ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet22f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 178 7e-42
2dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 178 7e-42
3dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 7e-42
4dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 7e-42
5emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 178 7e-42
6dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 7e-42
7emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 174 1e-40
8dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
9dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
10dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
11dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
12dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
13dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
14dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
15dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
16dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 174 1e-40
17gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 172 4e-40
18ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 170 2e-39
19emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 170 2e-39
20gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 161 2e-36
21emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 145 1e-31
22gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 145 1e-31
23gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 143 4e-31
24gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 137 2e-29
25dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 137 2e-29
26dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 2e-29
27dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 2e-29
28dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 2e-29
29dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 2e-29
30ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 135 1e-28
31gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 131 1e-27
32gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 131 1e-27
33dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 131 1e-27
34dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 1e-27
35dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 1e-27
36gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 131 1e-27
37emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 129 6e-27
38emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 129 6e-27
39emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 129 6e-27
40dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 6e-27
41gb|AY109324.1| Zea mays CL187_1 mRNA sequence 129 6e-27
42dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 123 4e-25
43emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 115 9e-23
44emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 115 9e-23
45gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 115 9e-23
46gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 115 9e-23
47gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 113 4e-22
48gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 111 1e-21
49emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 111 1e-21
50gb|AY112240.1| Zea mays CL187_6 mRNA sequence 111 1e-21
51dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 111 1e-21
52ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 107 2e-20
53ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 107 2e-20
54ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 107 2e-20
55ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 107 2e-20
56gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 107 2e-20
57gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 107 2e-20
58gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 107 2e-20
59gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 107 2e-20
60gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 107 2e-20
61gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 107 2e-20
62gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 107 2e-20
63gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 107 2e-20
64gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 107 2e-20
65gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 107 2e-20
66gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 107 2e-20
67emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 107 2e-20
68emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 107 2e-20
69emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 107 2e-20
70emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 107 2e-20
71emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 107 2e-20
72gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 105 9e-20
73gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 103 3e-19
74gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 103 3e-19
75gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 103 3e-19
76gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 103 3e-19
77gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 103 3e-19
78gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 100 5e-18
79emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 98 2e-17
80gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 94 3e-16
81emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 92 1e-15
82emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 92 1e-15
83emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 92 1e-15
84gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 92 1e-15
85emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 92 1e-15
86gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 88 2e-14
87emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 88 2e-14
88emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 88 2e-14
89gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 88 2e-14
90gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 88 2e-14
91gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 84 3e-13
92gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 84 3e-13
93dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 84 3e-13
94ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 82 1e-12
95ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
96ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
97ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
98ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
99ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
100ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
101ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 82 1e-12
102dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 82 1e-12
103dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 82 1e-12
104dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 82 1e-12
105dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
106dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
107dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
108emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 82 1e-12
109dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
110dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
111dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
112dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
113dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
114dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
115dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
116gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 82 1e-12
117emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 80 5e-12
118emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 80 5e-12
119emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 80 5e-12
120emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 80 5e-12
121gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 80 5e-12
122gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 80 5e-12
123emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 76 8e-11
124emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 74 3e-10
125gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 74 3e-10
126gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 72 1e-09
127emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 72 1e-09
128emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 72 1e-09
129gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 72 1e-09
130ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 70 5e-09
131ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 70 5e-09
132ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 70 5e-09
133ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 70 5e-09
134gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 70 5e-09
135gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 70 5e-09
136gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 70 5e-09
137gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 70 5e-09
138gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 70 5e-09
139gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 70 5e-09
140gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 70 5e-09
141gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 70 5e-09
142gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 70 5e-09
143gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 5e-09
144gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 5e-09
145gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 5e-09
146gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 5e-09
147gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 70 5e-09
148gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 70 5e-09
149gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 70 5e-09
150gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 70 5e-09
151gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 70 5e-09
152gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 70 5e-09
153emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 70 5e-09
154emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 70 5e-09
155emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 70 5e-09
156gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 70 5e-09
157gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 70 5e-09
158gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 70 5e-09
159gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 70 5e-09
160emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 70 5e-09
161emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 70 5e-09
162emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 70 5e-09
163emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 70 5e-09
164emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 70 5e-09
165gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 70 5e-09
166gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 70 5e-09
167gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 68 2e-08
168gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 68 2e-08
169gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 66 7e-08
170gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 66 7e-08
171gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 66 7e-08
172emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 66 7e-08
173emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 66 7e-08
174gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 66 7e-08
175gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 66 7e-08
176gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 66 7e-08
177gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 66 7e-08
178dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 66 7e-08
179gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 64 3e-07
180gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 64 3e-07
181gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 64 3e-07
182gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 64 3e-07
183gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 64 3e-07
184gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 64 3e-07
185gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 64 3e-07
186gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 64 3e-07
187emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
188dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 62 1e-06
189emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 62 1e-06
190gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 62 1e-06
191dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 62 1e-06
192gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 60 5e-06
193dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 60 5e-06
194gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 60 5e-06
195gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 58 2e-05
196emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 58 2e-05
197emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 58 2e-05
198emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 58 2e-05
199emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 58 2e-05
200emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 58 2e-05
201dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 58 2e-05
202gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting comple... 56 7e-05
203gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 56 7e-05
204gb|AY104614.1| Zea mays PCO084486 mRNA sequence 56 7e-05
205gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 56 7e-05
206gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 56 7e-05
207gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR... 54 3e-04
208gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 54 3e-04
209emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
210dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 54 3e-04
211emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 54 3e-04
212dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 54 3e-04
213gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 52 0.001
214emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 52 0.001
215emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 52 0.001
216gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 52 0.001
217gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 52 0.001
218emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 52 0.001
219gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 52 0.001
220gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 52 0.001
221dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 52 0.001
222gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 50 0.004
223gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 50 0.004
224emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 50 0.004
225emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 50 0.004
226emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 50 0.004
227gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 50 0.004
228gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 50 0.004
229gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 50 0.004
230gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 50 0.004
231gb|DQ122899.1| Chlamydomonas incerta chloroplast light harvestin... 48 0.017
232gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 48 0.017
233gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 48 0.017
234gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 48 0.017
235gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 48 0.017
236gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 48 0.017
237gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 48 0.017
238dbj|AB122115.1| Chlamydomonas reinhardtii LhcI-2 gene for light-... 48 0.017
239gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 48 0.017
240dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 48 0.017
241dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 48 0.017
242gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.068
243gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 46 0.068
244gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 46 0.068
245gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 46 0.068
246dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.068
247dbj|AB122120.1| Chlamydomonas reinhardtii LhcI-7 gene for light-... 46 0.068
248dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.068
249dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.068
250dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.068
251gb|AY106149.1| Zea mays PCO102434 mRNA sequence 46 0.068
252gb|AY105650.1| Zea mays PCO135935 mRNA sequence 46 0.068
253gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.068
254gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein... 46 0.068
255dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, ... 46 0.068
256dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 46 0.068
257dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 46 0.068
258ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 44 0.27
259gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 44 0.27
260gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 44 0.27
261gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 44 0.27
262gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 44 0.27
263gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 44 0.27
264dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 44 0.27
265gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 44 0.27
266gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 44 0.27
267dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 44 0.27
268gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 44 0.27
269dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.27
270gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 44 0.27
271gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 44 0.27
272gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 1.1
273gb|AF521085.1| Streptomyces nanchangensis NS3226 polyether ionop... 42 1.1
274ref|NM_001032032.1| Drosophila melanogaster held out wings CG102... 42 1.1
275gb|AC007114.8| Homo sapiens chromosome 17, clone RP11-166P13, co... 42 1.1
276gb|AC008144.5|AC008144 Drosophila melanogaster, chromosome 3R, r... 42 1.1
277emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 42 1.1
278gb|AE003737.3| Drosophila melanogaster chromosome 3R, section 75... 42 1.1
279gb|AF005849.1|AF005849 Drosophila melanogaster anon1F4 pseudogen... 42 1.1
280emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 42 1.1
281ref|NM_128200.3| Arabidopsis thaliana RCY1; cyclin-dependent pro... 40 4.2
282ref|XM_463041.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.2
283gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com... 40 4.2
284gb|AC163991.3| Mus musculus chromosome 15, clone RP24-119L11, co... 40 4.2
285gb|AC133333.5| Oryza sativa chromosome 3 BAC OJ1785_A05 genomic ... 40 4.2
286gb|AY150419.1| Arabidopsis thaliana putative cyclin (At2g26430) ... 40 4.2
287gb|AY091085.1| Arabidopsis thaliana putative cyclin (At2g26430) ... 40 4.2
288emb|AL939125.1|SCO939125 Streptomyces coelicolor A3(2) complete ... 40 4.2
289emb|CR626890.8| Zebrafish DNA sequence from clone DKEY-83J7 in l... 40 4.2
290emb|BX324206.6| Zebrafish DNA sequence from clone CH211-66O10 in... 40 4.2
291gb|AF249734.1| Arabidopsis thaliana ania-6a type cyclin (RCY1) m... 40 4.2
292emb|BX324151.11| Zebrafish DNA sequence from clone CH211-62C19 i... 40 4.2
293gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 40 4.2
294dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 40 4.2
295gb|AC002505.3| Arabidopsis thaliana chromosome 2 clone T9J22 map... 40 4.2
296ref|XM_686371.1| PREDICTED: Danio rerio similar to endothelial c... 40 4.2
297gb|CP000249.1| Frankia sp. CcI3, complete genome 40 4.2
298gb|AC156618.5| Mus musculus chromosome 3, clone RP24-372J15, com... 40 4.2
299dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
300emb|BX819076.1|CNS0A9W0 Arabidopsis thaliana Full-length cDNA Co... 40 4.2
301gb|AC114311.3| Homo sapiens chromosome 5 clone RP11-2N5, complet... 40 4.2
302gb|AC092915.7| Homo sapiens 3 BAC RP11-585F20 (Roswell Park Canc... 40 4.2
303gb|AY086218.1| Arabidopsis thaliana clone 22595 mRNA, complete s... 40 4.2
304dbj|AP004730.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
305dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 4.2
306gb|AC010582.6|AC010582 Homo sapiens chromosome 14 clone CTD-2547... 40 4.2
307emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 40 4.2
308emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 40 4.2
309emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 40 4.2
310gb|AC102905.9| Mus musculus chromosome 15, clone RP24-303N12, co... 40 4.2
311emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 i... 40 4.2
312gb|AY105356.1| Zea mays PCO075138 mRNA sequence 40 4.2
313gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 40 4.2
314emb|AL136040.5|CNS01DVV Human chromosome 14 DNA sequence BAC C-2... 40 4.2
315gb|AC104874.11| Mus musculus chromosome 3, clone RP23-453I14, co... 40 4.2
316emb|AL935316.7| Zebrafish DNA sequence from clone CH211-239C9 in... 40 4.2
317emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 4.2
318gb|AF005850.1|AF005850 Drosophila yakuba anon1F4 pseudogene, par... 40 4.2
319dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 4.2
320dbj|AP004488.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 4.2
321emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr... 40 4.2
322dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 40 4.2

