| Clone Name | rbaet22f10 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 23604331 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 23604272 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23604271 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 23604226 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 30025136 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 30025077 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 30025076 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 30025032
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 67030 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 66971 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 66970 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 66925
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 859 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 800 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 799 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 754
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 858 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 799 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 798 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 753
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 1288 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 1229 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1228 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 1183
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 178 bits (90), Expect = 7e-42 Identities = 102/106 (96%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||| Sbjct: 388 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 329 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 328 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 283
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 1247 tcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1188 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1187 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 1144
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 10793782 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 10793723 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 10793722 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 10793679
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 17505 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 17446 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17445 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 17402
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 130400 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 130341 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 130340 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 130297
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 850 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 791 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 790 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 747
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 857 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 798 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 797 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 754
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 174 bits (88), Expect = 1e-40 Identities = 100/104 (96%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||| Sbjct: 836 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 777 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 776 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 733
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 172 bits (87), Expect = 4e-40 Identities = 102/107 (95%) Strand = Plus / Minus Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273 |||| |||||||||| ||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808 Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 807 ggagaggtggtcggcgaggttctcgagggggcccttgccggtgacga 761
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 170 bits (86), Expect = 2e-39 Identities = 98/102 (96%) Strand = Plus / Minus Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278 |||||||||| ||||||||||||||| | |||||||||||||||||||| |||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725 Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 683
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 170 bits (86), Expect = 2e-39 Identities = 101/106 (95%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||| Sbjct: 2723 gctcacttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcg 2664 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 2663 gtgaggtggtcggcgaggttctcgatggggcccttgccggtgacga 2618
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 161 bits (81), Expect = 2e-36 Identities = 99/105 (94%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 |||| |||||||| ||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 872 ctcatttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 813 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||||||||||||| |||||| ||||||||||||| Sbjct: 812 cgaggtggtcggcgaggttctcgatggggcctttgccggtgacga 768
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 145 bits (73), Expect = 1e-31 Identities = 97/105 (92%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| || ||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 811 ctcacttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcgg 752 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 751 cgaggtggtcggcgaggttctcgagcgggcccttgccggtgacga 707
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 145 bits (73), Expect = 1e-31 Identities = 97/105 (92%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 1196 ctcacttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 1137 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||| || | |||||||||||||||||| |||||||||| Sbjct: 1136 cgagatggtccgccaagttctcgagggggcccttcccggtgacga 1092
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 143 bits (72), Expect = 4e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||||| ||||||||||||||| ||| |||||||| Sbjct: 1534 tcacttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || ||||||||| |||||||||| |||||||||||||||||||| Sbjct: 1474 gatgtggtcggccaggttctcgatggggcccttgccggtgacga 1431
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Plus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 13875 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 13934 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 13935 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 13979
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 21126 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 21067 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 21066 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 21022
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 776
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 776
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 778
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 137 bits (69), Expect = 2e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| |||||||| || || |||||||||||||||| Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 778
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 135 bits (68), Expect = 1e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||| Sbjct: 798 tcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 739 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||| |||||||| || || |||||||||||||||| Sbjct: 738 gaggtggtcggccaggttctccagtggccccttgccggtgacga 695
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 78970 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 79029 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 79030 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 79075
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 21808846 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21808787 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 21808786 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 21808741 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcggcgaggtggtcggcgag 291 |||||||||||||||||||| Sbjct: 21166198 tcggcgaggtggtcggcgag 21166179
