Clone Name	rbaet14h01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	9e-17
2	emb|X64621.1|OSR22CDNA O.sativa R22 mRNA	96	9e-17
3	dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	9e-17
4	dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	9e-17
5	gb|BT016528.1| Zea mays clone Contig361 mRNA sequence	90	5e-15
6	gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds	88	2e-14
7	ref|XM_476047.1| Oryza sativa (japonica cultivar-group), predic...	82	1e-12
8	gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA...	76	8e-11
9	dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clon...	76	8e-11
10	dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clon...	76	8e-11
11	dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clon...	76	8e-11
12	gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein Q...	76	8e-11
13	gb|BT016423.1| Zea mays clone Contig256 mRNA sequence	70	5e-09
14	gb|AY103671.1| Zea mays PCO135454 mRNA sequence	70	5e-09
15	gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome...	62	1e-06
16	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	62	1e-06
17	emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor	62	1e-06
18	emb|X81692.1|OSSG12G O.sativa SG12 gene	62	1e-06
19	gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds	62	1e-06
20	gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (...	52	0.001
21	gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, comp...	48	0.018
22	gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds	48	0.018
23	gb|AC126264.3| Mus musculus BAC clone RP23-376F13 from chromosom...	44	0.28
24	gb|AY794382.1| Valeriana sorbifolia trnK gene, intron; chloroplast	42	1.1
25	gb|AY794360.1| Valeriana nivalis trnK gene, intron; chloroplast	42	1.1
26	ref|XM_597663.2| PREDICTED: Bos taurus similar to Ca2+-dependent...	42	1.1
27	emb|AL159163.40| Human DNA sequence from clone RP11-514O12 on ch...	42	1.1
28	ref|XM_373233.3| PREDICTED: Homo sapiens similar to 60S ribosoma...	42	1.1
29	gb|AC019176.4|AC019176 Homo sapiens BAC clone RP11-221H10 from 8...	42	1.1
30	ref|XM_234245.2| PREDICTED: Rattus norvegicus ribosomal protein ...	42	1.1
31	emb|AL162451.16| Human DNA sequence from clone RP11-145C1, compl...	42	1.1
32	gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, compl...	42	1.1
33	emb|AJ634060.2| Bacillus amyloliquefaciens bae gene cluster dire...	42	1.1
34	emb|CT027663.2| Medicago truncatula chromosome 5 clone mth2-139g...	42	1.1
35	gb|AY650303.1| Macaca fascicularis ribosomal protein L10 mRNA, p...	40	4.4
36	ref|NM_102455.1| Arabidopsis thaliana structural constituent of ...	40	4.4
37	ref|XM_521341.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	4.4
38	ref|XM_524123.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	4.4
39	ref|XM_522476.1| PREDICTED: Pan troglodytes similar to 60S ribos...	40	4.4
40	ref|XM_522460.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	4.4
41	ref|XM_522544.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	4.4
42	ref|XM_528403.1| PREDICTED: Pan troglodytes similar to astrotact...	40	4.4
43	ref|XM_516069.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	4.4
44	ref|XM_525890.1| PREDICTED: Pan troglodytes LOC470509 (LOC470509...	40	4.4
45	gb|AE017129.1| Yersinia pestis biovar Medievalis str. 91001 sect...	40	4.4
46	gb|BC003358.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	40	4.4
47	gb|AE009952.1| Yersinia pestis KIM, complete genome	40	4.4
48	gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complet...	40	4.4
49	gb|AC006353.3| Homo sapiens PAC clone RP5-1062J16 from 7, comple...	40	4.4
50	gb|BC063422.1| Homo sapiens cDNA clone IMAGE:5219540, partial cds	40	4.4
51	ref|NM_006013.2| Homo sapiens ribosomal protein L10 (RPL10), mRNA	40	4.4
52	gb|BC015682.1| Homo sapiens cDNA clone IMAGE:4651465, **** WARNI...	40	4.4
53	gb|BC015618.1| Homo sapiens cDNA clone IMAGE:4841291, **** WARNI...	40	4.4
54	emb|BX936347.3| Human DNA sequence from clone WI2-83563B9 on chr...	40	4.4
55	gb|BC095425.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	40	4.4
56	ref|XM_499758.1| Yarrowia lipolytica CLIB122, YALI0A04631g predi...	40	4.4
57	emb|AL357117.20| Human DNA sequence from clone RP11-436I24 on ch...	40	4.4
58	emb|AL355608.11| Human DNA sequence from clone RP11-567J2 on chr...	40	4.4
59	emb|CR859565.1| Pongo pygmaeus mRNA; cDNA DKFZp468J045 (from clo...	40	4.4
60	emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp...	40	4.4
61	emb|AJ414157.1| Yersinia pestis strain CO92 complete genome; seg...	40	4.4
62	emb|BX510991.10| Zebrafish DNA sequence from clone RP71-44C4 in ...	40	4.4
63	emb|AL672199.16| Mouse DNA sequence from clone RP23-171O21 on ch...	40	4.4
64	gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, com...	40	4.4
65	gb|AC008752.6| Homo sapiens chromosome 19 clone CTD-2623N2, comp...	40	4.4
66	emb|CR623994.1| full-length cDNA clone CS0DI057YC10 of Placenta ...	40	4.4
67	emb|CR621751.1| full-length cDNA clone CS0DL002YD15 of B cells (...	40	4.4
68	emb|CR622051.1| full-length cDNA clone CS0DI035YF15 of Placenta ...	40	4.4
69	emb|CR617177.1| full-length cDNA clone CS0DB008YK09 of Neuroblas...	40	4.4
70	emb|CR614538.1| full-length cDNA clone CS0DJ007YD04 of T cells (...	40	4.4
71	emb|CR614058.1| full-length cDNA clone CS0DJ011YG02 of T cells (...	40	4.4
72	emb|CR613467.1| full-length cDNA clone CS0DF026YB19 of Fetal bra...	40	4.4
73	emb|CR612141.1| full-length cDNA clone CS0DB006YN08 of Neuroblas...	40	4.4
74	emb|CR610011.1| full-length cDNA clone CS0DH003YI21 of T cells (...	40	4.4
75	emb|CR609074.1| full-length cDNA clone CS0DE003YM19 of Placenta ...	40	4.4
76	emb|CR603980.1| full-length cDNA clone CS0DM012YA22 of Fetal liv...	40	4.4
77	emb|CR602212.1| full-length cDNA clone CS0DC001YA10 of Neuroblas...	40	4.4
78	emb|CR598560.1| full-length cDNA clone CS0DF019YC14 of Fetal bra...	40	4.4
79	emb|CR596460.1| full-length cDNA clone CS0DF006YM08 of Fetal bra...	40	4.4
80	emb|CR596152.1| full-length cDNA clone CS0DJ006YD12 of T cells (...	40	4.4
81	emb|CR593302.1| full-length cDNA clone CS0DI087YC07 of Placenta ...	40	4.4
82	gb|AC008127.11| Homo sapiens 12 BAC RP11-478B9 (Roswell Park Can...	40	4.4
83	gb|AC008590.6| Homo sapiens chromosome 5 clone CTC-575D19, compl...	40	4.4
84	gb|AF486812.1| Homo sapiens ribosomal protein L10 (QM) mRNA, com...	40	4.4
