ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet18a02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC073429.6| Homo sapiens BAC clone RP11-775H9 from 4, complet... 44 0.14
2ref|XM_719253.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 2.1
3gb|AC110799.3| Homo sapiens BAC clone RP11-663P9 from 4, complet... 40 2.1
4emb|BX936295.3| Mouse DNA sequence from clone RP23-256P1 on chro... 40 2.1
5gb|AC124395.5| Mus musculus BAC clone RP24-342J3 from 13, comple... 40 2.1
6gb|AC005548.1|AC005548 Homo sapiens chromosome 17, clone hRPK.75... 40 2.1
7ref|XM_675348.1| Plasmodium berghei strain ANKA DNAJ protein (PB... 40 2.1
8gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 38 8.4
9gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 38 8.4
10gb|AC119573.9| Mus musculus chromosome 15, clone RP23-75H23, com... 38 8.4
11gb|AC111143.10| Mus musculus chromosome 3, clone RP23-372C7, com... 38 8.4
12gb|AE009379.1| Agrobacterium tumefaciens str. C58 linear chromos... 38 8.4
13gb|AE008236.1| Agrobacterium tumefaciens str. C58 linear chromos... 38 8.4
14emb|CT025590.5| Mouse DNA sequence from clone RP24-132A1 on chro... 38 8.4
15gb|AC124743.5| Mus musculus BAC clone RP23-219C1 from 1, complet... 38 8.4
16gb|AC121567.3| Mus musculus BAC clone RP23-225D14 from 14, compl... 38 8.4
17ref|XM_760331.1| Theileria parva strain Muguga hypothetical prot... 38 8.4
18gb|AC154580.2| Mus musculus BAC clone RP23-380H1 from chromosome... 38 8.4
19gb|AC163332.3| Mus musculus chromosome 15, clone RP24-344C17, co... 38 8.4
20emb|AL627231.9| Human DNA sequence from clone RP13-147D17 on chr... 38 8.4
21emb|AL627133.5| Human DNA sequence from clone RP11-378O9 on chro... 38 8.4
22emb|AL589939.2| Human DNA sequence from clone RP11-117O13 on chr... 38 8.4
23emb|AL139114.12| Human DNA sequence from clone RP11-328C23 on ch... 38 8.4
24emb|AL132655.13|HSJ806M20 Human DNA sequence from clone RP4-806M... 38 8.4
25emb|AL109925.11|HSDJ534K7 Human DNA sequence from clone RP4-534K... 38 8.4
26emb|AL049860.8|HSDJ304O5 Human DNA sequence from clone RP1-304O5... 38 8.4
27gb|AC163448.2| Mus musculus chromosome 1, clone RP24-327O21, com... 38 8.4
28emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N2... 38 8.4
29emb|BX571863.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 38 8.4
30emb|AL663107.13| Mouse DNA sequence from clone RP23-465K20 on ch... 38 8.4
31emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, ... 38 8.4
32emb|AL021960.2|ATF7J7 Arabidopsis thaliana DNA chromosome 4, BAC... 38 8.4
33gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, co... 38 8.4
34gb|AC013558.10| Homo sapiens chromosome 18, clone RP11-41O4, com... 38 8.4
35gb|AC068457.5| Homo sapiens chromosome 11, clone RP11-582N4, com... 38 8.4
36gb|AC150891.3| Medicago truncatula chromosome 2 BAC clone mth2-7... 38 8.4
37gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell ... 38 8.4
38gb|AC107067.3| Homo sapiens BAC clone RP11-10L7 from 4, complete... 38 8.4
39gb|AC153896.10| Mus musculus 10 BAC RP23-114D16 (Roswell Park Ca... 38 8.4
40gb|AC008410.6| Homo sapiens chromosome 5 clone CTC-280C13, compl... 38 8.4
41gb|AC007067.4|AC007067 Genomic sequence for Arabidopsis thaliana... 38 8.4
42gb|AC153433.6| Mus musculus 10 BAC RP23-69K22 (Roswell Park Canc... 38 8.4
43gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome 38 8.4
44emb|CT572983.7| Mouse DNA sequence from clone RP23-110N1 on chro... 38 8.4
45emb|AL671090.9| Mouse DNA sequence from clone RP23-154A10 on chr... 38 8.4 
>gb|AC073429.6| Homo sapiens BAC clone RP11-775H9 from 4, complete sequence
          Length = 114909

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 136   tgaaagaaaacaaaatcctttc 157
             ||||||||||||||||||||||
Sbjct: 80323 tgaaagaaaacaaaatcctttc 80344
to top
>ref|XM_719253.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04093)
           partial mRNA
          Length = 1869