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 21801875 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21801816 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 21801815 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 21801770 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcggcgaggtggtcggcgag 291 |||||||||||||||||||| Sbjct: 21159227 tcggcgaggtggtcggcgag 21159208
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 845 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 786 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 785 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 740
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 420 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 361 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 360 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 315
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | ||||||||||||||| ||| |||||| Sbjct: 834 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 775 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 774 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 729
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 129 bits (65), Expect = 6e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | | |||||| |||||||||||||| |||||||| |||||||||| Sbjct: 1751 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 1707
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 129 bits (65), Expect = 6e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 863 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 804 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | | |||||| |||||||||||||| |||||||| |||||||||| Sbjct: 803 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 759
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 129 bits (65), Expect = 6e-27 Identities = 98/109 (89%) Strand = Plus / Minus Query: 212 tgagctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccggg 271 |||||| | |||||||| ||||||||||||||| | ||||| |||||||||||||| ||| Sbjct: 1685 tgagcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactggg 1626 Query: 272 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || |||| |||||| |||||||||||||| ||||||||||||||||||| Sbjct: 1625 tcagcgatgtggtcagcgaggttctcgagcgggcccttgccggtgacga 1577 Score = 42.1 bits (21), Expect = 1.1 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 68 ttagtgtacacacaccaactcatcatctcgact 100 |||||||||| || ||||||||||||||||||| Sbjct: 1833 ttagtgtaca-acgccaactcatcatctcgact 1802
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 129 bits (65), Expect = 6e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 865 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 806 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||| |||||||| | |||||||||||||||||||| Sbjct: 805 cgaggtggtcgagcaggttctccaaggggcccttgccggtgacga 761
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 129 bits (65), Expect = 6e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | | |||||| |||||||||||||| |||||||| |||||||||| Sbjct: 1751 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 1707
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 123 bits (62), Expect = 4e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 231 cgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcga 290 |||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| | Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636 Query: 291 ggttctcgagggggcccttgccggtgacga 320 |||||||||||| ||||||||||| |||| Sbjct: 635 agttctcgaggggtcccttgccggtcacga 606
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 115 bits (58), Expect = 9e-23 Identities = 88/98 (89%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||| ||||| || ||||| |||||||||||||| |||||||||| | Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318 ||||| ||||||||||| || ||||||||||||||||| Sbjct: 755 tggtcagcgaggttctcaagagggcccttgccggtgac 718
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 115 bits (58), Expect = 9e-23 Identities = 91/102 (89%) Strand = Plus / Minus Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278 |||||||||| ||||||||||||||||| |||||||| |||||||| || |||||||||| Sbjct: 973 acttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914 Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||| || | |||||||||||| ||||| |||||||||| Sbjct: 913 gatggtccgccaagttctcgaggggccccttcccggtgacga 872
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 115 bits (58), Expect = 9e-23 Identities = 91/102 (89%) Strand = Plus / Minus Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278 |||||||||| || |||||||||||||| ||||| || ||||||||||| |||||||||| Sbjct: 808 acttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 749 Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||||||||| || ||||||||||| ||||||| Sbjct: 748 tgtggtcagcgaggttctcaagtgggcccttgcccgtgacga 707
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 115 bits (58), Expect = 9e-23 Identities = 81/89 (91%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| ||||||||||||||| |||||||||||||||||||||| |||||||| ||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330 Query: 284 tcggcgaggttctcgagggggcccttgcc 312 ||||||||||| |||||||| || ||||| Sbjct: 329 tcggcgaggttntcgaggggtcctttgcc 301
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 113 bits (57), Expect = 4e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||||||||| || |||||||||||| | ||||| |||||||||||||| ||||||| Sbjct: 841 ctcacttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 782 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||| | || |||||| || || |||||||||||||||| Sbjct: 781 cgaggtggtctgtgatgttctccagtggccccttgccggtgacga 737
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 111 bits (56), Expect = 1e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||| | |||||||||||||||||||| ||||| Sbjct: 852 gctcactttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtca 793 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 || |||||||||||||||||||| | || ||||| |||||||| Sbjct: 792 gcaaggtggtcggcgaggttctccaatggtccctttccggtgac 749
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 111 bits (56), Expect = 1e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||| |||||| | ||||||||||||||| ||| |||||||||| | Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||||||||| |||||||||||||||||||| Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacga 725
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 111 bits (56), Expect = 1e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||| |||||| | ||||||||||||||| ||| |||||||||| | Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||||||||| |||||||||||||||||||| Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgacga 373
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 111 bits (56), Expect = 1e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| ||||||||||||||| | | ||||||||||||| ||| ||||||| Sbjct: 824 tcacttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggt 765 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || ||||||| ||||||||||| |||||||||||||||||||| Sbjct: 764 gacgtggtcgaagaggttctcgatggggcccttgccggtgacga 721
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 2543 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 2588
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 2543 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 2588
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 795 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 750
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 813 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 754 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 753 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 708
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 740 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 695
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 795 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 750
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 93201 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 93260 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 93261 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 93306 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 96106 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 96047 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 96046 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 96004
