ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet22a02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC074327.6| Homo sapiens chromosome 10 clone RP11-556E13, com... 44 0.081
2gb|AC025578.26| Homo sapiens 12 BAC RP11-340M11 (Roswell Park Ca... 44 0.081
3gb|AC124959.11| Medicago truncatula clone mth2-23l11, complete s... 42 0.32
4emb|CR931730.1| Medicago truncatula chromosome 5 clone mth2-17o... 42 0.32
5gb|AC153501.2| Mus musculus 10 BAC RP23-79J15 (Roswell Park Canc... 40 1.3
6gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, com... 40 1.3
7gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromo... 40 1.3
8emb|AL603902.4| Human DNA sequence from clone RP11-167I10 on chr... 40 1.3
9emb|AL355538.13| Human DNA sequence from clone RP4-787H6 on chro... 40 1.3
10emb|AL158211.29| Human DNA sequence from clone RP11-573G6 on chr... 40 1.3
11emb|AL109627.18|HSJ733M16 Human DNA sequence from clone RP4-733M... 40 1.3
12gb|AC138511.2| Homo sapiens chromosome 16 clone RP11-22F7, compl... 40 1.3
13emb|CR847783.6| Zebrafish DNA sequence from clone DKEYP-2C8 in l... 40 1.3
14dbj|AK094582.1| Homo sapiens cDNA FLJ37263 fis, clone BRAMY2011064 40 1.3
15gb|AC113435.14| Pan troglodytes clone rp43-153p22, complete sequ... 40 1.3
16gb|AC110742.4| Homo sapiens chromosome 11, clone CTD-2026G22, co... 40 1.3
17gb|AC063962.11| Homo sapiens chromosome 10 clone RP11-222G7, com... 40 1.3
18gb|AC105998.4| Homo sapiens chromosome 8, clone CTC-877B12, comp... 40 1.3
19gb|AC161814.2| Mus musculus BAC clone RP24-120E13 from chromosom... 40 1.3
20gb|AC009091.9| Homo sapiens chromosome 16 clone RP11-408D2, comp... 40 1.3
21gb|AC154553.3| Mus musculus BAC clone RP23-416K11 from chromosom... 40 1.3
22gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Can... 40 1.3
23gb|AC136433.3| Homo sapiens chromosome 16 clone RP11-21C14, comp... 40 1.3
24gb|AC153840.6| Mus musculus 10 BAC RP23-271A22 (Roswell Park Can... 40 1.3
25dbj|AP003400.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 1.3
26gb|AF029215.1|MMOX2S2 Mus musculus MRC OX-2 antigen homolog gene... 40 1.3
27gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence 38 5.0
28gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, com... 38 5.0
29gb|AC108433.9| Mus musculus chromosome 18, clone RP23-194M19, co... 38 5.0
30gb|AC109305.6| Mus musculus chromosome 1, clone RP24-350F5, comp... 38 5.0
31gb|AC121575.4| Mus musculus BAC clone RP23-241P4 from 1, complet... 38 5.0
32ref|XM_673944.1| Plasmodium berghei strain ANKA hypothetical pro... 38 5.0
33emb|AL365496.15| Human DNA sequence from clone RP11-449J3 on chr... 38 5.0
34emb|AL359842.14| Human DNA sequence from clone RP11-388D4 on chr... 38 5.0
35emb|AL162590.15| Human DNA sequence from clone RP11-54K16 on chr... 38 5.0
36emb|AL161935.10| Human DNA sequence from clone RP11-472N13 on ch... 38 5.0
37emb|AL157884.9| Human DNA sequence from clone RP11-462B18 on chr... 38 5.0
38emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on... 38 5.0
39emb|AL022151.2|HS199L16 Human DNA sequence from clone RP1-199L16... 38 5.0
40emb|AJ303345.1|LES303345 Lycopersicon esculentum lateral suppres... 38 5.0
41emb|AJ296334.1|CIN296334 Cichorium intybus X Cichorium endivia p... 38 5.0
42emb|BX322538.9| Zebrafish DNA sequence from clone CH211-245G11 i... 38 5.0
43emb|BX323587.5| Zebrafish DNA sequence from clone CH211-100L3, c... 38 5.0
44gb|AC096773.3| Homo sapiens BAC clone RP11-810P8 from 4, complet... 38 5.0
45gb|AC015553.21|AC015553 Homo sapiens 9 BAC RP11-100N10 (Roswell ... 38 5.0
46emb|BX465859.13| Zebrafish DNA sequence from clone DKEYP-67G10 i... 38 5.0
47gb|AC093596.3| Homo sapiens BAC clone RP11-98M12 from 4, complet... 38 5.0
48gb|DP000029.1| Cercopithecus aethiops target 1 genomic scaffold 38 5.0
49gb|AC010149.8| Homo sapiens BAC clone RP11-395A23 from 2, comple... 38 5.0
50gb|AC005792.1|AC005792 Homo sapiens chromosome 19, BAC CIT-B-978... 38 5.0
51gb|AC142557.3| Cercopithecus aethiops clone CH252-402M4, complet... 38 5.0
52emb|AL928956.11| Mouse DNA sequence from clone RP23-74G16 on chr... 38 5.0
53gb|AC138724.3| Cercopithecus aethiops clone CH252-200P12, comple... 38 5.0 
>gb|AC074327.6| Homo sapiens chromosome 10 clone RP11-556E13, complete sequence
          Length = 189250

