ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet16d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulga... 486 e-134
2gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding p... 206 3e-50
3gb|AY106149.1| Zea mays PCO102434 mRNA sequence 131 2e-27
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 117 2e-23
5dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic D... 117 2e-23
6dbj|AK098864.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
7dbj|AK060904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
8dbj|AK060800.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
9gb|AF094776.1|AF094776 Oryza sativa chlorophyll a/b-binding prot... 117 2e-23
10gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 44 0.28
11gb|AC164646.3| Mus musculus BAC clone RP24-262I1 from chromosome... 42 1.1
12emb|AL833798.8| Mouse DNA sequence from clone RP23-130L21 on chr... 42 1.1
13ref|NM_180375.1| Arabidopsis thaliana LHCA1 AT3G54890 (LHCA1) tr... 40 4.3
14ref|NM_180374.1| Arabidopsis thaliana LHCA1 AT3G54890 (LHCA1) tr... 40 4.3
15ref|NM_115346.2| Arabidopsis thaliana LHCA1; chlorophyll binding... 40 4.3
16gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome 40 4.3
17gb|BT000852.1| Arabidopsis thaliana At3g54890/F28P10_130 mRNA, c... 40 4.3
18gb|AF339688.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 40 4.3
19gb|AF326866.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 40 4.3
20emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 4.3
21emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 4.3
22gb|AY094437.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, c... 40 4.3
23gb|AF361847.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, c... 40 4.3
24gb|AY070473.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, c... 40 4.3
25gb|AF325016.2|AF325016 Arabidopsis thaliana AT3g54890 (AT3g54890... 40 4.3
26gb|AF324692.2|AF324692 Arabidopsis thaliana AT3g54890 (AT3g54890... 40 4.3
27emb|BX823678.1|CNS0A7B9 Arabidopsis thaliana Full-length cDNA Co... 40 4.3
28emb|BX823620.1|CNS0A7BA Arabidopsis thaliana Full-length cDNA Co... 40 4.3
29emb|BX822994.1|CNS0A7CC Arabidopsis thaliana Full-length cDNA Co... 40 4.3
30emb|BX822507.1|CNS0A73P Arabidopsis thaliana Full-length cDNA Co... 40 4.3
31emb|BX825357.1|CNS0A6D9 Arabidopsis thaliana Full-length cDNA Co... 40 4.3
32gb|AC073415.6| Homo sapiens BAC clone RP11-84C2 from 2, complete... 40 4.3
33emb|X56062.1|ATCABI A.thaliana Cab mRNA for photossystem I chlor... 40 4.3
34dbj|AP006865.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 4.3
35gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06,... 40 4.3
36gb|M85150.1|ATHCAB6P Arabidopsis thaliana chlorophyll A/B-bindin... 40 4.3

>gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 878 nt]
          Length = 878

 Score =  486 bits (245), Expect = e-134
 Identities = 297/311 (95%), Gaps = 10/311 (3%)
 Strand = Plus / Minus

                                                                       
Query: 19  ttcacaacagcggccgctacttaagctttacacattacaaaggttgccggccggagagcc 78
           ||||||||||||||||||||||||||||||||||||||||||||||||      ||||||
Sbjct: 863 ttcacaacagcggccgctacttaagctttacacattacaaaggttgccc-----agagcc 809

                                                                       
Query: 79  gacgttgttgtacagttccagcacgcacggacggtgcgcgcgcagagccagcgtggcaag 138
            ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 808 -acgttgttgtacagttccagcacgcacggacggtgcgcgcg-agagccagcgtggcaag 751

                                                                       
Query: 139 gtgatcaaccaatggatcgactcagaaacatgaatgaaaaccatgcgctccggctcctcg 198
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 gtgatcaaccaatggatcgactcagaaacatgaatgaaaaccatgcgctccggctcctcg 691

                                                                       
Query: 199 atctcctctcagcccggtcggctccgctcaagggccgtagatatttctggggatgacgat 258
           |||||    |||||||||||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 690 atctcg---cagcccggtcgcgtccgctcaagggccgtagatatttctggggatgacgat 634

                                                                       
Query: 259 gtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctccagcgggcc 318
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 633 gtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctccagcgggcc 574

                      
Query: 319 ggtgccggggt 329
           |||||||||||
Sbjct: 573 ggtgccggggt 563



to top

>gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding protein precursor (lhca1)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 784

 Score =  206 bits (104), Expect = 3e-50
 Identities = 104/104 (100%)
 Strand = Plus / Minus