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 12  tttgtaaacatttcagcaaa 31
           ||||||||||||||||||||
Sbjct: 518 tttgtaaacatttcagcaaa 499
to top
>gb|AC110799.3| Homo sapiens BAC clone RP11-663P9 from 4, complete sequence
          Length = 125785

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   atgctcaatgaaagaaaaca 147
             ||||||||||||||||||||
Sbjct: 93735 atgctcaatgaaagaaaaca 93716
to top
>emb|BX936295.3| Mouse DNA sequence from clone RP23-256P1 on chromosome 2, complete
             sequence
          Length = 56898

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ctcaatgaaagaaaacaaaa 150
             ||||||||||||||||||||
Sbjct: 24488 ctcaatgaaagaaaacaaaa 24469
to top
>gb|AC124395.5| Mus musculus BAC clone RP24-342J3 from 13, complete sequence
          Length = 147971

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     agctttgtaaacatttcagc 28
             ||||||||||||||||||||
Sbjct: 83679 agctttgtaaacatttcagc 83698
to top
>gb|AC005548.1|AC005548 Homo sapiens chromosome 17, clone hRPK.756_K_11, complete sequence
          Length = 156811

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 139  aagaaaacaaaatcctttcc 158
            ||||||||||||||||||||
Sbjct: 2494 aagaaaacaaaatcctttcc 2513
to top
>ref|XM_675348.1| Plasmodium berghei strain ANKA DNAJ protein (PB001261.02.0),
           partial mRNA
          Length = 1848

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 12  tttgtaaacatttcagcaaa 31
           ||||||||||||||||||||
Sbjct: 512 tttgtaaacatttcagcaaa 493
to top
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 22     tttcagcaaacccgcaggcttta 44
              |||||||||||| ||||||||||
Sbjct: 248306 tttcagcaaacctgcaggcttta 248284
to top
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 22     tttcagcaaacccgcaggcttta 44
              |||||||||||| ||||||||||
Sbjct: 248120 tttcagcaaacctgcaggcttta 248098
to top
>gb|AC119573.9| Mus musculus chromosome 15, clone RP23-75H23, complete sequence
          Length = 216297

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 138    aaagaaaacaaaatccttt 156
              |||||||||||||||||||
Sbjct: 192888 aaagaaaacaaaatccttt 192906
to top
>gb|AC111143.10| Mus musculus chromosome 3, clone RP23-372C7, complete sequence
          Length = 147125

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 138   aaagaaaacaaaatccttt 156
             |||||||||||||||||||
Sbjct: 86184 aaagaaaacaaaatccttt 86166
to top
>gb|AE009379.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 149 of
            187 of the complete sequence
          Length = 13623

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 100  attccatcgagcacatgga 118
            |||||||||||||||||||
Sbjct: 2093 attccatcgagcacatgga 2075
to top
>gb|AE008236.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 40 of
           187 of the complete sequence
          Length = 10396

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 100 attccatcgagcacatgga 118
           |||||||||||||||||||
Sbjct: 899 attccatcgagcacatgga 917
to top
>emb|CT025590.5| Mouse DNA sequence from clone RP24-132A1 on chromosome 14, complete
              sequence
          Length = 193572

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 132    tcaatgaaagaaaacaaaa 150
              |||||||||||||||||||
Sbjct: 104942 tcaatgaaagaaaacaaaa 104924
to top
>gb|AC124743.5| Mus musculus BAC clone RP23-219C1 from 1, complete sequence
          Length = 220167

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 133    caatgaaagaaaacaaaat 151
              |||||||||||||||||||
Sbjct: 140870 caatgaaagaaaacaaaat 140852
to top
>gb|AC121567.3| Mus musculus BAC clone RP23-225D14 from 14, complete sequence
          Length = 165586

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     tttgtaaacatttcagcaa 30
              |||||||||||||||||||
Sbjct: 127365 tttgtaaacatttcagcaa 127347
to top
>ref|XM_760331.1| Theileria parva strain Muguga hypothetical protein (TP02_0856)
            partial mRNA
          Length = 1365

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 84   ttgaaaaactcaagtcatt 102
            |||||||||||||||||||
Sbjct: 1163 ttgaaaaactcaagtcatt 1181
to top
>gb|AC154580.2| Mus musculus BAC clone RP23-380H1 from chromosome 14, complete sequence
          Length = 187377

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 132   tcaatgaaagaaaacaaaa 150
             |||||||||||||||||||
Sbjct: 45163 tcaatgaaagaaaacaaaa 45181
to top
>gb|AC163332.3| Mus musculus chromosome 15, clone RP24-344C17, complete sequence
          Length = 164408