85	gb|AF480632.1| HIV-1 isolate VT22 from Brazil envelope glycoprot...	40	4.4
86	gb|AC097522.4| Homo sapiens BAC clone RP11-588F10 from 4, comple...	40	4.4
87	ref|XM_944324.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
88	ref|XM_944319.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
89	ref|XM_939745.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
90	ref|XM_944311.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
91	ref|XM_934706.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
92	ref|XM_934705.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
93	ref|XM_209178.5| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
94	ref|XM_934704.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
95	ref|XM_939758.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
96	ref|XM_928462.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
97	ref|XM_941543.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	40	4.4
98	ref|XM_929431.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	40	4.4
99	ref|XM_945800.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
100	ref|XM_945799.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
101	ref|XM_945798.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
102	ref|XM_942217.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
103	ref|XM_945797.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
104	ref|XM_371781.3| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
105	ref|XM_931535.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
106	ref|XM_931532.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
107	ref|XM_931525.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
108	ref|XM_931519.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
109	ref|XM_926723.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
110	ref|XM_931512.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
111	ref|XM_937850.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
112	ref|XM_941661.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
113	ref|XM_209500.5| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
114	ref|XM_930080.1| PREDICTED: Homo sapiens similar to ribosomal pr...	40	4.4
115	gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds	40	4.4
116	emb|CR542069.1| Homo sapiens full open reading frame cDNA clone ...	40	4.4
117	emb|CR456797.1| Homo sapiens full open reading frame cDNA clone ...	40	4.4
118	dbj|AB168679.1| Macaca fascicularis testis cDNA clone: QtsA-1410...	40	4.4
119	gb|S35960.1| laminin receptor homolog {3' region} [human, mRNA P...	40	4.4
120	gb|S64169.1|S64168S2 QM [human, nontumorigenic Wilms' microcell ...	40	4.4
121	gb|DQ369716.1| Homo sapiens cell-line BT-20 QM protein mRNA, com...	40	4.4
122	gb|DQ369715.1| Homo sapiens cell-line FG (Colo357 F.S) QM protei...	40	4.4
123	gb|DQ369714.1| Homo sapiens cell-line PC3 QM protein mRNA, compl...	40	4.4
124	gb|DQ369713.1| Homo sapiens clone Ove-203Asn QM protein isoform ...	40	4.4
125	gb|DQ369712.1| Homo sapiens cell-line BxPC3 QM protein mRNA, com...	40	4.4
126	gb|DQ369711.1| Homo sapiens cell-line PI QM protein mRNA, comple...	40	4.4
127	gb|DQ369710.1| Homo sapiens cell-line HPAC QM protein mRNA, comp...	40	4.4
128	gb|DQ369709.1| Homo sapiens cell-line PANC28 QM protein mRNA, co...	40	4.4
129	gb|DQ369708.1| Homo sapiens cell-line PANC1 QM protein mRNA, com...	40	4.4
130	gb|DQ369707.1| Homo sapiens cell-line T46D QM protein mRNA, comp...	40	4.4
131	gb|DQ369706.1| Homo sapiens cell-line MCF-7 QM protein mRNA, com...	40	4.4
132	gb|DQ369705.1| Homo sapiens cell-line OVCAR QM protein mRNA, com...	40	4.4
133	gb|DQ369704.1| Homo sapiens clone Ove-202Ser QM protein isoform ...	40	4.4
134	gb|DQ369703.1| Homo sapiens cell-line MDAMB 231 QM protein mRNA,...	40	4.4
135	dbj|AK223309.1| Homo sapiens mRNA for ribosomal protein L10 vari...	40	4.4
136	gb|AF280893.1|AF280893 Pongo pygmaeus clone 3454 chromosome Xq g...	40	4.4
137	gb|AC123023.4| Homo sapiens 3 BAC RP11-727M21 (Roswell Park Canc...	40	4.4
138	gb|AC015550.19| Homo sapiens 12 BAC RP11-254B13 (Roswell Park Ca...	40	4.4
139	gb|AC016708.11| Homo sapiens BAC clone RP11-223M6 from 2, comple...	40	4.4
140	gb|AF218023.1|AF218023 Homo sapiens clone PP5910 unknown mRNA	40	4.4
141	gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete s...	40	4.4
142	ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosom...	40	4.4
143	ref|XM_575130.1| PREDICTED: Rattus norvegicus similar to ribosom...	40	4.4
144	ref|XM_345291.2| PREDICTED: Rattus norvegicus similar to 60S rib...	40	4.4
145	gb|AC016894.11| Homo sapiens BAC clone RP11-17D23 from 2, comple...	40	4.4
146	gb|AC078820.28| Homo sapiens 12 BAC RP11-114H23 (Roswell Park Ca...	40	4.4
147	gb|AY891756.1| Synthetic construct Homo sapiens clone FLH016426....	40	4.4
148	gb|AY889257.1| Synthetic construct Homo sapiens clone FLH016430....	40	4.4
149	emb|BX647954.1|HSM808100 Homo sapiens mRNA; cDNA DKFZp686J1851 (...	40	4.4
150	dbj|AK027197.1| Homo sapiens cDNA: FLJ23544 fis, clone LNG08336	40	4.4
151	dbj|AK026568.1| Homo sapiens cDNA: FLJ22915 fis, clone KAT06354,...	40	4.4
152	dbj|AK130582.1| Homo sapiens cDNA FLJ27072 fis, clone SPL01818, ...	40	4.4
153	emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human...	40	4.4
154	gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10...	40	4.4
155	gb|AY894061.1| Synthetic construct Homo sapiens clone FLH131216....	40	4.4
156	gb|BC071918.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	40	4.4
157	gb|L44140.1|HUMFLNG6PD Homo sapiens chromosome X region from fil...	40	4.4
158	gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome	40	4.4
159	gb|BC026276.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	40	4.4
160	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	40	4.4
161	gb|M64241.1|HUMQM Human Wilm's tumor-related protein (QM) mRNA, ...	40	4.4
162	gb|M73791.1|HUMNOVGENE Human novel gene mRNA, complete cds	40	4.4
163	gb|M81806.1|HUMHSKPQZ7 Human housekeeping (Q1Z 7F5) gene, exons ...	40	4.4
164	dbj|AB001582.1| Solanum melongena mRNA for QM family protein, pa...	40	4.4
165	dbj|AB001891.1| Solanum melongena mRNA for QM family protein, co...	40	4.4
166	dbj|AB007170.1| Homo sapiens gene for ribosomal protein L10, par...	40	4.4