                                                                       
Query: 226 tcaagggccgtagatatttctggggatgacgatgtcgccgatgttgttgtgccacgggtc 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 784 tcaagggccgtagatatttctggggatgacgatgtcgccgatgttgttgtgccacgggtc 725

                                                       
Query: 286 cgcgaggtgcgtggccaggttctccagcgggccggtgccggggt 329
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 724 cgcgaggtgcgtggccaggttctccagcgggccggtgccggggt 681



to top

>gb|AY106149.1| Zea mays PCO102434 mRNA sequence
          Length = 1081

 Score =  131 bits (66), Expect = 2e-27
 Identities = 81/86 (94%)
 Strand = Plus / Minus

                                                                       
Query: 244 tctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccag 303
           ||||||||||| |||||||||||||||||||||||||||||| |||||||| | ||| ||
Sbjct: 787 tctggggatgatgatgtcgccgatgttgttgtgccacgggtcggcgaggtgggaggcgag 728

                                     
Query: 304 gttctccagcgggccggtgccggggt 329
           ||||||||||||||||||||||||||
Sbjct: 727 gttctccagcgggccggtgccggggt 702



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                            
Query: 243      ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
                |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 12296597 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 12296538

                                           
Query: 303      ggttctccagcgggccggtgccggggt 329
                |||||||||| ||||||||||| ||||
Sbjct: 12296537 ggttctccagtgggccggtgcccgggt 12296511



to top

>dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0578B12
          Length = 151192

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                         
Query: 243   ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
             |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 13057 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 12998

                                        
Query: 303   ggttctccagcgggccggtgccggggt 329
             |||||||||| ||||||||||| ||||
Sbjct: 12997 ggttctccagtgggccggtgcccgggt 12971



to top

>dbj|AK098864.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001A03, full
           insert sequence
          Length = 1046

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
           |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 797 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 738

                                      
Query: 303 ggttctccagcgggccggtgccggggt 329
           |||||||||| ||||||||||| ||||
Sbjct: 737 ggttctccagtgggccggtgcccgggt 711



to top

>dbj|AK060904.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-E07, full
           insert sequence
          Length = 1051

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
           |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 802 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 743

                                      
Query: 303 ggttctccagcgggccggtgccggggt 329
           |||||||||| ||||||||||| ||||
Sbjct: 742 ggttctccagtgggccggtgcccgggt 716



to top

>dbj|AK060800.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-F04, full
           insert sequence
          Length = 1958

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
           |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 799 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 740

                                      
Query: 303 ggttctccagcgggccggtgccggggt 329
           |||||||||| ||||||||||| ||||
Sbjct: 739 ggttctccagtgggccggtgcccgggt 713



to top

>gb|AF094776.1|AF094776 Oryza sativa chlorophyll a/b-binding protein precursor (Cab26)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1050

 Score =  117 bits (59), Expect = 2e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttctggggatgacgatgtcgccgatgttgttgtgccacgggtccgcgaggtgcgtggcca 302
           |||| ||||||| |||||||||||||||||||||||||||||||| ||||||  ||||||
Sbjct: 782 ttctcgggatgatgatgtcgccgatgttgttgtgccacgggtccgagaggtggctggcca 723

                                      
Query: 303 ggttctccagcgggccggtgccggggt 329
           |||||||||| ||||||||||| ||||
Sbjct: 722 ggttctccagtgggccggtgcccgggt 696



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 182     tgcgctccggctcctcgatctcctctcagcccgg 215
               ||||||||| ||| ||||||||||| ||||||||
Sbjct: 3125637 tgcgctccgcctcgtcgatctcctcacagcccgg 3125670



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 302     aggttctccagcgggccggt 321
               ||||||||||||||||||||
Sbjct: 2368843 aggttctccagcgggccggt 2368824



to top

>gb|AC164646.3| Mus musculus BAC clone RP24-262I1 from chromosome 3, complete sequence
          Length = 175326

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 162   agaaacatgaatgaaaaccat 182
             |||||||||||||||||||||
Sbjct: 96766 agaaacatgaatgaaaaccat 96786



to top

>emb|AL833798.8| Mouse DNA sequence from clone RP23-130L21 on chromosome 4, complete
             sequence
          Length = 214799

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 159   ctcagaaacatgaatgaaaac 179
             |||||||||||||||||||||
Sbjct: 24328 ctcagaaacatgaatgaaaac 24308



to top

>ref|NM_180375.1| Arabidopsis thaliana LHCA1 AT3G54890 (LHCA1) transcript variant
           AT3G54890.3 mRNA, complete cds
          Length = 929