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 81001 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 80942 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 80941 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 80896 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Plus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 78096 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 78155 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 78156 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 78198
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 740 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 695
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 171 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 112 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 111 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 66
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 832 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 773 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 772 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 727
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 835 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 776 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 775 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 730
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 84 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 143 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 144 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 189
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 107 bits (54), Expect = 2e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||| Sbjct: 1100 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 1041 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 1040 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 995
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 105 bits (53), Expect = 9e-20 Identities = 74/81 (91%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||| || Sbjct: 828 tcacttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagc 769 Query: 277 gaggtggtcggcgaggttctc 297 |||||||| ||||||||||| Sbjct: 768 aaggtggtctgcgaggttctc 748
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 103 bits (52), Expect = 3e-19 Identities = 91/104 (87%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||| || ||||||||||| ||||||||||| ||||||||||| |||||||| Sbjct: 472 tcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||| | |||||| | || ||||||||||| |||| Sbjct: 412 gaggtgatcggccaagttctccaatggccccttgccggtcacga 369
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 103 bits (52), Expect = 3e-19 Identities = 91/104 (87%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||||| Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 738 caaatggtcggcgaggttctccaaaggtccctttccggtgacga 695
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 103 bits (52), Expect = 3e-19 Identities = 91/104 (87%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| |||||||| Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 738 caaatggtcggcgaggttctccaaaggtccctttccggtgacga 695
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 103 bits (52), Expect = 3e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| ||||||||||||||| ||||||||||||||||| ||| ||||| |||| Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||||||||| ||| |||||||||||||||| Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacga 475
>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding protein mRNA, partial cds Length = 191 Score = 103 bits (52), Expect = 3e-19 Identities = 87/100 (87%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||| |||||| | ||||||||||||||| ||| ||||||| | | Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacg 47 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||| ||||||||||| |||||||||||||||||||| Sbjct: 46 tggtcgaagaggttctcgatggggcccttgccggtgacga 7
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 99.6 bits (50), Expect = 5e-18 Identities = 92/106 (86%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| || || ||||||||| | ||||||||||||||| ||| |||||| Sbjct: 841 gctcacttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcg 782 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||||||| | |||||||| |||||||||||||||||||| Sbjct: 781 gcgacgtggtcgaaaaagttctcgatggggcccttgccggtgacga 736
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 97.6 bits (49), Expect = 2e-17 Identities = 85/97 (87%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 |||| ||||| || || |||||||||||| | |||||||||||||||||||| ||||| | Sbjct: 839 ctcatttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcag 780 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgcc 312 ||||||| |||||||||||||| ||||| || ||||| Sbjct: 779 cgaggtgatcggcgaggttctctaggggtcctttgcc 743
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 93.7 bits (47), Expect = 3e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 855 gctcactttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtca 796 Query: 275 gcgaggtggtcggcgaggttctc 297 || || ||||| || |||||||| Sbjct: 795 gcaagatggtcagcaaggttctc 773
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 91.7 bits (46), Expect = 1e-15 Identities = 88/102 (86%) Strand = Plus / Minus Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278 |||| ||||| ||||||||||||||||| ||||| ||||||||||| || |||||||| | Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaa 769 Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||||||| | || ||||| |||||||||| Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgacga 727
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 91.7 bits (46), Expect = 1e-15 Identities = 91/106 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||||||||||||| | ||||| |||||||||| ||| |||||| Sbjct: 842 gctcactttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcg 783 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 782 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 737
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 91.7 bits (46), Expect = 1e-15 Identities = 92/106 (86%), Gaps = 1/106 (0%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| ||||| ||||||||||| ||||| |||||||||||||| |||||| Sbjct: 834 gctcactttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcg 776 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 775 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 730
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 91.7 bits (46), Expect = 1e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 233 aagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgagg 292 |||||||||||| | |||||||||||||||||||| |||||||| ||||| ||||||||| Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcggcgagg 776 Query: 293 ttctcgagggggcccttgccggtgac 318 ||||| | || |||||||| ||||| Sbjct: 775 ttctccaaaggtcccttgccagtgac 750
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 91.7 bits (46), Expect = 1e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| ||||||||||||||| | ||||||||||||||||| || ||||| || ||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318 || || ||||||||||||| ||| || || |||||||| Sbjct: 809 tgatcagcgaggttctcgatgggtcctttcccggtgac 772
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 87.7 bits (44), Expect = 2e-14 Identities = 90/106 (84%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 || ||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || Sbjct: 634 gcwcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatca 575 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || | ||||||||||||||||| | || ||||| |||||||||| Sbjct: 574 gccaaatggtcggcgaggttctccaatggtccctttccggtgacga 529
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 87.7 bits (44), Expect = 2e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||||||||| | ||||||||||||||| | || |||||||| ||| Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || ||||||||||||| ||| || || |||||||||| Sbjct: 824 tgatcagcgaggttctcgatgggtcctttcccggtgacga 785