---

>dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-A02, full
           insert sequence
          Length = 906

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 272
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 676 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 617

                                                                       
Query: 273 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 332
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 616 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 557

               
Query: 333 atga 336
           ||||
Sbjct: 556 atga 553

---

>emb|X64621.1|OSR22CDNA O.sativa R22 mRNA
          Length = 629

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 272
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 389 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 330

                                                                       
Query: 273 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 332
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 329 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 270

               
Query: 333 atga 336
           ||||
Sbjct: 269 atga 266

---

>dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052E20, full
           insert sequence
          Length = 910

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 272
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 680 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 621

                                                                       
Query: 273 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 332
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 620 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 561

               
Query: 333 atga 336
           ||||
Sbjct: 560 atga 557

---

>dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-H08, full
           insert sequence
          Length = 555

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 272
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 325 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 266

                                                                       
Query: 273 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 332
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 265 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 206

               
Query: 333 atga 336
           ||||
Sbjct: 205 atga 202

---

>gb|BT016528.1| Zea mays clone Contig361 mRNA sequence
          Length = 814

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 287
           ||||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| |||
Sbjct: 586 ccgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcagg 527

                                                            
Query: 288 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatga 336
           ||||||  |||| ||||||||||||| |||||||| |||||||||||||
Sbjct: 526 tagtcagcgcggctgaacttggtgaagccccactttctgctctcaatga 478

---

>gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds
          Length = 928

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 229 cgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggt 288
           |||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| ||||
Sbjct: 634 cgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcaggt 575

                                                           
Query: 289 agtcattgcggttgaacttggtgaaaccccacttcctgctctcaatga 336
           |||||  |||| ||||||||||||| |||||||| |||||||||||||
Sbjct: 574 agtcagcgcggctgaacttggtgaagccccactttctgctctcaatga 527

---

>ref|XM_476047.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 236 cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 295
           |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 594 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 535

                                                    
Query: 296 gcggttgaacttggtgaaaccccacttcctgctctcaatga 336
           |||| |||||||||||||||||||||| || ||||||||||
Sbjct: 534 gcggctgaacttggtgaaaccccactttctactctcaatga 494

---

>gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA, complete
           sequence
          Length = 836

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 agcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtag 290
           ||||||||||||||||| |||||||||| ||  || |||||||||||| |||||| ||| 
Sbjct: 653 agcagcttagcattgacaccatcaggcacgattcttccctcactcttgtacttgatgtaa 594

                                                 
Query: 291 tcattgcggttgaacttggtgaaaccccacttcctgct 328
           |||     |||||||||||| || ||||||||||||||
Sbjct: 593 tcagccttgttgaacttggtaaagccccacttcctgct 556

---

>dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136P16, full
           insert sequence
          Length = 973

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 254
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 255 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 314
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                         
Query: 315 ccccacttcctgct 328
           ||||||||||||||
Sbjct: 575 ccccacttcctgct 562

---

>dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033115J23, full
           insert sequence
          Length = 995

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 254
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 255 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 314
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                         
Query: 315 ccccacttcctgct 328
           ||||||||||||||
Sbjct: 575 ccccacttcctgct 562

---

>dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D11, full
           insert sequence
          Length = 1034

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 254
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 701 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 642

                                                                       
Query: 255 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 314
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 641 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 582

                         
Query: 315 ccccacttcctgct 328
           ||||||||||||||
Sbjct: 581 ccccacttcctgct 568

---

>gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein QM mRNA, partial cds
          Length = 747

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 254
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 483 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 424

                                                                       
Query: 255 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 314
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 423 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 364

                         
Query: 315 ccccacttcctgct 328
           ||||||||||||||
Sbjct: 363 ccccacttcctgct 350

---

>gb|BT016423.1| Zea mays clone Contig256 mRNA sequence
          Length = 959

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 287
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 656 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 597

                                                          
Query: 288 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaat 334
           |||||    ||| ||||||||||||| |||||||| |||||||||||
Sbjct: 596 tagtcggcacggctgaacttggtgaagccccactttctgctctcaat 550