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 705 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 654



to top

>ref|NM_180374.1| Arabidopsis thaliana LHCA1 AT3G54890 (LHCA1) transcript variant
           AT3G54890.2 mRNA, complete cds
          Length = 894

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 670 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 619



to top

>ref|NM_115346.2| Arabidopsis thaliana LHCA1; chlorophyll binding AT3G54890 (LHCA1)
           transcript variant AT3G54890.1 mRNA, complete cds
          Length = 996

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 772 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 721



to top

>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    gtgcgcgcgcagagccagcg 131
              ||||||||||||||||||||
Sbjct: 197205 gtgcgcgcgcagagccagcg 197186



to top

>gb|BT000852.1| Arabidopsis thaliana At3g54890/F28P10_130 mRNA, complete cds
          Length = 726

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 704 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 653



to top

>gb|AF339688.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g54890) mRNA, complete cds
          Length = 770

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 704 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 653



to top

>gb|AF326866.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g54890) mRNA, complete cds
          Length = 939

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 770 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 719



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 281    gggtccgcgaggtgcgtggc 300
              ||||||||||||||||||||
Sbjct: 778859 gggtccgcgaggtgcgtggc 778840



to top

>emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, BAC clone F28P10
          Length = 90736

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 260   tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
             ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 47551 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 47500



to top

>gb|AY094437.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, complete cds
          Length = 945

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 770 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 719



to top

>gb|AF361847.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, complete cds
          Length = 923

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 770 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 719



to top

>gb|AY070473.1| Arabidopsis thaliana AT3g54890/F28P10_130 mRNA, complete cds
          Length = 890

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 770 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 719



to top

>gb|AF325016.2|AF325016 Arabidopsis thaliana AT3g54890 (AT3g54890/F28P10_130) mRNA,
           complete cds
          Length = 923

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 770 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 719



to top

>gb|AF324692.2|AF324692 Arabidopsis thaliana AT3g54890 (AT3g54890/F28P10_130) mRNA,
           complete cds
          Length = 921

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 768 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 717



to top

>emb|BX823678.1|CNS0A7B9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS66ZA09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 902

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 750 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 699



to top

>emb|BX823620.1|CNS0A7BA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS58ZA07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 860

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 756 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 705



to top

>emb|BX822994.1|CNS0A7CC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB7ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 460

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 282 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 231



to top

>emb|BX822507.1|CNS0A73P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB43ZB11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 752 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 701



to top

>emb|BX825357.1|CNS0A6D9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL31ZG05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 851

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 747 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 696



to top

>gb|AC073415.6| Homo sapiens BAC clone RP11-84C2 from 2, complete sequence
          Length = 214668

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    gaaacatgaatgaaaaccat 182
              ||||||||||||||||||||
Sbjct: 142115 gaaacatgaatgaaaaccat 142096



to top

>emb|X56062.1|ATCABI A.thaliana Cab mRNA for photossystem I chlorophyll A/B-binding
           protein
          Length = 933

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 260 tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
           ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 811 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 760



to top

>dbj|AP006865.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT37H21, TM1032,
             complete sequence
          Length = 95067

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   gatgacgatgtcgccgatgt 269
             ||||||||||||||||||||
Sbjct: 73695 gatgacgatgtcgccgatgt 73714



to top

>gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06, complete sequence
          Length = 145603

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                  
Query: 260    tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
              ||||| ||||| |||||||| || ||||| | ||| || |||||||||||||
Sbjct: 132199 tcgccaatgtttttgtgccatggatccgccaagtgagtagccaggttctcca 132148



to top

>gb|M85150.1|ATHCAB6P Arabidopsis thaliana chlorophyll A/B-binding protein gene, complete
            cds
          Length = 2904

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 260  tcgccgatgttgttgtgccacgggtccgcgaggtgcgtggccaggttctcca 311
            ||||| |||||||||||||| || ||||| | ||| || |||| ||||||||
Sbjct: 2409 tcgccaatgttgttgtgccatggatccgccaagtgagttgccaagttctcca 2358


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,242,304
Number of Sequences: 3902068
Number of extensions: 2242304
Number of successful extensions: 38593
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38430
Number of HSP's gapped (non-prelim): 161
length of query: 329
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 307
effective length of database: 17,147,199,772
effective search space: 5264190330004
effective search space used: 5264190330004
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top