142
effective length of database: 17,147,199,772
effective search space: 2434902367624
effective search space used: 2434902367624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top