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 7      aatcttttcaaataacaaaata 28
              ||||||||||||||||||||||
Sbjct: 163763 aatcttttcaaataacaaaata 163742
to top
>gb|AC025578.26| Homo sapiens 12 BAC RP11-340M11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 115528

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tttcaaataacaaaatacactt 33
             ||||||||||||||||||||||
Sbjct: 22861 tttcaaataacaaaatacactt 22840
to top
>gb|AC124959.11| Medicago truncatula clone mth2-23l11, complete sequence
          Length = 125883

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 7      aatcttttcaaataacaaaat 27
              |||||||||||||||||||||
Sbjct: 107218 aatcttttcaaataacaaaat 107198
to top
>emb|CR931730.1| Medicago truncatula chromosome 5 clone  mth2-17o15, COMPLETE SEQUENCE
          Length = 89342

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 39    acccaaatacaaaaatgcata 59
             |||||||||||||||||||||
Sbjct: 33690 acccaaatacaaaaatgcata 33670
to top
>gb|AC153501.2| Mus musculus 10 BAC RP23-79J15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 251631

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     ttttcaaataacaaaataca 30
              ||||||||||||||||||||
Sbjct: 230697 ttttcaaataacaaaataca 230678
to top
>gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, complete sequence
          Length = 164296

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 5      ataatcttttcaaataacaaaata 28
              |||||||||||||| |||||||||
Sbjct: 101504 ataatcttttcaaaaaacaaaata 101527
to top
>gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromosome 3, complete
              sequence
          Length = 191366

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 11     ttttcaaataacaaaatacactta 34
              ||||| ||||||||||||||||||
Sbjct: 156415 ttttctaataacaaaatacactta 156438
to top
>emb|AL603902.4| Human DNA sequence from clone RP11-167I10 on chromosome 6 Contains the 3'
              end of the TRDN gene for triadin (TDN, TRIADIN), complete
              sequence
          Length = 158024

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 80     atgcaaaacatatagttatt 99
              ||||||||||||||||||||
Sbjct: 140623 atgcaaaacatatagttatt 140604
to top
>emb|AL355538.13| Human DNA sequence from clone RP4-787H6 on chromosome 1, complete
            sequence
          Length = 127051

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 36   ggcacccaaatacaaaaatgcata 59
            |||||||||||||||| |||||||
Sbjct: 7277 ggcacccaaatacaaacatgcata 7254
to top
>emb|AL158211.29| Human DNA sequence from clone RP11-573G6 on chromosome 10 Contains a
            ribosomal protein L31 (RPL31) pseudogene, the BUP gene
            for BUP protein, the BMI1 gene for B lymphoma Mo-MLV
            insertion region (mouse) (MGC12685), the 5' end of the
            SPAG6 gene for sperm associated antigen 6 (pf16,
            MGC26276, Repro-SA-1,DKFZp434I153), the 5' end of a novel
            gene and seven CpG islands, complete sequence
          Length = 138094

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 32   ttatggcacccaaatacaaaaatg 55
            |||||||| |||||||||||||||
Sbjct: 9520 ttatggcagccaaatacaaaaatg 9543
to top
>emb|AL109627.18|HSJ733M16 Human DNA sequence from clone RP4-733M16 on chromosome 1p36.11-36.23
             Contains four novel genes, a novel gene (FLJ33962), a
             novel gene (MGC10731), the 3' end of a novel gene
             (KIAA1332), a  metallothionein family pseudogene and three
             CpG islands, complete sequence
          Length = 120825