---

>gb|AY103671.1| Zea mays PCO135454 mRNA sequence
          Length = 1044

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 287
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 700 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 641

                                                          
Query: 288 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaat 334
           |||||    ||| ||||||||||||| |||||||| |||||||||||
Sbjct: 640 tagtcggcacggctgaacttggtgaagccccactttctgctctcaat 594

---

>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04,
             complete sequence
          Length = 136713

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 236   cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 295
             |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 59216 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 59157

                                    
Query: 296   gcggttgaacttggtgaaacccc 318
             |||| ||||||||||||||||||
Sbjct: 59156 gcggctgaacttggtgaaacccc 59134

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                           
Query: 236     cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 295
               |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 4084522 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 4084463

                                      
Query: 296     gcggttgaacttggtgaaacccc 318
               |||| ||||||||||||||||||
Sbjct: 4084462 gcggctgaacttggtgaaacccc 4084440

---

>emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor
          Length = 971

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 111/135 (82%), Gaps = 2/135 (1%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 254
           ||||||||||| |||||||| || |||||  | || ||||||||||||||||| ||||||
Sbjct: 679 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagcttagcattgacaccatca 620

                                                                       
Query: 255 ggcaagaccctgccctcactcttgaacttgaggtagtc-attgcggttgaacttggtgaa 313
           | ||  |  |||||||||  ||| ||||||| ||| ||    |||| |||||||||||||
Sbjct: 619 gacataattctgccctcagccttcaacttga-gtactctcacgcggctgaacttggtgaa 561

                          
Query: 314 accccacttcctgct 328
            ||||||||||||||
Sbjct: 560 gccccacttcctgct 546

---

>emb|X81692.1|OSSG12G O.sativa SG12 gene
          Length = 1734

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 236  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 295
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 1307 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1248

                                   
Query: 296  gcggttgaacttggtgaaacccc 318
            |||| ||||||||||||||||||
Sbjct: 1247 gcggctgaacttggtgaaacccc 1225

---

>gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds
          Length = 2542

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 236  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 295
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 2047 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1988

                                   
Query: 296  gcggttgaacttggtgaaacccc 318
            |||| ||||||||||||||||||
Sbjct: 1987 gcggctgaacttggtgaaacccc 1965

---

>gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (QM) mRNA, complete cds
          Length = 980

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 ccatggcatccgagcagcttagcattgactccatcagg 256
           |||||||||||||| ||||| |||||||| ||||||||
Sbjct: 644 ccatggcatccgagaagcttggcattgacaccatcagg 607



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 299 gttgaacttggtgaaaccccacttcctgct 328
           ||||||||| ||||||||||||||||||||
Sbjct: 564 gttgaactttgtgaaaccccacttcctgct 535

---

>gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, complete cds
          Length = 977

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           |||||| |||||||||| ||||||||||||||
Sbjct: 542 cggttgtacttggtgaatccccacttcctgct 511

---

>gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds
          Length = 969

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           |||||| |||||||||| ||||||||||||||
Sbjct: 533 cggttgtacttggtgaatccccacttcctgct 502

---

>gb|AC126264.3| Mus musculus BAC clone RP23-376F13 from chromosome 14, complete
             sequence
          Length = 169909

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 38    aaaatagataatatcttccataacaa 63
             ||||||||||| ||||||||||||||
Sbjct: 62720 aaaatagataacatcttccataacaa 62745

---

>gb|AY794382.1| Valeriana sorbifolia trnK gene, intron; chloroplast
          Length = 959

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 31  ccattccaaaatagataatat 51
           |||||||||||||||||||||
Sbjct: 432 ccattccaaaatagataatat 412

---

>gb|AY794360.1| Valeriana nivalis trnK gene, intron; chloroplast
          Length = 1044

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 31  ccattccaaaatagataatat 51
           |||||||||||||||||||||
Sbjct: 445 ccattccaaaatagataatat 425

---

>ref|XM_597663.2| PREDICTED: Bos taurus similar to Ca2+-dependent activator for
            secretion protein 2 (LOC519444), mRNA
          Length = 2606

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 26   cagtaccattccaaaatagat 46
            |||||||||||||||||||||
Sbjct: 1249 cagtaccattccaaaatagat 1269

---

>emb|AL159163.40| Human DNA sequence from clone RP11-514O12 on chromosome 6 Contains the 5'
              end of a variant of the RPS6KA2 gene for ribosomal protein
              S6 kinase, 90kD, polypeptide 2 (RSK3), a novel gene, the 3'
              end of the gene for ribonuclease 6 precursor
              (RNASE6PL)(FLJ10907) and 2 CpG islands, complete sequence
          Length = 156938

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     cattcatatcagtaccattcc 37
              |||||||||||||||||||||
Sbjct: 139673 cattcatatcagtaccattcc 139653

---

>ref|XM_373233.3| PREDICTED: Homo sapiens similar to 60S ribosomal protein L10 (QM
           protein) (Tumor suppressor QM) (Laminin receptor
           homolog) (LOC392179), mRNA
          Length = 240

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 299 gttgaacttggtgaaaccccacttc 323
           ||||||||||||||| |||||||||
Sbjct: 126 gttgaacttggtgaagccccacttc 102

---

>gb|AC019176.4|AC019176 Homo sapiens BAC clone RP11-221H10 from 8, complete sequence
          Length = 170680

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 299    gttgaacttggtgaaaccccacttc 323
              ||||||||||||||| |||||||||
Sbjct: 147557 gttgaacttggtgaagccccacttc 147581

---

>ref|XM_234245.2| PREDICTED: Rattus norvegicus ribosomal protein L10-like (predicted)
           (Rpl10l_predicted), mRNA
          Length = 671

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 299 gttgaacttggtgaaaccccacttc 323
           ||||||||||||||| |||||||||
Sbjct: 551 gttgaacttggtgaatccccacttc 527

---

>emb|AL162451.16| Human DNA sequence from clone RP11-145C1, complete sequence
          Length = 156963