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 23604331 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 23604272

                                                              
Query: 275      gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
                ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23604271 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 23604226



 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                            
Query: 216      ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
                ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 30025136 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 30025077

                                                             
Query: 276      cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
                ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 30025076 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 30025032



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 67030 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 66971

                                                           
Query: 275   gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66970 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 66925



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 859 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 800

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 799 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 754



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 858 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 799

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 753



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 1288 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 1229

                                                          
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1228 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 1183



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score =  178 bits (90), Expect = 7e-42
 Identities = 102/106 (96%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||
Sbjct: 388 gctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcg 329

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 283



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 1247 tcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1188

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1187 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 1144



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                            
Query: 217      tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
                |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 10793782 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 10793723

                                                            
Query: 277      gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
                ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10793722 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 10793679



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                         
Query: 217   tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
             |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 17505 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 17446

                                                         
Query: 277   gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 17445 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 17402



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                          
Query: 217    tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
              |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 130400 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 130341

                                                          
Query: 277    gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
              ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 130340 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 130297



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 850 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 791

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 747



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 857 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 798

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 797 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 754



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 752



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||
Sbjct: 836 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 777

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 776 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 733



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  172 bits (87), Expect = 4e-40
 Identities = 102/107 (95%)
 Strand = Plus / Minus

                                                                       
Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273
           |||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808

                                                          
Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807 ggagaggtggtcggcgaggttctcgagggggcccttgccggtgacga 761



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  170 bits (86), Expect = 2e-39
 Identities = 98/102 (96%)
 Strand = Plus / Minus

                                                                       
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278
           |||||||||| ||||||||||||||| | |||||||||||||||||||| ||||||||||
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                                                     
Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 683



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  170 bits (86), Expect = 2e-39
 Identities = 101/106 (95%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||
Sbjct: 2723 gctcacttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcg 2664

                                                          
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            | ||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2663 gtgaggtggtcggcgaggttctcgatggggcccttgccggtgacga 2618



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  161 bits (81), Expect = 2e-36
 Identities = 99/105 (94%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           |||| |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 872 ctcatttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 813

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 812 cgaggtggtcggcgaggttctcgatggggcctttgccggtgacga 768



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| || |||||||||||  | ||||| |||||||||||||| |||||||
Sbjct: 811 ctcacttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcgg 752

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 751 cgaggtggtcggcgaggttctcgagcgggcccttgccggtgacga 707



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
            ||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 1196 ctcacttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 1137

                                                         
Query: 276  cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |||| ||||| || | |||||||||||||||||| ||||||||||
Sbjct: 1136 cgagatggtccgccaagttctcgagggggcccttcccggtgacga 1092