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 87.7 bits (44), Expect = 2e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| |||||||||||||| | ||||||||||||||| | || |||||||| ||| Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || ||||||||||||| ||| || || |||||||||| Sbjct: 1902 tgatcagcgaggttctcgatgggtcctttcccggtgacga 1863
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 87.7 bits (44), Expect = 2e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 ||||| || |||||||||||||| | ||||||||||||||||| || |||||||| ||| Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggggtcggccagg 226 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || ||||||||||||| ||| || || |||||||||| Sbjct: 225 tgatcagcgaggttctcgatgggtcctttcccggtgacga 186
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 87.7 bits (44), Expect = 2e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||||||||| ||||||||||||||| | |||||||| ||||||||||| ||||| Sbjct: 825 gctcacttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtcc 766 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 || ||||| || || |||||||| | || ||||| |||||||| Sbjct: 765 gcaaggtgatcagcaaggttctccaatggacccttaccggtgac 722
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 83.8 bits (42), Expect = 3e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 |||||||| ||||||||||||||| | ||||||||||||||||| || ||||| || ||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318 || || | ||||||||||| ||| || || |||||||| Sbjct: 800 tgatcagtgaggttctcgatgggtcctttcccggtgac 763
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 83.8 bits (42), Expect = 3e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| || ||||||||||||||||| || |||||||| Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggc 292 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | ||||||||| |||||||| | || ||||| |||||||| Sbjct: 291 aatgtggtcggcaaggttctccaatggaccctttccggtgac 250
>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll a/b-binding protein of photosystem II, complete cds Length = 935 Score = 83.8 bits (42), Expect = 3e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||| ||||| |||||||||||||||||||||| ||||| Sbjct: 814 gctcacttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtct 755 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || |||||||| | |||||| ||||| || || ||||| |||| Sbjct: 754 gccagatggtcggccaagttctccaggggaccttttccggtaacga 709
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 756 tccaaggggcccttgccggtgacga 732
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacga 756
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacga 756
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 782 tccaaggggcccttgccggtgacga 758
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 787 tccaaggggcccttgccggtgacga 763
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 820 tccaaggggcccttgccggtgacga 796
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 22434793 tccaaggggcccttgccggtgacga 22434769
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 81.8 bits (41), Expect = 1e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| ||||||||||||||| | |||||||| |||||||| || |||||||| ||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833 Query: 284 tcggcgaggttctcgagggggcccttgcc 312 ||||| |||||||||| ||| || ||||| Sbjct: 832 tcggcaaggttctcgatgggtcctttgcc 804
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 95860 tccaaggggcccttgccggtgacga 95836
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 81.8 bits (41), Expect = 1e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| ||||| ||||||||| | |||||||| |||||||| || |||||||| ||||| Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826 Query: 284 tcggcgaggttctcgagggggcccttgcc 312 |||||||||||||||| ||| || ||||| Sbjct: 825 tcggcgaggttctcgatgggtcctttgcc 797
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 756 tccaaggggcccttgccggtgacga 732
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacga 756
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacga 756
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacga 761
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 781 tccaaggggcccttgccggtgacga 757
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||| | |||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788 Query: 296 tcgagggggcccttgccggtgacga 320 || | |||||||||||||||||||| Sbjct: 787 tccaaggggcccttgccggtgacga 763
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 81.8 bits (41), Expect = 1e-12 Identities = 89/105 (84%) Strand = Plus / Minus Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273 ||||||||| |||||||| ||||| ||||| || ||||| ||||||||||| || ||||| Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783 Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 || ||||||||||| |||||||| | || ||||| |||||||| Sbjct: 782 agcaaggtggtcggcaaggttctccaatggaccctttccggtgac 738
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || || Sbjct: 2376 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagc 2317 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||||||| ||||| | || ||||| |||||||||| Sbjct: 2316 caaatggtcggcgagattctccaacggtccctttccggtgacga 2273
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || || Sbjct: 2377 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagc 2318 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||||||| ||||| | || ||||| |||||||||| Sbjct: 2317 caaatggtcggcgagattctccaacggtccctttccggtgacga 2274
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein Length = 1025 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| ||| ||||||||||||||| |||||||| || Sbjct: 859 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 800 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||| || |||||||| | || ||||| |||||||||| Sbjct: 799 aaggtggtcagcaaggttctccaatggaccctttccggtgacga 756
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| |||||||||||||| | |||||||||||||||||||| || | Sbjct: 1044 gctcactttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtcca 985 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 || ||||| |||||||||||||| | || ||||| |||||||| Sbjct: 984 gcaaggtgatcggcgaggttctccaatggaccctttccggtgac 941
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 ||||||||||||||||||||| |||||| ||||||| ||||||||| || || || || Sbjct: 849 tcacttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagc 790 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||| | |||||||| | ||||||||||||||||||| Sbjct: 789 aatgtggtcgactaggttctcaactgggcccttgccggtgacga 746
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds Length = 1815 Score = 79.8 bits (40), Expect = 5e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| ||| ||||||||||||||| |||||||| || Sbjct: 1779 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 1720 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||| || |||||||| | || ||||| |||||||||| Sbjct: 1719 aaggtggtcagcaaggttctccaatggaccctttccggtgacga 1676
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 75.8 bits (38), Expect = 8e-11 Identities = 84/98 (85%), Gaps = 1/98 (1%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaag-cccaggcgttgttgttgaccgggtcggcgaggtg 282 |||||||||||||| ||||| |||| |||| ||||||||||| || ||||| || ||||| Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625 Query: 283 gtcggcgaggttctcgagggggcccttgccggtgacga 320 ||| || |||||||| | |||||||| |||||||||| Sbjct: 624 gtcagcaaggttctccaacgggccctttccggtgacga 587
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 73.8 bits (37), Expect = 3e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 254 gcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgccg 313 |||||||||||||| |||||||| | ||||||||| |||||||| | |||||||||||| Sbjct: 759 gcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgccg 700 Query: 314 gtgac 318 ||||| Sbjct: 699 gtgac 695
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end Length = 351 Score = 73.8 bits (37), Expect = 3e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| |||||||||||||||||||| || ||||| || Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgc 292 Query: 277 gaggtggtcggcgaggttctc 297 ||||| || || |||||||| Sbjct: 291 aaggtgatcagcaaggttctc 271