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    aaaatgcatacactattcag 69
             ||||||||||||||||||||
Sbjct: 36227 aaaatgcatacactattcag 36246
to top
>gb|AC138511.2| Homo sapiens chromosome 16 clone RP11-22F7, complete sequence
          Length = 149037

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     aaataacaaaatacacttat 35
              ||||||||||||||||||||
Sbjct: 130263 aaataacaaaatacacttat 130282
to top
>emb|CR847783.6| Zebrafish DNA sequence from clone DKEYP-2C8 in linkage group 5, complete
              sequence
          Length = 184144

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      atgataatcttttcaaataa 21
              ||||||||||||||||||||
Sbjct: 149642 atgataatcttttcaaataa 149661
to top
>dbj|AK094582.1| Homo sapiens cDNA FLJ37263 fis, clone BRAMY2011064
          Length = 2518

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 32   ttatggcacccaaatacaaaaatg 55
            |||||||| |||||||||||||||
Sbjct: 2442 ttatggcagccaaatacaaaaatg 2465
to top
>gb|AC113435.14| Pan troglodytes clone rp43-153p22, complete sequence
          Length = 161703

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     aaataacaaaatacacttat 35
              ||||||||||||||||||||
Sbjct: 146773 aaataacaaaatacacttat 146792
to top
>gb|AC110742.4| Homo sapiens chromosome 11, clone CTD-2026G22, complete sequence
          Length = 129095

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     atcttttcaaataacaaaat 27
             ||||||||||||||||||||
Sbjct: 58890 atcttttcaaataacaaaat 58871
to top
>gb|AC063962.11| Homo sapiens chromosome 10 clone RP11-222G7, complete sequence
          Length = 171818

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      aatgataatcttttcaaata 20
              ||||||||||||||||||||
Sbjct: 136720 aatgataatcttttcaaata 136739
to top
>gb|AC105998.4| Homo sapiens chromosome 8, clone CTC-877B12, complete sequence
          Length = 76970

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aaaaatgcatacactattca 68
             ||||||||||||||||||||
Sbjct: 22951 aaaaatgcatacactattca 22932
to top
>gb|AC161814.2| Mus musculus BAC clone RP24-120E13 from chromosome 17, complete sequence
          Length = 196752

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      taatcttttcaaataacaaa 25
              ||||||||||||||||||||
Sbjct: 131186 taatcttttcaaataacaaa 131205
to top
>gb|AC009091.9| Homo sapiens chromosome 16 clone RP11-408D2, complete sequence
          Length = 156273

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    aaataacaaaatacacttat 35
             ||||||||||||||||||||
Sbjct: 24194 aaataacaaaatacacttat 24213
to top
>gb|AC154553.3| Mus musculus BAC clone RP23-416K11 from chromosome 17, complete sequence
          Length = 186842

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      taatcttttcaaataacaaa 25
              ||||||||||||||||||||
Sbjct: 132849 taatcttttcaaataacaaa 132830
to top
>gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 161141

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 11   ttttcaaataacaaaatacactta 34
            ||||| ||||||||||||||||||
Sbjct: 6172 ttttctaataacaaaatacactta 6149
to top
>gb|AC136433.3| Homo sapiens chromosome 16 clone RP11-21C14, complete sequence
          Length = 164765

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    aaataacaaaatacacttat 35
             ||||||||||||||||||||
Sbjct: 19955 aaataacaaaatacacttat 19936
to top
>gb|AC153840.6| Mus musculus 10 BAC RP23-271A22 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 210217

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    ttttcaaataacaaaataca 30
             ||||||||||||||||||||
Sbjct: 19425 ttttcaaataacaaaataca 19406
to top
>dbj|AP003400.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-643G5, complete
             sequence
          Length = 135637

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     atcttttcaaataacaaaat 27
             ||||||||||||||||||||
Sbjct: 64804 atcttttcaaataacaaaat 64785
to top
>gb|AF029215.1|MMOX2S2 Mus musculus MRC OX-2 antigen homolog gene, exons 2-5, and complete
            cds
          Length = 11486

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 5    ataatcttttcaaataacaaaata 28
            |||||||||||||| |||||||||
Sbjct: 3765 ataatcttttcaaaaaacaaaata 3742
to top
>gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence
          Length = 199248