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  143 bits (72), Expect = 4e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||||||||| ||||||||||||||||| |||||||||||||||  ||| ||||||||
Sbjct: 1534 tcacttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || ||||||||| |||||||||| ||||||||||||||||||||
Sbjct: 1474 gatgtggtcggccaggttctcgatggggcccttgccggtgacga 1431



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Plus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
             ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 13875 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 13934

                                                          
Query: 276   cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 13935 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 13979



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
             ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 21126 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 21067

                                                          
Query: 276   cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 21066 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 21022



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 776



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 776



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 778



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  137 bits (69), Expect = 2e-29
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacga 778



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  135 bits (68), Expect = 1e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||||||
Sbjct: 798 tcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 739

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||| |||||||| || || ||||||||||||||||
Sbjct: 738 gaggtggtcggccaggttctccagtggccccttgccggtgacga 695



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Plus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 78970 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 79029

                                                           
Query: 275   gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 79030 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 79075



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 21808846 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21808787

                                                              
Query: 275      gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
                |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 21808786 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 21808741



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 272      tcggcgaggtggtcggcgag 291
                ||||||||||||||||||||
Sbjct: 21166198 tcggcgaggtggtcggcgag 21166179



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Minus

                                                                            
Query: 215      gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
                |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 21801875 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 21801816

                                                              
Query: 275      gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
                |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 21801815 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 21801770



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 272      tcggcgaggtggtcggcgag 291
                ||||||||||||||||||||
Sbjct: 21159227 tcggcgaggtggtcggcgag 21159208



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 845 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 786

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 785 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 740



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 420 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 361

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 360 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 315



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  131 bits (66), Expect = 1e-27
 Identities = 96/106 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 834 gctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcg 775

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 774 gcgacgtggtcgaagaggttctcgatggggcccttgccggtgacga 729



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  129 bits (65), Expect = 6e-27
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
            ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752

                                                         
Query: 276  cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            | | |||||| |||||||||||||| |||||||| ||||||||||
Sbjct: 1751 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 1707



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  129 bits (65), Expect = 6e-27
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 863 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 804

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           | | |||||| |||||||||||||| |||||||| ||||||||||
Sbjct: 803 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 759



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  129 bits (65), Expect = 6e-27
 Identities = 98/109 (89%)
 Strand = Plus / Minus

                                                                        
Query: 212  tgagctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccggg 271
            |||||| | |||||||| ||||||||||||||| | ||||| |||||||||||||| |||
Sbjct: 1685 tgagcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactggg 1626

                                                             
Query: 272  tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || |||| |||||| |||||||||||||| |||||||||||||||||||
Sbjct: 1625 tcagcgatgtggtcagcgaggttctcgagcgggcccttgccggtgacga 1577



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                             
Query: 68   ttagtgtacacacaccaactcatcatctcgact 100
            |||||||||| || |||||||||||||||||||
Sbjct: 1833 ttagtgtaca-acgccaactcatcatctcgact 1802



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  129 bits (65), Expect = 6e-27
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 865 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 806

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||   |||||||| | ||||||||||||||||||||
Sbjct: 805 cgaggtggtcgagcaggttctccaaggggcccttgccggtgacga 761



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  129 bits (65), Expect = 6e-27
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
            ||||||||||||| ||||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 1811 ctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcgg 1752

                                                         
Query: 276  cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            | | |||||| |||||||||||||| |||||||| ||||||||||
Sbjct: 1751 caatgtggtcagcgaggttctcgagcgggcccttcccggtgacga 1707



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  123 bits (62), Expect = 4e-25
 Identities = 83/90 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 cgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcga 290
           |||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636

                                         
Query: 291 ggttctcgagggggcccttgccggtgacga 320
            |||||||||||| ||||||||||| ||||
Sbjct: 635 agttctcgaggggtcccttgccggtcacga 606



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  115 bits (58), Expect = 9e-23
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| |||||||| ||||| || ||||| |||||||||||||| |||||||||| |
Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756

                                                 
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318
           ||||| ||||||||||| || |||||||||||||||||
Sbjct: 755 tggtcagcgaggttctcaagagggcccttgccggtgac 718



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  115 bits (58), Expect = 9e-23
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                       
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278
           |||||||||| ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 973 acttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914

                                                     
Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           | ||||| || | |||||||||||| ||||| ||||||||||
Sbjct: 913 gatggtccgccaagttctcgaggggccccttcccggtgacga 872



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  115 bits (58), Expect = 9e-23
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                       
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278
           |||||||||| || |||||||||||||| ||||| || ||||||||||| ||||||||||
Sbjct: 808 acttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 749

                                                     
Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |||||| ||||||||||| || ||||||||||| |||||||
Sbjct: 748 tgtggtcagcgaggttctcaagtgggcccttgcccgtgacga 707



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score =  115 bits (58), Expect = 9e-23
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| ||||||||||||||| |||||||||||||||||||||| |||||||| ||||| 
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330

                                        
Query: 284 tcggcgaggttctcgagggggcccttgcc 312
           ||||||||||| |||||||| || |||||
Sbjct: 329 tcggcgaggttntcgaggggtcctttgcc 301



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  113 bits (57), Expect = 4e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||||||||| || |||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 841 ctcacttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 782

                                                        
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||| | || |||||| || || ||||||||||||||||
Sbjct: 781 cgaggtggtctgtgatgttctccagtggccccttgccggtgacga 737



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  111 bits (56), Expect = 1e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||| | |||||||||||||||||||| ||||| 
Sbjct: 852 gctcactttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtca 793

                                                       
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           || |||||||||||||||||||| |  || ||||| ||||||||
Sbjct: 792 gcaaggtggtcggcgaggttctccaatggtccctttccggtgac 749



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  111 bits (56), Expect = 1e-21
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| |||||||| |||||| | |||||||||||||||  ||| |||||||||| |
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacga 725



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score =  111 bits (56), Expect = 1e-21
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| |||||||| |||||| | |||||||||||||||  ||| |||||||||| |
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgacga 373



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  111 bits (56), Expect = 1e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| ||||||||||||||| | | |||||||||||||  ||| ||||||| 
Sbjct: 824 tcacttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggt 765

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 764 gacgtggtcgaagaggttctcgatggggcccttgccggtgacga 721



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Plus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542

                                                          
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 2543 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 2588



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Plus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 2483 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 2542

                                                          
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 2543 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 2588



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 795 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 750



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 813 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 754

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 753 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 708



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 740 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 695



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 855 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 796

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 795 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 750



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Plus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 93201 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 93260

                                                           
Query: 275   gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 93261 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 93306



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
             ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 96106 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 96047

                                                        
Query: 276   cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
             | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 96046 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 96004



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 81001 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 80942

                                                           
Query: 275   gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 80941 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 80896



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                         
Query: 216   ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
             ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 78096 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 78155

                                                        
Query: 276   cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
             | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 78156 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 78198



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 800 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 741

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 740 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 695



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 851 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 792

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 791 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 746



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 171 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 112

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 111 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 66



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 832 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 773

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 772 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 727



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 835 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 776

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 775 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 730



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Plus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 84  gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 143

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 144 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 189