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||||||||||||||| ||||||||| | ||||||||||||||| | | || || || Sbjct: 874 tcacttgccgggaacgaaattggtggcgtaggcccaggcgttgttggttgcgggatccgc 815 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 | ||||||| ||| || |||| ||||||||||||||| |||| Sbjct: 814 caagtggtcgaagagattttcgatggggcccttgccggttacga 771
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 71.9 bits (36), Expect = 1e-09 Identities = 84/100 (84%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 ||||| || |||||||| || ||| | ||||||||||||||| | ||||||||||| ||| Sbjct: 848 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 789 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || ||||| ||||||| ||| || || |||||||||| Sbjct: 788 tgatcagcgagattctcgatgggtcctttaccggtgacga 749
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 71.9 bits (36), Expect = 1e-09 Identities = 84/100 (84%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280 ||||| || |||||||| || ||| | ||||||||||||||| | ||||||||||| ||| Sbjct: 845 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 786 Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320 || || ||||| ||||||| ||| || || |||||||||| Sbjct: 785 tgatcagcgagattctcgatgggtcctttaccggtgacga 746
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding protein mRNA, complete cds Length = 1118 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 227 ggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcg 286 ||||| ||||||||||| ||||||||||||| ||||| |||||||| || ||||||||| Sbjct: 877 ggaacaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcg 818 Query: 287 gcgaggttctcgagggggcccttgccggtgac 318 || | |||||| || || ||||| || ||||| Sbjct: 817 gccaagttctccagcggaccctttccagtgac 786
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 812 gccaaatggtcagcaaggttctc 790
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 799 gccaaatggtcagcaaggttctc 777
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 813 gccaaatggtcagcaaggttctc 791
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 230 acgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcg 289 |||||||||||||| || |||||||| ||||||||||| || ||||| ||||| ||||| Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggcc 602 Query: 290 aggttctcgagggggcccttgcc 312 | |||||| || || |||||||| Sbjct: 601 aagttctccagtggccccttgcc 579
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence Length = 958 Score = 69.9 bits (35), Expect = 5e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| || ||||| ||||||||||||||||| |||||||| || ||||| || |||||| Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776 Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318 || || |||||||| | || ||||| |||||||| Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgac 741
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 799 gccaaatggtcagcaaggttctc 777
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 806 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 747 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 746 gccaaatggtcagcaaggttctc 724
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 812 gccaaatggtcagcaaggttctc 790
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 742 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 700
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 799 gccaaatggtcagcaaggttctc 777
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 806 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 747 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 746 gccaaatggtcagcaaggttctc 724
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 806 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 747 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 746 gccaaatggtcagcaaggttctc 724
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 799 gccaaatggtcagcaaggttctc 777
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 798 gccaaatggtcagcaaggttctc 776
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 812 gccaaatggtcagcaaggttctc 790
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 812 gccaaatggtcagcaaggttctc 790
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 852 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 793 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 792 gccaaatggtcagcaaggttctc 770
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 798 gccaaatggtcagcaaggttctc 776
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 812 gccaaatggtcagcaaggttctc 790
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 870 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 811 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 810 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 768
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 176 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 117 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 116 gccaaatggtcagcaaggttctc 94
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 841 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 782 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 781 gccaaatggtcagcaaggttctc 759
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 522 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 463 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 462 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 420
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 752 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 693 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 692 gccaaatggtcagcaaggttctc 670
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 22544 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 22485 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 22484 gccaaatggtcagcaaggttctc 22462 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 19898 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 19839 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 19838 gccaaatggtcagcaaggttctc 19816 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 16109 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 16168 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 16169 gccaaatggtcagcaaggttctc 16191
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 813 gccaaatggtcagcaaggttctc 791
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 1102 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 1043 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 1042 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 1000
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || ||| Sbjct: 1023 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 964 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 963 gccaaatggtcagcaaggttctc 941
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 1012 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 953 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 952 gccaaatggtcagcaaggttctc 930
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 69.9 bits (35), Expect = 5e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 951 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 892 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 891 gccaaatggtcagcaaggttctc 869
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 69.9 bits (35), Expect = 5e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273 |||||||| ||||| ||||||||||| ||||| ||||| |||||||||||||| ||||| Sbjct: 377 gctcactttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 69.9 bits (35), Expect = 5e-09 Identities = 86/103 (83%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || | Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 | | |||||| ||||||||||| | || ||||| |||||||| Sbjct: 742 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 700
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 69.9 bits (35), Expect = 5e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| |||||||||||||| | ||| |||||||||||||| |||||||| | |||| Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935 Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318 ||||| |||| ||| | ||||||||||||||||| Sbjct: 934 tcggcaaggtcctccaatgggcccttgccggtgac 900