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    caaaacatatagttattca 101
             |||||||||||||||||||
Sbjct: 23491 caaaacatatagttattca 23509
to top
>gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, complete sequence
          Length = 206108

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     caaataacaaaatacactt 33
              |||||||||||||||||||
Sbjct: 121339 caaataacaaaatacactt 121321
to top
>gb|AC108433.9| Mus musculus chromosome 18, clone RP23-194M19, complete sequence
          Length = 188997

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 14   tcaaataacaaaatacact 32
            |||||||||||||||||||
Sbjct: 8014 tcaaataacaaaatacact 8032
to top
>gb|AC109305.6| Mus musculus chromosome 1, clone RP24-350F5, complete sequence
          Length = 184088

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      aatgataatcttttcaaat 19
              |||||||||||||||||||
Sbjct: 128954 aatgataatcttttcaaat 128936
to top
>gb|AC121575.4| Mus musculus BAC clone RP23-241P4 from 1, complete sequence
          Length = 193725

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      aatgataatcttttcaaat 19
              |||||||||||||||||||
Sbjct: 158040 aatgataatcttttcaaat 158022
to top
>ref|XM_673944.1| Plasmodium berghei strain ANKA hypothetical protein (PB100287.00.0)
           partial mRNA
          Length = 180

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  aaatacaaaaatgcataca 61
           |||||||||||||||||||
Sbjct: 90  aaatacaaaaatgcataca 108
to top
>emb|AL365496.15| Human DNA sequence from clone RP11-449J3 on chromosome 10 Contains the 3'
              end of the PCDH15 gene for protocadherin 15 and a novel
              gene, complete sequence
          Length = 173728

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 46     tacaaaaatgcatacacta 64
              |||||||||||||||||||
Sbjct: 146845 tacaaaaatgcatacacta 146827
to top
>emb|AL359842.14| Human DNA sequence from clone RP11-388D4 on chromosome 13 Contains a
             peroxisomal biogenesis factor 12 (PEX12) pseudogene,
             complete sequence
          Length = 136943

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    cttttcaaataacaaaata 28
             |||||||||||||||||||
Sbjct: 45517 cttttcaaataacaaaata 45499
to top
>emb|AL162590.15| Human DNA sequence from clone RP11-54K16 on chromosome 9p13.3-21.1
            Contains a cancer/testis antigen 1 (CTAG1) (LAGE2B)
            pseudogene, the DNAJA1 gene for DnaJ (Hsp40) homolog,
            subfamily A, member 1, the gene for homolog of C. elegans
            smu-1 (SMU-1) (FLJ10805), the 5' end of the  APTX gene
            for aprataxin and 3 CpG islands, complete sequence
          Length = 98271

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    aatgataatcttttcaaat 19
            |||||||||||||||||||
Sbjct: 8786 aatgataatcttttcaaat 8804
to top
>emb|AL161935.10| Human DNA sequence from clone RP11-472N13 on chromosome 10 Contains the
              3' end of the TCF8 gene for transcription factor 8
              (represses interleukin 2 expression),  two novel genes, the
              glutamate dehydrogenase pseudogene 5 (GLUDP5) and a CpG
              island, complete sequence
          Length = 191824

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      aatcttttcaaataacaaa 25
              |||||||||||||||||||
Sbjct: 134749 aatcttttcaaataacaaa 134731
to top
>emb|AL157884.9| Human DNA sequence from clone RP11-462B18 on chromosome 9p13.1-21.1
             Contains a pseudogene similar to part of membrane guanylyl
             cyclase, a ribosomal protein S11 (RPS11) pseudogene, a
             novel gene and a CpG island, complete sequence
          Length = 176932

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 15    caaataacaaaatacacttatgg 37
             ||||||||||||||| |||||||
Sbjct: 99427 caaataacaaaatacccttatgg 99405
to top
>emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on chromosome 1p34.1-35.3
             Contains the 3' end of the ZBTB8 gene for zinc finger and
             BTB domain containing 8, the 3' end of the gene for
             archease (ARCH) and two CpG islands, complete sequence
          Length = 147167

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 11    ttttcaaataacaaaatacactt 33
             |||||||||||| ||||||||||
Sbjct: 10632 ttttcaaataactaaatacactt 10610
to top
>emb|AL022151.2|HS199L16 Human DNA sequence from clone RP1-199L16 on chromosome Xq22.1-22.3
             Contains a ribosomal protein S29 (RPS29) pseudogene,
             complete sequence
          Length = 134963