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score =  107 bits (54), Expect = 2e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 1100 gctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcg 1041

                                                          
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 1040 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 995



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  105 bits (53), Expect = 9e-20
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||| ||
Sbjct: 828 tcacttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagc 769

                                
Query: 277 gaggtggtcggcgaggttctc 297
            |||||||| |||||||||||
Sbjct: 768 aaggtggtctgcgaggttctc 748



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score =  103 bits (52), Expect = 3e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||| || ||||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 472 tcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||| ||||| | |||||| |  || ||||||||||| ||||
Sbjct: 412 gaggtgatcggccaagttctccaatggccccttgccggtcacga 369



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  103 bits (52), Expect = 3e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||
Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 738 caaatggtcggcgaggttctccaaaggtccctttccggtgacga 695



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  103 bits (52), Expect = 3e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||
Sbjct: 798 tcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 738 caaatggtcggcgaggttctccaaaggtccctttccggtgacga 695



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  103 bits (52), Expect = 3e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| ||||||||||||||| |||||||||||||||||  ||| ||||| ||||  
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||  ||||||||||| ||| ||||||||||||||||
Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacga 475



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score =  103 bits (52), Expect = 3e-19
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| |||||||| |||||| | |||||||||||||||  ||| |||||||  | |
Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacg 47

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||  ||||||||||| ||||||||||||||||||||
Sbjct: 46  tggtcgaagaggttctcgatggggcccttgccggtgacga 7



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| || || ||||||||| | |||||||||||||||  ||| ||||||
Sbjct: 841 gctcacttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcg 782

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| |||||||   | |||||||| ||||||||||||||||||||
Sbjct: 781 gcgacgtggtcgaaaaagttctcgatggggcccttgccggtgacga 736



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           |||| ||||| || || |||||||||||| | |||||||||||||||||||| ||||| |
Sbjct: 839 ctcatttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcag 780

                                                
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgcc 312
           ||||||| |||||||||||||| ||||| || |||||
Sbjct: 779 cgaggtgatcggcgaggttctctaggggtcctttgcc 743



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 855 gctcactttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtca 796

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || || ||||| || ||||||||
Sbjct: 795 gcaagatggtcagcaaggttctc 773



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278
           |||| ||||| ||||||||||||||||| ||||| ||||||||||| || |||||||| |
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaa 769

                                                     
Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgacga 727



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||||||||||||| | ||||| |||||||||| ||| ||||||
Sbjct: 842 gctcactttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcg 783

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 782 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 737



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 92/106 (86%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| ||||| ||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 834 gctcactttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcg 776

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 775 gccaaatggtcggcgaggttctccaaaggtccctttccggtgacga 730



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 aagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgagg 292
           |||||||||||| | |||||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcggcgagg 776

                                     
Query: 293 ttctcgagggggcccttgccggtgac 318
           ||||| |  || |||||||| |||||
Sbjct: 775 ttctccaaaggtcccttgccagtgac 750



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| ||||||||||||||| | ||||||||||||||||| || ||||| || |||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810

                                                 
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318
           || || ||||||||||||| ||| || || ||||||||
Sbjct: 809 tgatcagcgaggttctcgatgggtcctttcccggtgac 772



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           || ||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || 
Sbjct: 634 gcwcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatca 575

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || |  ||||||||||||||||| |  || ||||| ||||||||||
Sbjct: 574 gccaaatggtcggcgaggttctccaatggtccctttccggtgacga 529



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| ||||||||||||||  | ||||||||||||||| | || |||||||| |||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || || ||||||||||||| ||| || || ||||||||||
Sbjct: 824 tgatcagcgaggttctcgatgggtcctttcccggtgacga 785



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                        
Query: 221  ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
            |||||||| ||||||||||||||  | ||||||||||||||| | || |||||||| |||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903

                                                    
Query: 281  tggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || || ||||||||||||| ||| || || ||||||||||
Sbjct: 1902 tgatcagcgaggttctcgatgggtcctttcccggtgacga 1863



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           ||||| || ||||||||||||||  | ||||||||||||||||| || |||||||| |||
Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggggtcggccagg 226

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || || ||||||||||||| ||| || || ||||||||||
Sbjct: 225 tgatcagcgaggttctcgatgggtcctttcccggtgacga 186



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||||||||| ||||||||||||||| | |||||||| ||||||||||| ||||| 
Sbjct: 825 gctcacttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtcc 766

                                                       
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           || ||||| || || |||||||| |  || ||||| ||||||||
Sbjct: 765 gcaaggtgatcagcaaggttctccaatggacccttaccggtgac 722



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           |||||||| ||||||||||||||| | ||||||||||||||||| || ||||| || |||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801

                                                 
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgac 318
           || || | ||||||||||| ||| || || ||||||||
Sbjct: 800 tgatcagtgaggttctcgatgggtcctttcccggtgac 763



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggc 292

                                                     
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
            | ||||||||| |||||||| |  || ||||| ||||||||
Sbjct: 291 aatgtggtcggcaaggttctccaatggaccctttccggtgac 250



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||| |||||  |||||||||||||||||||||| ||||| 
Sbjct: 814 gctcacttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtct 755

                                                         
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || || |||||||| | |||||| ||||| || || ||||| ||||
Sbjct: 754 gccagatggtcggccaagttctccaggggaccttttccggtaacga 709



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 756 tccaaggggcccttgccggtgacga 732



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacga 756



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacga 756



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 782 tccaaggggcccttgccggtgacga 758



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 787 tccaaggggcccttgccggtgacga 763



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 820 tccaaggggcccttgccggtgacga 796



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                            
Query: 236      ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
                ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794

                                         
Query: 296      tcgagggggcccttgccggtgacga 320
                || | ||||||||||||||||||||
Sbjct: 22434793 tccaaggggcccttgccggtgacga 22434769



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| ||||||||||||||| | |||||||| |||||||| || |||||||| ||||| 
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833

                                        
Query: 284 tcggcgaggttctcgagggggcccttgcc 312
           ||||| |||||||||| ||| || |||||
Sbjct: 832 tcggcaaggttctcgatgggtcctttgcc 804



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                         
Query: 236   ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
             ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861

                                      
Query: 296   tcgagggggcccttgccggtgacga 320
             || | ||||||||||||||||||||
Sbjct: 95860 tccaaggggcccttgccggtgacga 95836



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| ||||| ||||||||| | |||||||| |||||||| || |||||||| ||||| 
Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826

                                        
Query: 284 tcggcgaggttctcgagggggcccttgcc 312
           |||||||||||||||| ||| || |||||
Sbjct: 825 tcggcgaggttctcgatgggtcctttgcc 797



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 756 tccaaggggcccttgccggtgacga 732



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacga 756



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacga 756



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacga 761



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 781 tccaaggggcccttgccggtgacga 757



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||| |  ||||||||||||||  ||| ||||||||||||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || | ||||||||||||||||||||
Sbjct: 787 tccaaggggcccttgccggtgacga 763