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264 |||||||| |||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 634 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 67.9 bits (34), Expect = 2e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| || ||||| |||||||||||||| ||||||||||| || ||||| || |||||| Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732 Query: 284 tcggcgaggttctc 297 || || |||||||| Sbjct: 731 tcagcaaggttctc 718
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||||| Sbjct: 762 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703 Query: 277 gaggtggtcggcgaggttctc 297 | ||||| || |||||||| Sbjct: 702 caaatggtcagcaaggttctc 682
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 65.9 bits (33), Expect = 7e-08 Identities = 84/101 (83%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| ||||| || ||||| ||||| || ||||| |||||||||||||| ||||| Sbjct: 219 gctcactttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtca 160 Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggt 315 | || |||||||| |||||||| || || ||||| ||||| Sbjct: 159 gtgatatggtcggcaaggttctctagaggtccctttccggt 119 Score = 60.0 bits (30), Expect = 5e-06 Identities = 66/78 (84%) Strand = Plus / Plus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| || ||||| |||||||| ||||| ||||||||||| || ||||| || Sbjct: 8571 tcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagc 8630 Query: 277 gaggtggtcggcgaggtt 294 || |||||| || ||||| Sbjct: 8631 gatgtggtcagcaaggtt 8648
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||||| Sbjct: 804 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745 Query: 277 gaggtggtcggcgaggttctc 297 | ||||| || |||||||| Sbjct: 744 caaatggtcagcaaggttctc 724
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein Length = 1080 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| | |||||||| |||||||| || ||||| || Sbjct: 867 tcactttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgc 808 Query: 277 gaggtggtcggcgaggttctc 297 ||||||||||| |||||||| Sbjct: 807 aaggtggtcggcaaggttctc 787
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| || |||||||||||| | | |||||| |||||||| || ||||| || Sbjct: 871 tcactttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagc 812 Query: 277 gaggtggtcggcgaggttctc 297 ||||||||||| |||||||| Sbjct: 811 aaggtggtcggctaggttctc 791
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| || ||||| || |||||||| || ||||| || Sbjct: 189 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 130 Query: 277 gaggtggtcggcgaggttctc 297 |||||||| ||||||||||| Sbjct: 129 aaggtggtcagcgaggttctc 109
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||||||||| | ||||| |||||||||||||| |||||||| Sbjct: 852 tcactttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793 Query: 277 gaggtggtcggcgaggttctc 297 || || || || |||||||| Sbjct: 792 aagatgatcagcaaggttctc 772
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||| || Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagc 292 Query: 277 gaggtggtcggcgaggttctc 297 | ||||||||| || ||||| Sbjct: 291 aatgtggtcggcaagattctc 271
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end Length = 351 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||| || Sbjct: 351 tcactttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgc 292 Query: 277 gaggtggtcggcgaggttctc 297 ||||| || || |||||||| Sbjct: 291 aaggtgatcagcaaggttctc 271
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| | |||||||| |||||||| || ||||| || Sbjct: 5163 tcactttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagc 5104 Query: 277 gaggtggtcggcgaggttctc 297 ||||||||||| |||||||| Sbjct: 5103 aaggtggtcggcaaggttctc 5083 Score = 63.9 bits (32), Expect = 3e-07 Identities = 86/104 (82%) Strand = Plus / Plus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| | ||||| ||||||||||| || ||||| || Sbjct: 1870 tcactttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagc 1929 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || |||||||| |||||||| | || ||||| |||||||||| Sbjct: 1930 aagatggtcggcaaggttctccaatggaccctttccggtgacga 1973
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacga 715
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacga 715
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||||| || ||||||||||||| ||| ||||| |||||||||| Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 61.9 bits (31), Expect = 1e-06 Identities = 71/83 (85%), Gaps = 1/83 (1%) Strand = Plus / Minus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274 |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || ||| Sbjct: 843 gctcactttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcg 785 Query: 275 gcgaggtggtcggcgaggttctc 297 || | ||||| || |||||||| Sbjct: 784 gccaaatggtcagcaaggttctc 762
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 61.9 bits (31), Expect = 1e-06 Identities = 73/87 (83%) Strand = Plus / Minus Query: 232 gaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgag 291 ||||||||||||| ||||||||||||||||| | || ||||| | |||||||| | Sbjct: 1379 gaagttggtggcgtaagcccaggcgttgttgacggtgggatcggccaagtggtcggacaa 1320 Query: 292 gttctcgagggggcccttgccggtgac 318 |||||||| ||||||||| |||||||| Sbjct: 1319 gttctcgatggggccctttccggtgac 1293
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev Length = 326 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||||||| |||||||||||||| |||||||| || ||||||| Sbjct: 3 ggcgaggtggtcagcgaggttctcgagcgggcccttaccagtgacga 49
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds Length = 1253 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| || ||||| ||||||||||||||||| |||||||| || ||||| || ||||| Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922 Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318 || || |||||||| | || ||||| |||||||| Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgac 887
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 61.9 bits (31), Expect = 1e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 ||||||||||||||||||||| | ||||||||||||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttg 801
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 60.0 bits (30), Expect = 5e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 |||||||||||||| || ||||||||||||| ||| ||||| |||||||| Sbjct: 755 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgac 706
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 60.0 bits (30), Expect = 5e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 |||||||||||||||||||||||| | ||||| ||||||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807
>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 |||||||| ||||| ||||| ||| ||||||||||||||| || ||||| || |||||| Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732 Query: 284 tcggcgaggttctc 297 || || |||||||| Sbjct: 731 tctgcaaggttctc 718
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 58.0 bits (29), Expect = 2e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311 ||||||||||| || | |||| ||| |||||||||| ||||||| ||||||||||||| Sbjct: 759 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 700 Query: 312 cggtgacga 320 |||| |||| Sbjct: 699 cggtcacga 691
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein Length = 928 Score = 58.0 bits (29), Expect = 2e-05 Identities = 71/85 (83%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 |||||||||||| |||| || || ||| ||| |||||| ||||||||||| |||||| Sbjct: 818 ttggtggcgaaaacccatgcattattggcgacagggtcgtcgaggtggtcgaacaggttc 759 Query: 296 tcgagggggcccttgccggtgacga 320 || | ||||||||||||||||||| Sbjct: 758 tccaatgggcccttgccggtgacga 734
>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I Length = 2432 Score = 58.0 bits (29), Expect = 2e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| |||||||| ||||||||||| || || || || Sbjct: 1704 tcactttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactggatcagc 1645 Query: 277 gaggtggtc 285 |||||||| Sbjct: 1644 aaggtggtc 1636
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 58.0 bits (29), Expect = 2e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| || ||||| || |||||||| || ||||| || Sbjct: 1031 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 972 Query: 277 gaggtggtcggcgaggttctc 297 ||||| || ||||||||||| Sbjct: 971 aaggtgatcagcgaggttctc 951
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261 |||||| |||||||| |||||||||||| |||||||||| ||||| Sbjct: 964 tcactttccgggaacaaagttggtggcgtaagcccaggcattgtt 920