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     atcttttcaaataacaaaa 26
             |||||||||||||||||||
Sbjct: 18762 atcttttcaaataacaaaa 18744
to top
>emb|AJ303345.1|LES303345 Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2
          Length = 57047

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     tcttttcaaataacaaaat 27
             |||||||||||||||||||
Sbjct: 17768 tcttttcaaataacaaaat 17750
to top
>emb|AJ296334.1|CIN296334 Cichorium intybus X Cichorium endivia partial mRNA for GTP binding
           protein (chi3153 gene)
          Length = 749

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 13  ttcaaataacaaaatacac 31
           |||||||||||||||||||
Sbjct: 661 ttcaaataacaaaatacac 643
to top
>emb|BX322538.9| Zebrafish DNA sequence from clone CH211-245G11 in linkage group 15,
            complete sequence
          Length = 159879

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    ataatcttttcaaataaca 23
            |||||||||||||||||||
Sbjct: 6733 ataatcttttcaaataaca 6715
to top
>emb|BX323587.5| Zebrafish DNA sequence from clone CH211-100L3, complete sequence
          Length = 90800

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    tttcaaataacaaaataca 30
             |||||||||||||||||||
Sbjct: 37963 tttcaaataacaaaataca 37945
to top
>gb|AC096773.3| Homo sapiens BAC clone RP11-810P8 from 4, complete sequence
          Length = 136403

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     cttatggcacccaaataca 49
              |||||||||||||||||||
Sbjct: 105724 cttatggcacccaaataca 105706
to top
>gb|AC015553.21|AC015553 Homo sapiens 9 BAC RP11-100N10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162063

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 15    caaataacaaaatacacttatgg 37
             ||||||||||||||| |||||||
Sbjct: 38858 caaataacaaaatacccttatgg 38836
to top
>emb|BX465859.13| Zebrafish DNA sequence from clone DKEYP-67G10 in linkage group 4,
             complete sequence
          Length = 214205

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    aaatacaaaaatgcataca 61
             |||||||||||||||||||
Sbjct: 79548 aaatacaaaaatgcataca 79530
to top
>gb|AC093596.3| Homo sapiens BAC clone RP11-98M12 from 4, complete sequence
          Length = 152347

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    aaaacatatagttattcaa 102
             |||||||||||||||||||
Sbjct: 76690 aaaacatatagttattcaa 76672
to top
>gb|DP000029.1| Cercopithecus aethiops target 1 genomic scaffold
          Length = 1825024

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     caaaacatatagttattca 101
              |||||||||||||||||||
Sbjct: 528206 caaaacatatagttattca 528224
to top
>gb|AC010149.8| Homo sapiens BAC clone RP11-395A23 from 2, complete sequence
          Length = 172132

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    cttttcaaataacaaaata 28
             |||||||||||||||||||
Sbjct: 92768 cttttcaaataacaaaata 92750
to top
>gb|AC005792.1|AC005792 Homo sapiens chromosome 19, BAC CIT-B-978SK-259j21, complete sequence
          Length = 81357

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     taatcttttcaaataacaa 24
             |||||||||||||||||||
Sbjct: 42831 taatcttttcaaataacaa 42813
to top
>gb|AC142557.3| Cercopithecus aethiops clone CH252-402M4, complete sequence
          Length = 150854

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     caaaacatatagttattca 101
              |||||||||||||||||||
Sbjct: 142899 caaaacatatagttattca 142917
to top
>emb|AL928956.11| Mouse DNA sequence from clone RP23-74G16 on chromosome 2, complete
              sequence
          Length = 174347

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 43     aaatacaaaaatgcataca 61
              |||||||||||||||||||
Sbjct: 113708 aaatacaaaaatgcataca 113690
to top
>gb|AC138724.3| Cercopithecus aethiops clone CH252-200P12, complete sequence
          Length = 173770

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 83   caaaacatatagttattca 101
            |||||||||||||||||||
Sbjct: 1073 caaaacatatagttattca 1091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,319,721
Number of Sequences: 3902068
Number of extensions: 2319721
Number of successful extensions: 136056
Number of sequences better than 10.0: 53
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135904
Number of HSP's gapped (non-prelim): 152
length of query: 110
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 89
effective length of database: 17,151,101,840
effective search space: 1526448063760
effective search space used: 1526448063760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top