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 agctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273
           ||||||||| |||||||| ||||| ||||| || ||||| ||||||||||| || |||||
Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783

                                                        
Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
            || ||||||||||| |||||||| |  || ||||| ||||||||
Sbjct: 782 agcaaggtggtcggcaaggttctccaatggaccctttccggtgac 738



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || ||
Sbjct: 2376 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagc 2317

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             |  ||||||||||| ||||| |  || ||||| ||||||||||
Sbjct: 2316 caaatggtcggcgagattctccaacggtccctttccggtgacga 2273



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || || ||
Sbjct: 2377 tcactttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagc 2318

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             |  ||||||||||| ||||| |  || ||||| ||||||||||
Sbjct: 2317 caaatggtcggcgagattctccaacggtccctttccggtgacga 2274



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| |||||  ||| ||||||||||||||| |||||||| ||
Sbjct: 859 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 800

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |||||||| || |||||||| |  || ||||| ||||||||||
Sbjct: 799 aaggtggtcagcaaggttctccaatggaccctttccggtgacga 756



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| ||||| ||||||||||||||  | |||||||||||||||||||| ||  | 
Sbjct: 1044 gctcactttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtcca 985

                                                        
Query: 275  gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
            || ||||| |||||||||||||| |  || ||||| ||||||||
Sbjct: 984  gcaaggtgatcggcgaggttctccaatggaccctttccggtgac 941



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           ||||||||||||||||||||| |||||| ||||||| |||||||||   || || || ||
Sbjct: 849 tcacttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagc 790

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            | ||||||| | |||||||| |  |||||||||||||||||||
Sbjct: 789 aatgtggtcgactaggttctcaactgggcccttgccggtgacga 746



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| |||||  ||| ||||||||||||||| |||||||| ||
Sbjct: 1779 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 1720

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             |||||||| || |||||||| |  || ||||| ||||||||||
Sbjct: 1719 aaggtggtcagcaaggttctccaatggaccctttccggtgacga 1676



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 84/98 (85%), Gaps = 1/98 (1%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaag-cccaggcgttgttgttgaccgggtcggcgaggtg 282
           |||||||||||||| ||||| |||| |||| ||||||||||| || ||||| || |||||
Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625

                                                 
Query: 283 gtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||| || |||||||| |  |||||||| ||||||||||
Sbjct: 624 gtcagcaaggttctccaacgggccctttccggtgacga 587



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 gcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgccg 313
           |||||||||||||| |||||||| | ||||||||| |||||||| |  ||||||||||||
Sbjct: 759 gcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgccg 700

                
Query: 314 gtgac 318
           |||||
Sbjct: 699 gtgac 695



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| ||||| |||||||||||||||||||| || ||||| ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgc 292

                                
Query: 277 gaggtggtcggcgaggttctc 297
            ||||| || || ||||||||
Sbjct: 291 aaggtgatcagcaaggttctc 271



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||||||||||||||| ||||||||| | ||||||||||||||| |  | || || ||
Sbjct: 874 tcacttgccgggaacgaaattggtggcgtaggcccaggcgttgttggttgcgggatccgc 815

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            | |||||||  ||| || |||| ||||||||||||||| ||||
Sbjct: 814 caagtggtcgaagagattttcgatggggcccttgccggttacga 771



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           ||||| || |||||||| || ||| | ||||||||||||||| | ||||||||||| |||
Sbjct: 848 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 789

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || || ||||| ||||||| ||| || || ||||||||||
Sbjct: 788 tgatcagcgagattctcgatgggtcctttaccggtgacga 749



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgagg 280
           ||||| || |||||||| || ||| | ||||||||||||||| | ||||||||||| |||
Sbjct: 845 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 786

                                                   
Query: 281 tggtcggcgaggttctcgagggggcccttgccggtgacga 320
           || || ||||| ||||||| ||| || || ||||||||||
Sbjct: 785 tgatcagcgagattctcgatgggtcctttaccggtgacga 746



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcg 286
           ||||| |||||||||||  ||||||||||||| ||||| |||||||| || |||||||||
Sbjct: 877 ggaacaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcg 818

                                           
Query: 287 gcgaggttctcgagggggcccttgccggtgac 318
           || | |||||| || || ||||| || |||||
Sbjct: 817 gccaagttctccagcggaccctttccagtgac 786



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 812 gccaaatggtcagcaaggttctc 790



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 799 gccaaatggtcagcaaggttctc 777



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 813 gccaaatggtcagcaaggttctc 791



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 acgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcg 289
           |||||||||||||| || |||||||| ||||||||||| || ||||| ||||| ||||| 
Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggcc 602

                                  
Query: 290 aggttctcgagggggcccttgcc 312
           | |||||| || || ||||||||
Sbjct: 601 aagttctccagtggccccttgcc 579



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| || ||||| ||||||||||||||||| |||||||| || ||||| || ||||||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776

                                              
Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318
           || || |||||||| |  || ||||| ||||||||
Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgac 741



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 799 gccaaatggtcagcaaggttctc 777



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 806 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 747

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 746 gccaaatggtcagcaaggttctc 724



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 812 gccaaatggtcagcaaggttctc 790



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 742 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 700



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 800

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 799 gccaaatggtcagcaaggttctc 777



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 806 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 747

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 746 gccaaatggtcagcaaggttctc 724



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 806 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 747

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 746 gccaaatggtcagcaaggttctc 724



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 859 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 800

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 799 gccaaatggtcagcaaggttctc 777



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 798 gccaaatggtcagcaaggttctc 776



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 812 gccaaatggtcagcaaggttctc 790



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 812 gccaaatggtcagcaaggttctc 790



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 852 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 793

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 792 gccaaatggtcagcaaggttctc 770



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 858 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 799

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 798 gccaaatggtcagcaaggttctc 776



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 872 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 813

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 812 gccaaatggtcagcaaggttctc 790



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 870 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 811

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 810 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 768



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 176 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 117

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 116 gccaaatggtcagcaaggttctc 94



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 841 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 782

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 781 gccaaatggtcagcaaggttctc 759



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 522 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 463

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 462 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 420



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 752 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 693

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 692 gccaaatggtcagcaaggttctc 670



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 22544 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 22485

                                    
Query: 275   gcgaggtggtcggcgaggttctc 297
             || |  ||||| || ||||||||
Sbjct: 22484 gccaaatggtcagcaaggttctc 22462



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 19898 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 19839

                                    
Query: 275   gcgaggtggtcggcgaggttctc 297
             || |  ||||| || ||||||||
Sbjct: 19838 gccaaatggtcagcaaggttctc 19816



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                         
Query: 215   gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
             |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 16109 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 16168

                                    
Query: 275   gcgaggtggtcggcgaggttctc 297
             || |  ||||| || ||||||||
Sbjct: 16169 gccaaatggtcagcaaggttctc 16191



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 873 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 814

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 813 gccaaatggtcagcaaggttctc 791



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 762



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                        
Query: 216  ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
            ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 1102 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 1043