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 58.0 bits (29), Expect = 2e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311 ||||||||||| || | ||||| || |||||||| || ||||||| || ||||||||||| Sbjct: 768 aggcgttgttggtgccggggtcagccaggtggtcagccaggttctggatggggcccttgc 709 Query: 312 cggtgacga 320 |||| |||| Sbjct: 708 cggtcacga 700
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 58.0 bits (29), Expect = 2e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311 ||||||||||| || | |||| ||| |||||||||| ||||||| ||||||||||||| Sbjct: 743 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 684 Query: 312 cggtgacga 320 |||| |||| Sbjct: 683 cggtcacga 675
>gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting complex I protein (Lhca) mRNA, complete cds; nuclear gene for chloroplast product Length = 1274 Score = 56.0 bits (28), Expect = 7e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtg 316 ||||| || |||||||| || ||||| ||||||||||||||||||||| Sbjct: 684 gggtcagccaggtggtcagccaggttgtcgagggggcccttgccggtg 637
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 56.0 bits (28), Expect = 7e-05 Identities = 82/100 (82%) Strand = Plus / Minus Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278 |||| ||||| ||||||||||| || |||||||| || |||||||| |||||||| | Sbjct: 805 actttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtcaaaaa 746 Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgac 318 |||||||||| | ||| || || || ||||| |||||||| Sbjct: 745 ggtggtcggccaagttttccagtggcccctttccggtgac 706
>gb|AY104614.1| Zea mays PCO084486 mRNA sequence Length = 1214 Score = 56.0 bits (28), Expect = 7e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 255 cgttgttgttgaccgggtcggcgaggtggtcg 286 ||||||||||||| |||||||||||||||||| Sbjct: 955 cgttgttgttgacggggtcggcgaggtggtcg 924
>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10, 3' end and flank Length = 367 Score = 56.0 bits (28), Expect = 7e-05 Identities = 85/104 (81%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| |||||| | | ||| ||||||||||| || || ||||| Sbjct: 231 tcactttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggc 172 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 || ||||| || |||||||| | || ||||| |||||||||| Sbjct: 171 aagatggtcagcaaggttctccaatggaccctttccggtgacga 128
>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3' end Length = 387 Score = 56.0 bits (28), Expect = 7e-05 Identities = 61/72 (84%) Strand = Plus / Minus Query: 226 gggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtc 285 |||||| ||||| |||||| | | ||| || |||||||| || |||||||| |||||||| Sbjct: 387 gggaacaaagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtc 328 Query: 286 ggcgaggttctc 297 ||| |||||||| Sbjct: 327 ggcaaggttctc 316
>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial sequence; nuclear gene for chloroplast product Length = 255 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 ||||||| ||||| |||||||||||||| |||||||||| |||||| Sbjct: 186 ctcacttcccgggcacgaagttggtggcataagcccaggcattgttg 140
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267 |||||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 843 tcactttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 54.0 bits (27), Expect = 3e-04 Identities = 55/63 (87%), Gaps = 1/63 (1%) Strand = Plus / Plus Query: 215 gctcacttgccgggaacgaagttggtggcgaaagccc-aggcgttgttgttgaccgggtc 273 |||||||| |||||||| |||||||| ||||| |||| | |||||||||||||| || || Sbjct: 49 gctcactttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatc 108 Query: 274 ggc 276 ||| Sbjct: 109 ggc 111
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 54.0 bits (27), Expect = 3e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 ||||||||||||||||||||| | ||||| ||||||||| Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttg 2979
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 54.0 bits (27), Expect = 3e-04 Identities = 81/99 (81%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| || ||||||||||| || ||| || |||||||| |||||||| || Sbjct: 853 tcactttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagc 794 Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggt 315 |||||||| |||||||| || | |||||||| ||||| Sbjct: 793 aaggtggtcagcgaggttttccaatgggccctttccggt 755
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 248 gcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggccc 307 ||||| ||||||||||| || |||||||| |||||||| || |||||||| | || ||| Sbjct: 2223 gcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggaccc 2164 Query: 308 ttgccggtgac 318 || |||||||| Sbjct: 2163 tttccggtgac 2153
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 752 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 287 gcgaggttctcgagggggcccttgccggtgacga 320 ||||||||||||| ||| |||||||||||||||| Sbjct: 745 gcgaggttctcgatgggtcccttgccggtgacga 712
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding protein of photosystem II Length = 772 Score = 52.0 bits (26), Expect = 0.001 Identities = 41/46 (89%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 |||||||||||||||||| |||||||| | |||||||| |||||| Sbjct: 707 tcacttgccgggaacgaaattggtggcataggcccaggcattgttg 662
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 |||||||||||||| ||||||||| | |||||||| |||||| Sbjct: 586 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 545
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262 |||||||||||||| ||||||||| | |||||||| |||||| Sbjct: 737 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 696
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 52.0 bits (26), Expect = 0.001 Identities = 62/74 (83%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| || ||||| ||||| ||| ||||||||||||||| || ||||| || |||||| Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732 Query: 284 tcggcgaggttctc 297 || || |||||||| Sbjct: 731 tcagcaaggttctc 718
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B (ftrbpot gene) Length = 701 Score = 52.0 bits (26), Expect = 0.001 Identities = 63/74 (85%), Gaps = 1/74 (1%) Strand = Plus / Plus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 ||||| || ||||| |||||||||||| || |||||||||| || ||||| || |||||| Sbjct: 6 ccggggacaaagtttgtggcgaaagccaag-cgttgttgttaacggggtctgcaaggtgg 64 Query: 284 tcggcgaggttctc 297 || || |||||||| Sbjct: 65 tcagcaaggttctc 78
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| ||||| ||||| ||||||| || ||||||||||| ||||| || Sbjct: 1552 tcactttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagc 1493 Query: 277 gaggtg 282 ||||| Sbjct: 1492 aaggtg 1487
>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds Length = 351 Score = 52.0 bits (26), Expect = 0.001 Identities = 62/74 (83%) Strand = Plus / Minus Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283 |||||||| ||||| |||||| | | ||||||||||||||| || ||||| || ||||| Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285 Query: 284 tcggcgaggttctc 297 || || |||||||| Sbjct: 284 tcagcaaggttctc 271
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggccctt 309 ||||||||||||||| || ||||| || |||||||| || |||||||| | |||||||| Sbjct: 5099 ccaggcgttgttgttaacagggtctgcaaggtggtcagcaaggttctccaatgggccctt 5040 Query: 310 gccggt 315 ||||| Sbjct: 5039 tccggt 5034 Score = 42.1 bits (21), Expect = 1.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 233 aagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgagg 292 ||||| |||||| | | ||||||||||||||| || ||||| || || ||||| || ||| Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagcaagg 2604 Query: 293 ttctc 297 ||||| Sbjct: 2603 ttctc 2599
>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex II protein m9 mRNA, partial cds; nuclear gene for chloroplast product Length = 577 Score = 50.1 bits (25), Expect = 0.004 Identities = 70/85 (82%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||||| || |||||||||| | | | |||| ||| |||||||| | |||||| Sbjct: 444 ttggtggcgaaggcgaaggcgttgttctcggcagggttggccaggtggtcagtcaggttc 385 Query: 296 tcgagggggcccttgccggtgacga 320 | || ||||||||||||||| |||| Sbjct: 384 tggatggggcccttgccggtcacga 360
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 50.1 bits (25), Expect = 0.004 Identities = 70/85 (82%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||||| || ||||||||||| | |||| ||| ||||||||| | |||||| Sbjct: 782 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 723 Query: 296 tcgagggggcccttgccggtgacga 320 | || ||||||||||||||| |||| Sbjct: 722 tggacggggcccttgccggtcacga 698