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 303    aacttggtgaaaccccacttc 323
              |||||||||||||||||||||
Sbjct: 132568 aacttggtgaaaccccacttc 132548

---

>gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, complete sequence
          Length = 149905

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 229   cgagcagcttagcattgactc 249
             |||||||||||||||||||||
Sbjct: 77115 cgagcagcttagcattgactc 77095

---

>emb|AJ634060.2| Bacillus amyloliquefaciens bae gene cluster directing biosynthesis of
             bacillaene, strain FZB42
          Length = 72494

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 152   tgatagtcttctgctaaattatgcg 176
             ||||||||||||||||||| |||||
Sbjct: 59357 tgatagtcttctgctaaatgatgcg 59333

---

>emb|CT027663.2| Medicago truncatula chromosome 5 clone mth2-139g23, COMPLETE SEQUENCE
          Length = 133229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 312   aaaccccacttcctgctctca 332
             |||||||||||||||||||||
Sbjct: 24279 aaaccccacttcctgctctca 24299

---

>gb|AY650303.1| Macaca fascicularis ribosomal protein L10 mRNA, partial cds
          Length = 573

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 503 ttgaacttggtgaagccccacttc 480

---

>ref|NM_102455.1| Arabidopsis thaliana structural constituent of ribosome AT1G26910
           mRNA, complete cds
          Length = 872

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgct 561

---

>ref|XM_521341.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10
            (LOC465944), mRNA
          Length = 2042

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1907 ttgaacttggtgaagccccacttc 1884

---

>ref|XM_524123.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10
           (LOC468736), mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>ref|XM_522476.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L10 (QM
           protein) (Tumor suppressor QM) (Laminin receptor
           homolog) (LOC467076), mRNA
          Length = 438

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 323 ttgaacttggtgaagccccacttc 300

---

>ref|XM_522460.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10
           (LOC467060), mRNA
          Length = 357

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 242 ttgaacttggtgaagccccacttc 219

---

>ref|XM_522544.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10
            (LOC467144), mRNA
          Length = 1896

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1754 ttgaacttggtgaagccccacttc 1731

---

>ref|XM_528403.1| PREDICTED: Pan troglodytes similar to astrotactin 2 isoform a
            (LOC473033), mRNA
          Length = 6030

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 2507 ttgaacttggtgaagccccacttc 2484

---

>ref|XM_516069.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10
           (LOC459923), mRNA
          Length = 638

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 281 ttgaacttggtgaagccccacttc 258

---

>ref|XM_525890.1| PREDICTED: Pan troglodytes LOC470509 (LOC470509), mRNA
          Length = 309

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 194 ttgaacttggtgaagccccacttc 171

---

>gb|AE017129.1| Yersinia pestis biovar Medievalis str. 91001 section 3 of 16 of the
             complete genome
          Length = 290002

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 202   cacggttcgcaaggcggccatggc 225
             |||| |||||||||||||||||||
Sbjct: 53639 cacgtttcgcaaggcggccatggc 53616

---

>gb|BC003358.1| Homo sapiens ribosomal protein L10, mRNA (cDNA clone MGC:5189
           IMAGE:2900175), complete cds
          Length = 2171

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 202    cacggttcgcaaggcggccatggc 225
              |||| |||||||||||||||||||
Sbjct: 779396 cacgtttcgcaaggcggccatggc 779373

---

>gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complete sequence
          Length = 190846

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 256  gcaagaccctgccctcactc 275
            ||||||||||||||||||||
Sbjct: 9943 gcaagaccctgccctcactc 9924

---

>gb|AC006353.3| Homo sapiens PAC clone RP5-1062J16 from 7, complete sequence
          Length = 158090

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 129   ggtaaaataaggattgatagaact 152
             |||||||||| |||||||||||||
Sbjct: 92287 ggtaaaataatgattgatagaact 92310

---

>gb|BC063422.1| Homo sapiens cDNA clone IMAGE:5219540, partial cds
          Length = 1643

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1436 ttgaacttggtgaagccccacttc 1413

---

>ref|NM_006013.2| Homo sapiens ribosomal protein L10 (RPL10), mRNA
          Length = 2188

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 571 ttgaacttggtgaagccccacttc 548

---

>gb|BC015682.1| Homo sapiens cDNA clone IMAGE:4651465, **** WARNING: chimeric clone
           ****
          Length = 1474

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 225 ttgaacttggtgaagccccacttc 248

---

>gb|BC015618.1| Homo sapiens cDNA clone IMAGE:4841291, **** WARNING: chimeric clone
           ****
          Length = 3065

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 218 ttgaacttggtgaagccccacttc 241

---

>emb|BX936347.3| Human DNA sequence from clone WI2-83563B9 on chromosome X Contains
            the 3' end of the RPL10 gene for ribosomal protein L10,
            the DNASE1L1 gene for deoxyribonuclease I-like 1, the TAZ
            gene for  tafazzin (cardiomyopathy, dilated 3A
            (X-linked); endocardial fibroelastosis 2; Barth
            syndrome), the 5' end of the ATP6AP1 gene for H+
            transporting ATPase lysosomal accessory protein 1 and two
            CpG islands, complete sequence
          Length = 37440

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 3312 ttgaacttggtgaagccccacttc 3289

---

>gb|BC095425.1| Homo sapiens ribosomal protein L10, mRNA (cDNA clone
           IMAGE:30709458)
          Length = 594

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 398 ttgaacttggtgaagccccacttc 375

---

>ref|XM_499758.1| Yarrowia lipolytica CLIB122, YALI0A04631g predicted mRNA
          Length = 1404

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 53 ttccataacaaggttcgaca 72
          ||||||||||||||||||||
Sbjct: 9  ttccataacaaggttcgaca 28

---

>emb|AL357117.20| Human DNA sequence from clone RP11-436I24 on chromosome 6 Contains part
             of the gene for a novel protein (contains KIAA0680), a
             novel gene and a CpG island, complete sequence
          Length = 139627