                                                       
Query: 276  cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
            | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 1042 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 1000



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| |||||||| |||||||||||||| ||||| ||||||||||| || || |||
Sbjct: 1023 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcg 964

                                   
Query: 275  gcgaggtggtcggcgaggttctc 297
            || |  ||||| || ||||||||
Sbjct: 963  gccaaatggtcagcaaggttctc 941



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                        
Query: 215  gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
            |||||||| |||||||| |||||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 1012 gctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcg 953

                                   
Query: 275  gcgaggtggtcggcgaggttctc 297
            || |  ||||| || ||||||||
Sbjct: 952  gccaaatggtcagcaaggttctc 930



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 951 gctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcg 892

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 891 gccaaatggtcagcaaggttctc 869



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273
           |||||||| ||||| ||||||||||| ||||| ||||| |||||||||||||| |||||
Sbjct: 377 gctcactttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| ||||||||||| ||||| ||||| || ||||||||||| || || |
Sbjct: 802 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743

                                                      
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           | | |||||| ||||||||||| |  || ||||| ||||||||
Sbjct: 742 ccaagtggtccgcgaggttctccaacggtccctttccggtgac 700



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| |||||||||||||| |    ||| |||||||||||||| |||||||| | ||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935

                                              
Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318
           ||||| |||| ||| |  |||||||||||||||||
Sbjct: 934 tcggcaaggtcctccaatgggcccttgccggtgac 900



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgtt 264
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 634 gctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| || ||||| |||||||||||||| ||||||||||| || ||||| || ||||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

                         
Query: 284 tcggcgaggttctc 297
           || || ||||||||
Sbjct: 731 tcagcaaggttctc 718



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 762 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703

                                
Query: 277 gaggtggtcggcgaggttctc 297
            |  ||||| || ||||||||
Sbjct: 702 caaatggtcagcaaggttctc 682



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| ||||| || ||||| ||||| || ||||| |||||||||||||| ||||| 
Sbjct: 219 gctcactttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtca 160

                                                    
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggt 315
           | ||  |||||||| |||||||| || || ||||| |||||
Sbjct: 159 gtgatatggtcggcaaggttctctagaggtccctttccggt 119



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| ||||| || ||||| |||||||| ||||| ||||||||||| || ||||| ||
Sbjct: 8571 tcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagc 8630

                              
Query: 277  gaggtggtcggcgaggtt 294
            || |||||| || |||||
Sbjct: 8631 gatgtggtcagcaaggtt 8648



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 804 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745

                                
Query: 277 gaggtggtcggcgaggttctc 297
            |  ||||| || ||||||||
Sbjct: 744 caaatggtcagcaaggttctc 724



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| |||||  | |||||||| |||||||| || ||||| ||
Sbjct: 867 tcactttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgc 808

                                
Query: 277 gaggtggtcggcgaggttctc 297
            ||||||||||| ||||||||
Sbjct: 807 aaggtggtcggcaaggttctc 787



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| ||||| || |||||||||||| | | |||||| |||||||| || ||||| ||
Sbjct: 871 tcactttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagc 812

                                
Query: 277 gaggtggtcggcgaggttctc 297
            ||||||||||| ||||||||
Sbjct: 811 aaggtggtcggctaggttctc 791



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| ||||| || ||||| || |||||||| || ||||| ||
Sbjct: 189 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 130

                                
Query: 277 gaggtggtcggcgaggttctc 297
            |||||||| |||||||||||
Sbjct: 129 aaggtggtcagcgaggttctc 109



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| |||||||||||  | ||||| |||||||||||||| ||||||||
Sbjct: 852 tcactttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793

                                
Query: 277 gaggtggtcggcgaggttctc 297
            || || || || ||||||||
Sbjct: 792 aagatgatcagcaaggttctc 772



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||| ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagc 292

                                
Query: 277 gaggtggtcggcgaggttctc 297
            | ||||||||| || |||||
Sbjct: 291 aatgtggtcggcaagattctc 271



to top

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| ||||| || ||||||||||||||||| || ||||| ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgc 292

                                
Query: 277 gaggtggtcggcgaggttctc 297
            ||||| || || ||||||||
Sbjct: 291 aaggtgatcagcaaggttctc 271



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| |||||  | |||||||| |||||||| || ||||| ||
Sbjct: 5163 tcactttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagc 5104

                                 
Query: 277  gaggtggtcggcgaggttctc 297
             ||||||||||| ||||||||
Sbjct: 5103 aaggtggtcggcaaggttctc 5083



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| |||||  | ||||| ||||||||||| || ||||| ||
Sbjct: 1870 tcactttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagc 1929

                                                        
Query: 277  gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
             || |||||||| |||||||| |  || ||||| ||||||||||
Sbjct: 1930 aagatggtcggcaaggttctccaatggaccctttccggtgacga 1973



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacga 715



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacga 715



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||||
Sbjct: 766 gggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacga 715



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 71/83 (85%), Gaps = 1/83 (1%)
 Strand = Plus / Minus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcg 274
           |||||||| |||||||| ||||||||||| || ||||| |||||||||||||| || |||
Sbjct: 843 gctcactttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcg 785

                                  
Query: 275 gcgaggtggtcggcgaggttctc 297
           || |  ||||| || ||||||||
Sbjct: 784 gccaaatggtcagcaaggttctc 762



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                        
Query: 232  gaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgag 291
            ||||||||||||| |||||||||||||||||  |   || ||||| | ||||||||  | 
Sbjct: 1379 gaagttggtggcgtaagcccaggcgttgttgacggtgggatcggccaagtggtcggacaa 1320

                                       
Query: 292  gttctcgagggggcccttgccggtgac 318
            |||||||| ||||||||| ||||||||
Sbjct: 1319 gttctcgatggggccctttccggtgac 1293



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 274 ggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||||||| |||||||||||||| |||||||| || |||||||
Sbjct: 3   ggcgaggtggtcagcgaggttctcgagcgggcccttaccagtgacga 49



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| || ||||| ||||||||||||||||| |||||||| || ||||| || ||||| 
Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922

                                              
Query: 284 tcggcgaggttctcgagggggcccttgccggtgac 318
           || || |||||||| |  || ||||| ||||||||
Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgac 887



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           ||||||||||||||||||||| | |||||||||||||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttg 801



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           |||||||||||||| || ||||||||||||| ||| ||||| ||||||||
Sbjct: 755 gggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgac 706



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 221  ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
            |||||||||||||||||||||||| | ||||| |||||||||
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           |||||||| ||||| |||||  ||| ||||||||||||||| || ||||| || ||||||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                         
Query: 284 tcggcgaggttctc 297
           || || ||||||||
Sbjct: 731 tctgcaaggttctc 718



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311
           ||||||||||| || | |||| ||| ||||||||||  |||||||  |||||||||||||
Sbjct: 759 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 700