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 50.1 bits (25), Expect = 0.004 Identities = 49/57 (85%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273 |||||| |||||||| ||||||||||| | ||||| || ||||||||||| ||||| Sbjct: 815 tcactttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 50.1 bits (25), Expect = 0.004 Identities = 67/81 (82%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| || ||||| || ||| ||| ||| ||||||||||| || |||||||| Sbjct: 1034 tcactttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggc 975 Query: 277 gaggtggtcggcgaggttctc 297 ||||| || || |||||||| Sbjct: 974 aaggtgatcagcaaggttctc 954
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 50.1 bits (25), Expect = 0.004 Identities = 40/45 (88%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261 |||||| || ||||||||||||||||| || |||||||| ||||| Sbjct: 873 tcactttccaggaacgaagttggtggcaaaggcccaggcattgtt 829
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 50.1 bits (25), Expect = 0.004 Identities = 67/81 (82%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 ||||||||||||| | ||||| || ||||| ||||| || |||||||| || ||||| || Sbjct: 860 tcacttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgc 801 Query: 277 gaggtggtcggcgaggttctc 297 || || || ||||||||||| Sbjct: 800 aagatgatcagcgaggttctc 780
>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide 15) mRNA, clone pAB96 Length = 822 Score = 50.1 bits (25), Expect = 0.004 Identities = 67/81 (82%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| |||||||| |||||||| || | | ||| ||||||||||| || |||||||| Sbjct: 688 tcactttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggc 629 Query: 277 gaggtggtcggcgaggttctc 297 || || ||||| |||||||| Sbjct: 628 aagatgatcggcaaggttctc 608
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 50.1 bits (25), Expect = 0.004 Identities = 70/85 (82%) Strand = Plus / Minus Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295 ||||||||||| || ||||||||||| | |||| ||| ||||||||| | |||||| Sbjct: 1803 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 1744 Query: 296 tcgagggggcccttgccggtgacga 320 | || ||||||||||||||| |||| Sbjct: 1743 tggacggggcccttgccggtcacga 1719
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 50.1 bits (25), Expect = 0.004 Identities = 58/69 (84%) Strand = Plus / Minus Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276 |||||| ||||| || ||||||||||| | ||||| || ||||||||||| ||||| || Sbjct: 992 tcactttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagc 933 Query: 277 gaggtggtc 285 |||||||| Sbjct: 932 aaggtggtc 924
>gb|DQ122899.1| Chlamydomonas incerta chloroplast light harvesting complex I protein (LhcA) mRNA, complete cds; nuclear gene for chloroplast product Length = 746 Score = 48.1 bits (24), Expect = 0.017 Identities = 42/48 (87%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtg 316 ||||| || |||||||||| ||||| || |||||||||||||||||| Sbjct: 683 gggtcagccaggtggtcggacaggttgtccagggggcccttgccggtg 636
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 48.1 bits (24), Expect = 0.017 Identities = 39/44 (88%) Strand = Plus / Minus Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318 |||||||| || ||||||||||||| ||| ||||| |||||||| Sbjct: 760 gcgaggtgatcagcgaggttctcgatgggtccctttccggtgac 717
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||| ||||| || ||||||||||||| ||| || || |||||||||| Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||| ||||| || ||||||||||||| ||| || || |||||||||| Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||||||| ||||| || ||||||||||||| ||| || || |||||||||| Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||| ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 722 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 671
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 48.1 bits (24), Expect = 0.017 Identities = 81/100 (81%) Strand = Plus / Minus Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275 ||||||| ||||| || ||||| ||||| | ||||| || ||||||||||| ||||| | Sbjct: 851 ctcactttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcag 792 Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggt 315 | |||||||| || ||||| || || || ||||| ||||| Sbjct: 791 caaggtggtctgcaaggttttccagcggtccctttccggt 752
>dbj|AB122115.1| Chlamydomonas reinhardtii LhcI-2 gene for light-harvesting chlorophyll-a/b protein of photosystem I (Type III), complete cds Length = 2389 Score = 48.1 bits (24), Expect = 0.017 Identities = 51/60 (85%) Strand = Plus / Minus Query: 256 gttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggt 315 |||||||||||| ||||| || ||||| || | ||||||| || ||||||||||||||| Sbjct: 2214 gttgttgttgacggggtcagccaggtgctccaccaggttctggaaggggcccttgccggt 2155
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||| ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 746 gggttggccaggtggtcgtccaggttctggacggggcccttgccggtcacga 695
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||| ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 738 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 687
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 |||| ||| ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 1419 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 1368
>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0091I11, complete sequence Length = 135993 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 289 gaggttctcgagggggcccttgccggtgacg 319 ||||||||||| |||||||| |||||||||| Sbjct: 40182 gaggttctcgacggggccctcgccggtgacg 40152
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 46.1 bits (23), Expect = 0.068 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 730 aggtggtcgtccaggttctggatggggcccttgccggtcacga 688
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 46.1 bits (23), Expect = 0.068 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 731 aggtggtcgtccaggttctggatggggcccttgccggtcacga 689
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 46.1 bits (23), Expect = 0.068 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320 ||||||||| | ||||||| || ||||||||||||||| |||| Sbjct: 725 aggtggtcgtccaggttctggacggggcccttgccggtcacga 683
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 289 gaggttctcgagggggcccttgccggtgacg 319 ||||||||||| |||||||| |||||||||| Sbjct: 7581096 gaggttctcgacggggccctcgccggtgacg 7581066
>dbj|AB122120.1| Chlamydomonas reinhardtii LhcI-7 gene for light-harvesting chlorophyll-a/b protein of photosystem I, complete cds Length = 2261 Score = 46.1 bits (23), Expect = 0.068 Identities = 26/27 (96%) Strand = Plus / Minus Query: 290 aggttctcgagggggcccttgccggtg 316 ||||| ||||||||||||||||||||| Sbjct: 1868 aggttgtcgagggggcccttgccggtg 1842
>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full insert sequence Length = 1157 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 289 gaggttctcgagggggcccttgccggtgacg 319 ||||||||||| |||||||| |||||||||| Sbjct: 861 gaggttctcgacggggccctcgccggtgacg 831
>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full insert sequence Length = 1101 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 289 gaggttctcgagggggcccttgccggtgacg 319 ||||||||||| |||||||| |||||||||| Sbjct: 851 gaggttctcgacggggccctcgccggtgacg 821
>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full insert sequence Length = 1186 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 289 gaggttctcgagggggcccttgccggtgacg 319 ||||||||||| |||||||| |||||||||| Sbjct: 862 gaggttctcgacggggccctcgccggtgacg 832 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,763,290 Number of Sequences: 3902068 Number of extensions: 2763290 Number of successful extensions: 54731 Number of sequences better than 10.0: 322 Number of HSP's better than 10.0 without gapping: 322 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 53805 Number of HSP's gapped (non-prelim): 920 length of query: 320 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 298 effective length of database: 17,147,199,772 effective search space: 5109865532056 effective search space used: 5109865532056 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)