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 138    aaagaaaacaaaatccttt 156
              |||||||||||||||||||
Sbjct: 113757 aaagaaaacaaaatccttt 113739
to top
>emb|AL627231.9| Human DNA sequence from clone RP13-147D17 on chromosome X Contains a
              filamin-binding LIM protein-1 (FBLP-1) pseudogene, complete
              sequence
          Length = 146366

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 134    aatgaaagaaaacaaaatc 152
              |||||||||||||||||||
Sbjct: 144969 aatgaaagaaaacaaaatc 144951
to top
>emb|AL627133.5| Human DNA sequence from clone RP11-378O9 on chromosome X, complete
             sequence
          Length = 129007

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 134   aatgaaagaaaacaaaatc 152
             |||||||||||||||||||
Sbjct: 62791 aatgaaagaaaacaaaatc 62809
to top
>emb|AL589939.2| Human DNA sequence from clone RP11-117O13 on chromosome 6 Contains the
             5' end of the GOPC gene for golgi associated PDZ and
             coiled-coil motif containing, a novel pseudogene and a CpG
             island, complete sequence
          Length = 62197

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 127   aatgctcaatgaaagaaaa 145
             |||||||||||||||||||
Sbjct: 23369 aatgctcaatgaaagaaaa 23351
to top
>emb|AL139114.12| Human DNA sequence from clone RP11-328C23 on chromosome 9p22.3-24.1,
              complete sequence
          Length = 132139

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 128    atgctcaatgaaagaaaac 146
              |||||||||||||||||||
Sbjct: 115126 atgctcaatgaaagaaaac 115144
to top
>emb|AL132655.13|HSJ806M20 Human DNA sequence from clone RP4-806M20 on chromosome 20 Contains a
             novel pseudogene, the 5' end of the GNAS complex locus and
             a CpG island, complete sequence
          Length = 126586

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 130   gctcaatgaaagaaaacaa 148
             |||||||||||||||||||
Sbjct: 34001 gctcaatgaaagaaaacaa 33983
to top
>emb|AL109925.11|HSDJ534K7 Human DNA sequence from clone RP4-534K7 on chromosome 1p31.2-32.3
             Contains the 3' end of gene KIAA1799, the gene for a novel
             protein similar to deleted in lymphocytic leukemia 2
             (DLEU2), the 5' end of a variant of the ITGB3BP gene for
             integrin beta 3 binding protein (beta3-endonexin) and the
             PGM1 gene for phosphoglucomutase 1, complete sequence
          Length = 152583

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 136   tgaaagaaaacaaaatcct 154
             |||||||||||||||||||
Sbjct: 53451 tgaaagaaaacaaaatcct 53469
to top
>emb|AL049860.8|HSDJ304O5 Human DNA sequence from clone RP1-304O5 on chromosome 6q12-13, complete
             sequence
          Length = 96467

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 133   caatgaaagaaaacaaaat 151
             |||||||||||||||||||
Sbjct: 47085 caatgaaagaaaacaaaat 47067
to top
>gb|AC163448.2| Mus musculus chromosome 1, clone RP24-327O21, complete sequence
          Length = 150247

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 133    caatgaaagaaaacaaaat 151
              |||||||||||||||||||
Sbjct: 115004 caatgaaagaaaacaaaat 115022
to top
>emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N21 on chromosome 20p12.3-13
             Contains the CHGB gene for chromogranin B (secretogranin
             1), a novel pseudogene, the gene for CGI-09 protein
             (CGI-09), the C20orf154 gene for a novel MCM2/3/5 family
             member, a pseudogene similar to part of cytochrome c
             oxidase I, the C20orf155 gene for a novel CDP-alcohol
             phosphatidyltransferase family member, the 3' end of a
             novel gene and four CpG islands, complete sequence
          Length = 139352

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 140   agaaaacaaaatcctttcc 158
             |||||||||||||||||||
Sbjct: 24089 agaaaacaaaatcctttcc 24107
to top
>emb|BX571863.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              5/17
          Length = 349318

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aaacccgcaggctttagcg 47
              |||||||||||||||||||
Sbjct: 107069 aaacccgcaggctttagcg 107051
to top
>emb|AL663107.13| Mouse DNA sequence from clone RP23-465K20 on chromosome 11 Contains a
            novel gene (2210415F13Rik), an NADH dehydrogenase
            (ubiquinone) Fe-S protein 3 (Ndufs3) pseudogene, a novel
            pseudogene, a novel gene (1810065E05Rik), a novel gene
            similar to rat solute carrier family 11 member 1
            (Slc11a1), a novel gene, the  Olfr30 gene for olfactory
            receptor 30, an olfactory receptor (MOR284-1P)
            pseudogene, the gene for olfactory receptor MOR284-2
            (LOC216774),  a novel gene similar to MOR275 (LOC193140),
            a ribosomal protein L24 (Rpl24) pseudogene, the gene for
            olfactory receptor MOR275-1, a DEAD (Asp-Glu-Ala-Asp) box
            polypeptide 5 (Ddx5) pseudogene, an olfactory receptor
            (MOR275-3) pseudogene and a CpG island, complete sequence
          Length = 191700