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 256   gcaagaccctgccctcactc 275
             ||||||||||||||||||||
Sbjct: 51995 gcaagaccctgccctcactc 51976

---

>emb|AL355608.11| Human DNA sequence from clone RP11-567J2 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin 2 (KIAA0634) and a novel
             gene similar to ribosomal protein L10 (RPL10), complete
             sequence
          Length = 132590

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 23355 ttgaacttggtgaagccccacttc 23378

---

>emb|CR859565.1| Pongo pygmaeus mRNA; cDNA DKFZp468J045 (from clone DKFZp468J045)
          Length = 750

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 573 ttgaacttggtgaagccccacttc 550

---

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 202    cacggttcgcaaggcggccatggc 225
              |||| |||||||||||||||||||
Sbjct: 571321 cacgtttcgcaaggcggccatggc 571298

---

>emb|AJ414157.1| Yersinia pestis strain CO92 complete genome; segment 17/20
          Length = 216050

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 202   cacggttcgcaaggcggccatggc 225
             |||| |||||||||||||||||||
Sbjct: 99370 cacgtttcgcaaggcggccatggc 99393

---

>emb|BX510991.10| Zebrafish DNA sequence from clone RP71-44C4 in linkage group 17,
             complete sequence
          Length = 116313

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   cttgaacttgaggtagtcat 294
             ||||||||||||||||||||
Sbjct: 53590 cttgaacttgaggtagtcat 53609

---

>emb|AL672199.16| Mouse DNA sequence from clone RP23-171O21 on chromosome 11 Contains the
              Srcasm gene for Src activating and signaling molecule and
              the 3' end of a novel gene, complete sequence
          Length = 150260

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 67     tcgacacaacattcagacaaaata 90
              ||||||||||||||| ||||||||
Sbjct: 130462 tcgacacaacattcaaacaaaata 130485

---

>gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, complete sequence
          Length = 203790

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 42702 ttgaacttggtgaagccccacttc 42679

---

>gb|AC008752.6| Homo sapiens chromosome 19 clone CTD-2623N2, complete sequence
          Length = 138036

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 34722 ttgaacttggtgaagccccacttc 34745

---

>emb|CR623994.1| full-length cDNA clone CS0DI057YC10 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1290

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1145 ttgaacttggtgaagccccacttc 1122

---

>emb|CR621751.1| full-length cDNA clone CS0DL002YD15 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 723

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR622051.1| full-length cDNA clone CS0DI035YF15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 723

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR617177.1| full-length cDNA clone CS0DB008YK09 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1308

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1150 ttgaacttggtgaagccccacttc 1127

---

>emb|CR614538.1| full-length cDNA clone CS0DJ007YD04 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 728

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>emb|CR614058.1| full-length cDNA clone CS0DJ011YG02 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 728

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>emb|CR613467.1| full-length cDNA clone CS0DF026YB19 of Fetal brain of Homo sapiens
            (human)
          Length = 1271

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1141 ttgaacttggtgaagccccacttc 1118

---

>emb|CR612141.1| full-length cDNA clone CS0DB006YN08 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 721

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR610011.1| full-length cDNA clone CS0DH003YI21 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 713

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR609074.1| full-length cDNA clone CS0DE003YM19 of Placenta of Homo sapiens
            (human)
          Length = 1390

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1231 ttgaacttggtgaagccccacttc 1208

---

>emb|CR603980.1| full-length cDNA clone CS0DM012YA22 of Fetal liver of Homo sapiens
           (human)
          Length = 720

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR602212.1| full-length cDNA clone CS0DC001YA10 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 732

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>emb|CR598560.1| full-length cDNA clone CS0DF019YC14 of Fetal brain of Homo sapiens
           (human)
          Length = 732

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>emb|CR596460.1| full-length cDNA clone CS0DF006YM08 of Fetal brain of Homo sapiens
           (human)
          Length = 723

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>emb|CR596152.1| full-length cDNA clone CS0DJ006YD12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 728

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 554 ttgaacttggtgaagccccacttc 531

---

>emb|CR593302.1| full-length cDNA clone CS0DI087YC07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 718

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 544 ttgaacttggtgaagccccacttc 521

---

>gb|AC008127.11| Homo sapiens 12 BAC RP11-478B9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 140626

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 299    gttgaacttggtgaaacccc 318
              ||||||||||||||||||||
Sbjct: 116505 gttgaacttggtgaaacccc 116486

---

>gb|AC008590.6| Homo sapiens chromosome 5 clone CTC-575D19, complete sequence
          Length = 98692

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 20711 ttgaacttggtgaagccccacttc 20688

---

>gb|AF486812.1| Homo sapiens ribosomal protein L10 (QM) mRNA, complete cds
          Length = 772

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 552 ttgaacttggtgaagccccacttc 529

---

>gb|AF480632.1| HIV-1 isolate VT22 from Brazil envelope glycoprotein (env) gene,
           partial cds
          Length = 501

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  tcatatcagtaccattccaa 39
           ||||||||||||||||||||
Sbjct: 424 tcatatcagtaccattccaa 405

---

>gb|AC097522.4| Homo sapiens BAC clone RP11-588F10 from 4, complete sequence
          Length = 207883

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 253  caggcaagaccctgccctca 272
            ||||||||||||||||||||
Sbjct: 2646 caggcaagaccctgccctca 2665

---

>ref|XM_944324.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 4 (LOC648209), mRNA
          Length = 749

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 576 ttgaacttggtgaagccccacttc 553

---

>ref|XM_944319.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 3 (LOC648209), mRNA
          Length = 651

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 445 ttgaacttggtgaagccccacttc 422

---

>ref|XM_939745.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 1 (LOC648209), mRNA
          Length = 790

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 577 ttgaacttggtgaagccccacttc 554

---

>ref|XM_944311.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 2 (LOC648209), mRNA
          Length = 629

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 425 ttgaacttggtgaagccccacttc 402

---

>ref|XM_934706.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 4 (LOC284393), mRNA
          Length = 749

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 576 ttgaacttggtgaagccccacttc 553