                    
Query: 312 cggtgacga 320
           |||| ||||
Sbjct: 699 cggtcacga 691



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           |||||||||||| |||| || || |||  ||| |||||| |||||||||||   ||||||
Sbjct: 818 ttggtggcgaaaacccatgcattattggcgacagggtcgtcgaggtggtcgaacaggttc 759

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           || |  |||||||||||||||||||
Sbjct: 758 tccaatgggcccttgccggtgacga 734



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| ||||| |||||||| ||||||||||| || || || ||
Sbjct: 1704 tcactttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactggatcagc 1645

                     
Query: 277  gaggtggtc 285
             ||||||||
Sbjct: 1644 aaggtggtc 1636



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| ||||| || ||||| || |||||||| || ||||| ||
Sbjct: 1031 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 972

                                 
Query: 277  gaggtggtcggcgaggttctc 297
             ||||| || |||||||||||
Sbjct: 971  aaggtgatcagcgaggttctc 951



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           |||||| |||||||| |||||||||||| |||||||||| |||||
Sbjct: 964 tcactttccgggaacaaagttggtggcgtaagcccaggcattgtt 920



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311
           ||||||||||| || | ||||| || |||||||| || ||||||| || |||||||||||
Sbjct: 768 aggcgttgttggtgccggggtcagccaggtggtcagccaggttctggatggggcccttgc 709

                    
Query: 312 cggtgacga 320
           |||| ||||
Sbjct: 708 cggtcacga 700



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 aggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgc 311
           ||||||||||| || | |||| ||| ||||||||||  |||||||  |||||||||||||
Sbjct: 743 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 684

                    
Query: 312 cggtgacga 320
           |||| ||||
Sbjct: 683 cggtcacga 675



to top

>gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting complex I protein (Lhca)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1274

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtg 316
           ||||| || |||||||| || ||||| |||||||||||||||||||||
Sbjct: 684 gggtcagccaggtggtcagccaggttgtcgagggggcccttgccggtg 637



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 acttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcga 278
           |||| ||||| ||||||||||| || |||||||| || |||||||| ||||||||    |
Sbjct: 805 actttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtcaaaaa 746

                                                   
Query: 279 ggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           |||||||||| | ||| || || || ||||| ||||||||
Sbjct: 745 ggtggtcggccaagttttccagtggcccctttccggtgac 706



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 255 cgttgttgttgaccgggtcggcgaggtggtcg 286
           ||||||||||||| ||||||||||||||||||
Sbjct: 955 cgttgttgttgacggggtcggcgaggtggtcg 924



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| ||||| |||||| | | ||| ||||||||||| || || |||||
Sbjct: 231 tcactttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggc 172

                                                       
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            || ||||| || |||||||| |  || ||||| ||||||||||
Sbjct: 171 aagatggtcagcaaggttctccaatggaccctttccggtgacga 128



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 226 gggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtc 285
           |||||| ||||| |||||| | | ||| || |||||||| || |||||||| ||||||||
Sbjct: 387 gggaacaaagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtc 328

                       
Query: 286 ggcgaggttctc 297
           ||| ||||||||
Sbjct: 327 ggcaaggttctc 316



to top

>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial
           sequence; nuclear gene for chloroplast product
          Length = 255

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           ||||||| ||||| ||||||||||||||  |||||||||| ||||||
Sbjct: 186 ctcacttcccgggcacgaagttggtggcataagcccaggcattgttg 140



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgac 267
           |||||| ||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 843 tcactttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 55/63 (87%), Gaps = 1/63 (1%)
 Strand = Plus / Plus

                                                                       
Query: 215 gctcacttgccgggaacgaagttggtggcgaaagccc-aggcgttgttgttgaccgggtc 273
           |||||||| |||||||| |||||||| ||||| |||| | |||||||||||||| || ||
Sbjct: 49  gctcactttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatc 108

              
Query: 274 ggc 276
           |||
Sbjct: 109 ggc 111



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 224  ccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
            ||||||||||||||||||||| | ||||| |||||||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttg 2979



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| ||||| || ||||||||||| ||   ||| || |||||||| |||||||| ||
Sbjct: 853 tcactttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagc 794

                                                  
Query: 277 gaggtggtcggcgaggttctcgagggggcccttgccggt 315
            |||||||| |||||||| || |  |||||||| |||||
Sbjct: 793 aaggtggtcagcgaggttttccaatgggccctttccggt 755



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 248  gcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggccc 307
            ||||| ||||||||||| || |||||||| |||||||| || |||||||| |  || |||
Sbjct: 2223 gcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggaccc 2164

                       
Query: 308  ttgccggtgac 318
            || ||||||||
Sbjct: 2163 tttccggtgac 2153



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 287 gcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||||||| ||| ||||||||||||||||
Sbjct: 745 gcgaggttctcgatgggtcccttgccggtgacga 712



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||||||| ||||||||  | |||||||| ||||||
Sbjct: 707 tcacttgccgggaacgaaattggtggcataggcccaggcattgttg 662



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||| ||||||||| | |||||||| ||||||
Sbjct: 586 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 545



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 221 ttgccgggaacgaagttggtggcgaaagcccaggcgttgttg 262
           |||||||||||||| ||||||||| | |||||||| ||||||
Sbjct: 737 ttgccgggaacgaaattggtggcgtaggcccaggcattgttg 696



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| || ||||| |||||  ||| ||||||||||||||| || ||||| || ||||||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                         
Query: 284 tcggcgaggttctc 297
           || || ||||||||
Sbjct: 731 tcagcaaggttctc 718



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 63/74 (85%), Gaps = 1/74 (1%)
 Strand = Plus / Plus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           ||||| || ||||| |||||||||||| || |||||||||| || ||||| || ||||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaag-cgttgttgttaacggggtctgcaaggtgg 64

                         
Query: 284 tcggcgaggttctc 297
           || || ||||||||
Sbjct: 65  tcagcaaggttctc 78



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| |||||||| ||||| |||||  ||||||| || ||||||||||| ||||| ||
Sbjct: 1552 tcactttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagc 1493

                  
Query: 277  gaggtg 282
             |||||
Sbjct: 1492 aaggtg 1487



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 ccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtgg 283
           |||||||| ||||| |||||| | | ||||||||||||||| || ||||| || ||||| 
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285

                         
Query: 284 tcggcgaggttctc 297
           || || ||||||||
Sbjct: 284 tcagcaaggttctc 271



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 250  ccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggccctt 309
            ||||||||||||||| || ||||| || |||||||| || |||||||| |  ||||||||
Sbjct: 5099 ccaggcgttgttgttaacagggtctgcaaggtggtcagcaaggttctccaatgggccctt 5040

                  
Query: 310  gccggt 315
             |||||
Sbjct: 5039 tccggt 5034



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 233  aagttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgagg 292
            ||||| |||||| | | ||||||||||||||| || ||||| || || ||||| || |||
Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagcaagg 2604