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 137  gaaagaaaacaaaatcctt 155
            |||||||||||||||||||
Sbjct: 8422 gaaagaaaacaaaatcctt 8440
to top
>emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 54
          Length = 198715

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 132   tcaatgaaagaaaacaaaa 150
             |||||||||||||||||||
Sbjct: 80117 tcaatgaaagaaaacaaaa 80099
to top
>emb|AL021960.2|ATF7J7 Arabidopsis thaliana DNA chromosome 4, BAC clone  F7J7 (ESSA project)
          Length = 91387

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 132   tcaatgaaagaaaacaaaa 150
             |||||||||||||||||||
Sbjct: 21914 tcaatgaaagaaaacaaaa 21896
to top
>gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, complete sequence
          Length = 197907

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 137   gaaagaaaacaaaatcctt 155
             |||||||||||||||||||
Sbjct: 92082 gaaagaaaacaaaatcctt 92100
to top
>gb|AC013558.10| Homo sapiens chromosome 18, clone RP11-41O4, complete sequence
          Length = 133557

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 48    ctggcaatgcaagaacaagtacg 70
             ||||||||||| |||||||||||
Sbjct: 40116 ctggcaatgcaggaacaagtacg 40094
to top
>gb|AC068457.5| Homo sapiens chromosome 11, clone RP11-582N4, complete sequence
          Length = 172516

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 137    gaaagaaaacaaaatcctt 155
              |||||||||||||||||||
Sbjct: 139260 gaaagaaaacaaaatcctt 139242
to top
>gb|AC150891.3| Medicago truncatula chromosome 2 BAC clone mth2-76a9, complete sequence
          Length = 142579

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    ctggcaatgcaagaacaag 66
             |||||||||||||||||||
Sbjct: 22717 ctggcaatgcaagaacaag 22735
to top
>gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 140597

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 138   aaagaaaacaaaatccttt 156
             |||||||||||||||||||
Sbjct: 35904 aaagaaaacaaaatccttt 35922
to top
>gb|AC107067.3| Homo sapiens BAC clone RP11-10L7 from 4, complete sequence
          Length = 112291

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 138    aaagaaaacaaaatccttt 156
              |||||||||||||||||||
Sbjct: 105688 aaagaaaacaaaatccttt 105670
to top
>gb|AC153896.10| Mus musculus 10 BAC RP23-114D16 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 206003

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 133   caatgaaagaaaacaaaat 151
             |||||||||||||||||||
Sbjct: 35370 caatgaaagaaaacaaaat 35352
to top
>gb|AC008410.6| Homo sapiens chromosome 5 clone CTC-280C13, complete sequence
          Length = 133218

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    aaaactcaagtcattccat 106
             |||||||||||||||||||
Sbjct: 52808 aaaactcaagtcattccat 52826
to top
>gb|AC007067.4|AC007067 Genomic sequence for Arabidopsis thaliana BAC T10O24 from Chromosome 1,
             complete sequence
          Length = 89934

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 127   aatgctcaatgaaagaaaa 145
             |||||||||||||||||||
Sbjct: 77878 aatgctcaatgaaagaaaa 77896
to top
>gb|AC153433.6| Mus musculus 10 BAC RP23-69K22 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 200061

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 133    caatgaaagaaaacaaaat 151
              |||||||||||||||||||
Sbjct: 167160 caatgaaagaaaacaaaat 167142
to top
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 22     tttcagcaaacccgcaggcttta 44
              |||||||||| ||||||||||||
Sbjct: 428383 tttcagcaaatccgcaggcttta 428405
to top
>emb|CT572983.7| Mouse DNA sequence from clone RP23-110N1 on chromosome 14, complete
              sequence
          Length = 218673

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 134    aatgaaagaaaacaaaatc 152
              |||||||||||||||||||
Sbjct: 120183 aatgaaagaaaacaaaatc 120165
to top
>emb|AL671090.9| Mouse DNA sequence from clone RP23-154A10 on chromosome 4, complete
              sequence
          Length = 197665

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 139    aagaaaacaaaatcctttc 157
              |||||||||||||||||||
Sbjct: 113299 aagaaaacaaaatcctttc 113317


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,907,259
Number of Sequences: 3902068
Number of extensions: 1907259
Number of successful extensions: 208538
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 208333
Number of HSP's gapped (non-prelim): 205
length of query: 173
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 151
effective length of database: 17,147,199,772
effective search space: 2589227165572
effective search space used: 2589227165572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top