---

>ref|XM_934705.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 3 (LOC284393), mRNA
          Length = 651

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 445 ttgaacttggtgaagccccacttc 422

---

>ref|XM_209178.5| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 1 (LOC284393), mRNA
          Length = 819

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 576 ttgaacttggtgaagccccacttc 553

---

>ref|XM_934704.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 2 (LOC284393), mRNA
          Length = 629

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 425 ttgaacttggtgaagccccacttc 402

---

>ref|XM_939758.1| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC650671), mRNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 921 ttgaacttggtgaagccccacttc 898

---

>ref|XM_928462.1| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC645422), mRNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 921 ttgaacttggtgaagccccacttc 898

---

>ref|XM_941543.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L10 (QM
           protein) (Tumor suppressor QM) (Laminin receptor
           homolog) (LOC649693), mRNA
          Length = 397

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 210 ttgaacttggtgaagccccacttc 187

---

>ref|XM_929431.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L10 (QM
           protein) (Tumor suppressor QM) (Laminin receptor
           homolog) (LOC644039), mRNA
          Length = 396

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 210 ttgaacttggtgaagccccacttc 187

---

>ref|XM_945800.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 12 (LOC389342), mRNA
          Length = 756

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 548 ttgaacttggtgaagccccacttc 525

---

>ref|XM_945799.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 11 (LOC389342), mRNA
          Length = 916

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_945798.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 10 (LOC389342), mRNA
          Length = 646

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 446 ttgaacttggtgaagccccacttc 423

---

>ref|XM_942217.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 8 (LOC389342), mRNA
          Length = 910

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_945797.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 9 (LOC389342), mRNA
          Length = 626

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 426 ttgaacttggtgaagccccacttc 403

---

>ref|XM_371781.3| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 1 (LOC389342), mRNA
          Length = 910

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_931535.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 7 (LOC389342), mRNA
          Length = 911

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_931532.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 6 (LOC389342), mRNA
          Length = 757

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 548 ttgaacttggtgaagccccacttc 525

---

>ref|XM_931525.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 5 (LOC389342), mRNA
          Length = 921

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_931519.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 4 (LOC389342), mRNA
          Length = 647

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 446 ttgaacttggtgaagccccacttc 423

---

>ref|XM_926723.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 2 (LOC389342), mRNA
          Length = 921

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 702 ttgaacttggtgaagccccacttc 679

---

>ref|XM_931512.1| PREDICTED: Homo sapiens similar to ribosomal protein L10,
           transcript variant 3 (LOC389342), mRNA
          Length = 642

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 426 ttgaacttggtgaagccccacttc 403

---

>ref|XM_937850.1| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC285176), mRNA
          Length = 473

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 281 ttgaacttggtgaagccccacttc 258

---

>ref|XM_941661.1| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC652253), mRNA
          Length = 240

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 125 ttgaacttggtgaagccccacttc 102

---

>ref|XM_209500.5| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC285176), mRNA
          Length = 473

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 281 ttgaacttggtgaagccccacttc 258

---

>ref|XM_930080.1| PREDICTED: Homo sapiens similar to ribosomal protein L10
           (LOC647074), mRNA
          Length = 240

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 125 ttgaacttggtgaagccccacttc 102

---

>gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds
          Length = 666

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 533 cggttaaacttggtgaacccccatttcctgct 502

---

>emb|CR542069.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0636D for
           gene RPL10, ribosomal protein L10; complete cds, without
           stopcodon
          Length = 642

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>emb|CR456797.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0816D for
           gene RPL10, ribosomal protein L10; complete cds, incl.
           stopcodon
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>dbj|AB168679.1| Macaca fascicularis testis cDNA clone: QtsA-14101, similar to human
           ribosomal protein L10 (RPL10), mRNA, RefSeq: NM_006013.2
          Length = 812

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 623 ttgaacttggtgaagccccacttc 600

---

>gb|S35960.1| laminin receptor homolog {3' region} [human, mRNA Partial, 739 nt]
          Length = 739

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 548 ttgaacttggtgaagccccacttc 525

---

>gb|S64169.1|S64168S2 QM [human, nontumorigenic Wilms' microcell hybrid cells, Genomic,
            2623 nt, segment 2 of 2]
          Length = 2623

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1870 ttgaacttggtgaagccccacttc 1847

---

>gb|DQ369716.1| Homo sapiens cell-line BT-20 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369715.1| Homo sapiens cell-line FG (Colo357 F.S) QM protein mRNA, complete
           cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369714.1| Homo sapiens cell-line PC3 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369713.1| Homo sapiens clone Ove-203Asn QM protein isoform 1 mRNA, complete
           cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369712.1| Homo sapiens cell-line BxPC3 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369711.1| Homo sapiens cell-line PI QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369710.1| Homo sapiens cell-line HPAC QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369709.1| Homo sapiens cell-line PANC28 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369708.1| Homo sapiens cell-line PANC1 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369707.1| Homo sapiens cell-line T46D QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369706.1| Homo sapiens cell-line MCF-7 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369705.1| Homo sapiens cell-line OVCAR QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369704.1| Homo sapiens clone Ove-202Ser QM protein isoform 2 mRNA, complete
           cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|DQ369703.1| Homo sapiens cell-line MDAMB 231 QM protein mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>dbj|AK223309.1| Homo sapiens mRNA for ribosomal protein L10 variant, clone: TMS00528
          Length = 1264

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 1063 ttgaacttggtgaagccccacttc 1040

---

>gb|AF280893.1|AF280893 Pongo pygmaeus clone 3454 chromosome Xq genomic sequence
          Length = 924

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 761 ttgaacttggtgaagccccacttc 738

---

>gb|AC123023.4| Homo sapiens 3 BAC RP11-727M21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 183779

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    aaccccacttcctgctctca 332
              ||||||||||||||||||||
Sbjct: 132133 aaccccacttcctgctctca 132152

---

>gb|AC015550.19| Homo sapiens 12 BAC RP11-254B13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 140300