                 
Query: 293  ttctc 297
            |||||
Sbjct: 2603 ttctc 2599



to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||||| ||  |||||||||| | | | |||| ||| |||||||| |  ||||||
Sbjct: 444 ttggtggcgaaggcgaaggcgttgttctcggcagggttggccaggtggtcagtcaggttc 385

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           | || ||||||||||||||| ||||
Sbjct: 384 tggatggggcccttgccggtcacga 360



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
           ||||||||||| ||  |||||||||||  |   |||| ||| ||||||||| | ||||||
Sbjct: 782 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 723

                                    
Query: 296 tcgagggggcccttgccggtgacga 320
           | || ||||||||||||||| ||||
Sbjct: 722 tggacggggcccttgccggtcacga 698



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtc 273
           |||||| |||||||| |||||||||||  | ||||| || ||||||||||| |||||
Sbjct: 815 tcactttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                        
Query: 217  tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
            |||||| ||||| || ||||| || ||| ||| ||| ||||||||||| || ||||||||
Sbjct: 1034 tcactttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggc 975

                                 
Query: 277  gaggtggtcggcgaggttctc 297
             ||||| || || ||||||||
Sbjct: 974  aaggtgatcagcaaggttctc 954



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgtt 261
           |||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 873 tcactttccaggaacgaagttggtggcaaaggcccaggcattgtt 829



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           ||||||||||||| | ||||| || ||||| ||||| || |||||||| || ||||| ||
Sbjct: 860 tcacttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgc 801

                                
Query: 277 gaggtggtcggcgaggttctc 297
            || || || |||||||||||
Sbjct: 800 aagatgatcagcgaggttctc 780



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| |||||||| |||||||| ||  | | ||| ||||||||||| || ||||||||
Sbjct: 688 tcactttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggc 629

                                
Query: 277 gaggtggtcggcgaggttctc 297
            || || ||||| ||||||||
Sbjct: 628 aagatgatcggcaaggttctc 608



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                        
Query: 236  ttggtggcgaaagcccaggcgttgttgttgaccgggtcggcgaggtggtcggcgaggttc 295
            ||||||||||| ||  |||||||||||  |   |||| ||| ||||||||| | ||||||
Sbjct: 1803 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 1744

                                     
Query: 296  tcgagggggcccttgccggtgacga 320
            | || ||||||||||||||| ||||
Sbjct: 1743 tggacggggcccttgccggtcacga 1719



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcggc 276
           |||||| ||||| || |||||||||||  | ||||| || ||||||||||| ||||| ||
Sbjct: 992 tcactttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagc 933

                    
Query: 277 gaggtggtc 285
            ||||||||
Sbjct: 932 aaggtggtc 924



to top

>gb|DQ122899.1| Chlamydomonas incerta chloroplast light harvesting complex I
           protein (LhcA) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 746

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtg 316
           ||||| || ||||||||||  ||||| || ||||||||||||||||||
Sbjct: 683 gggtcagccaggtggtcggacaggttgtccagggggcccttgccggtg 636



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 275 gcgaggtggtcggcgaggttctcgagggggcccttgccggtgac 318
           |||||||| || ||||||||||||| ||| ||||| ||||||||
Sbjct: 760 gcgaggtgatcagcgaggttctcgatgggtccctttccggtgac 717



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||| ||||| || ||||||||||||| ||| || || ||||||||||
Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||| ||||| || ||||||||||||| ||| || || ||||||||||
Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||||||| ||||| || ||||||||||||| ||| || || ||||||||||
Sbjct: 766 gggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacga 715



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| ||| ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 722 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 671



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 81/100 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcacttgccgggaacgaagttggtggcgaaagcccaggcgttgttgttgaccgggtcgg 275
           ||||||| ||||| || ||||| |||||  | ||||| || ||||||||||| ||||| |
Sbjct: 851 ctcactttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcag 792

                                                   
Query: 276 cgaggtggtcggcgaggttctcgagggggcccttgccggt 315
           | |||||||| || ||||| || || || ||||| |||||
Sbjct: 791 caaggtggtctgcaaggttttccagcggtccctttccggt 752



to top

>dbj|AB122115.1| Chlamydomonas reinhardtii LhcI-2 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I (Type III),
            complete cds
          Length = 2389

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                        
Query: 256  gttgttgttgaccgggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggt 315
            |||||||||||| ||||| || ||||| ||  | ||||||| || |||||||||||||||
Sbjct: 2214 gttgttgttgacggggtcagccaggtgctccaccaggttctggaaggggcccttgccggt 2155



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| ||| ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 746 gggttggccaggtggtcgtccaggttctggacggggcccttgccggtcacga 695



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 269 gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           |||| ||| ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 738 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 687



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 269  gggtcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
            |||| ||| ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 1419 gggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacga 1368



to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 289   gaggttctcgagggggcccttgccggtgacg 319
             ||||||||||| |||||||| ||||||||||
Sbjct: 40182 gaggttctcgacggggccctcgccggtgacg 40152



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 730 aggtggtcgtccaggttctggatggggcccttgccggtcacga 688



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 731 aggtggtcgtccaggttctggatggggcccttgccggtcacga 689



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 278 aggtggtcggcgaggttctcgagggggcccttgccggtgacga 320
           ||||||||| | ||||||| || ||||||||||||||| ||||
Sbjct: 725 aggtggtcgtccaggttctggacggggcccttgccggtcacga 683



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 289     gaggttctcgagggggcccttgccggtgacg 319
               ||||||||||| |||||||| ||||||||||
Sbjct: 7581096 gaggttctcgacggggccctcgccggtgacg 7581066



to top

>dbj|AB122120.1| Chlamydomonas reinhardtii LhcI-7 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 2261

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 290  aggttctcgagggggcccttgccggtg 316
            ||||| |||||||||||||||||||||
Sbjct: 1868 aggttgtcgagggggcccttgccggtg 1842



to top

>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full
           insert sequence
          Length = 1157

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 289 gaggttctcgagggggcccttgccggtgacg 319
           ||||||||||| |||||||| ||||||||||
Sbjct: 861 gaggttctcgacggggccctcgccggtgacg 831



to top

>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full
           insert sequence
          Length = 1101

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 289 gaggttctcgagggggcccttgccggtgacg 319
           ||||||||||| |||||||| ||||||||||
Sbjct: 851 gaggttctcgacggggccctcgccggtgacg 821



to top

>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full
           insert sequence
          Length = 1186

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 289 gaggttctcgagggggcccttgccggtgacg 319
           ||||||||||| |||||||| ||||||||||
Sbjct: 862 gaggttctcgacggggccctcgccggtgacg 832


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,763,290
Number of Sequences: 3902068
Number of extensions: 2763290
Number of successful extensions: 54731
Number of sequences better than 10.0: 322
Number of HSP's better than 10.0 without gapping: 322
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 53805
Number of HSP's gapped (non-prelim): 920
length of query: 320
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 298
effective length of database: 17,147,199,772
effective search space: 5109865532056
effective search space used: 5109865532056
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top