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 40303 ttgaacttggtgaagccccacttc 40280

---

>gb|AC016708.11| Homo sapiens BAC clone RP11-223M6 from 2, complete sequence
          Length = 194304

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 300    ttgaacttggtgaaaccccacttc 323
              |||||||||||||| |||||||||
Sbjct: 154178 ttgaacttggtgaagccccacttc 154155

---

>gb|AF218023.1|AF218023 Homo sapiens clone PP5910 unknown mRNA
          Length = 2275

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 2039 ttgaacttggtgaagccccacttc 2016

---

>gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete sequence
          Length = 872

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgct 561

---

>ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L10
           (LOC503169), mRNA
          Length = 942

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 300 ttgaacttggtgaaacccca 319
           ||||||||||||||||||||
Sbjct: 827 ttgaacttggtgaaacccca 808

---

>ref|XM_575130.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L10
           (LOC499794), mRNA
          Length = 453

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 300 ttgaacttggtgaaacccca 319
           ||||||||||||||||||||
Sbjct: 245 ttgaacttggtgaaacccca 226

---

>ref|XM_345291.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L10 (QM
            protein) (Tumor suppressor QM) (Laminin receptor homolog)
            (LOC365944), mRNA
          Length = 1365

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  ttgaacttggtgaaacccca 319
            ||||||||||||||||||||
Sbjct: 1250 ttgaacttggtgaaacccca 1231

---

>gb|AC016894.11| Homo sapiens BAC clone RP11-17D23 from 2, complete sequence
          Length = 135160

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 300    ttgaacttggtgaaaccccacttc 323
              |||||||||||||| |||||||||
Sbjct: 118970 ttgaacttggtgaagccccacttc 118993

---

>gb|AC078820.28| Homo sapiens 12 BAC RP11-114H23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 164812

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 8273 ttgaacttggtgaagccccacttc 8250

---

>gb|AY891756.1| Synthetic construct Homo sapiens clone FLH016426.01L ribosomal
           protein L10 (RPL10) mRNA, partial cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|AY889257.1| Synthetic construct Homo sapiens clone FLH016430.01X ribosomal
           protein L10 (RPL10) mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>emb|BX647954.1|HSM808100 Homo sapiens mRNA; cDNA DKFZp686J1851 (from clone DKFZp686J1851)
          Length = 650

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 408 ttgaacttggtgaagccccacttc 385

---

>dbj|AK027197.1| Homo sapiens cDNA: FLJ23544 fis, clone LNG08336
          Length = 2454

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 2264 ttgaacttggtgaagccccacttc 2241

---

>dbj|AK026568.1| Homo sapiens cDNA: FLJ22915 fis, clone KAT06354, highly similar to
           HUMQM Human Wilm's tumor-related protein (QM) mRNA
          Length = 869

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 675 ttgaacttggtgaagccccacttc 652

---

>dbj|AK130582.1| Homo sapiens cDNA FLJ27072 fis, clone SPL01818, highly similar to
           60S ribosomal protein L10
          Length = 744

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 571 ttgaacttggtgaagccccacttc 548

---

>emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human Wilm's tumor-related
           protein HUMQM (partial)
          Length = 615

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 301 tgaacttggtgaaaccccacttcctgct 328
           ||||||| ||||| ||||||||||||||
Sbjct: 318 tgaacttagtgaacccccacttcctgct 291

---

>gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10 mRNA, complete cds
          Length = 852

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 297 cggttgaacttggtgaaaccccacttcctgct 328
           |||||||  ||||||||||||||||| |||||
Sbjct: 557 cggttgattttggtgaaaccccactttctgct 526

---

>gb|AY894061.1| Synthetic construct Homo sapiens clone FLH131216.01L ribosomal
           protein L10 (RPL10) mRNA, partial cds
          Length = 645

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 530 ttgaacttggtgaagccccacttc 507

---

>gb|BC071918.1| Homo sapiens ribosomal protein L10, mRNA (cDNA clone MGC:88600
           IMAGE:6731213), complete cds
          Length = 744

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 549 ttgaacttggtgaagccccacttc 526

---

>gb|L44140.1|HUMFLNG6PD Homo sapiens chromosome X region from filamin (FLN) gene to
             glucose-6-phosphate dehydrogenase (G6PD) gene, complete
             cds's
          Length = 219447

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 300   ttgaacttggtgaaaccccacttc 323
             |||||||||||||| |||||||||
Sbjct: 71174 ttgaacttggtgaagccccacttc 71151

---

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 290     gtcattgcggttgaacttgg 309
               ||||||||||||||||||||
Sbjct: 1557032 gtcattgcggttgaacttgg 1557051

---

>gb|BC026276.1| Homo sapiens ribosomal protein L10, mRNA (cDNA clone MGC:23823
           IMAGE:4276627), complete cds
          Length = 778

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 571 ttgaacttggtgaagccccacttc 548

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     ttccataacaaggttcgaca 72
              ||||||||||||||||||||
Sbjct: 492668 ttccataacaaggttcgaca 492649

---

>gb|M64241.1|HUMQM Human Wilm's tumor-related protein (QM) mRNA, complete cds
          Length = 744

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 571 ttgaacttggtgaagccccacttc 548

---

>gb|M73791.1|HUMNOVGENE Human novel gene mRNA, complete cds
          Length = 722

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 544 ttgaacttggtgaagccccacttc 521

---

>gb|M81806.1|HUMHSKPQZ7 Human housekeeping (Q1Z 7F5) gene, exons 2 through 7, complete cds
          Length = 3188

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  ttgaacttggtgaaaccccacttc 323
            |||||||||||||| |||||||||
Sbjct: 2499 ttgaacttggtgaagccccacttc 2476

---

>dbj|AB001582.1| Solanum melongena mRNA for QM family protein, partial cds
          Length = 413

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 301 tgaacttggtgaaaccccacttcctgct 328
           ||||||||||||| |||||||| |||||
Sbjct: 317 tgaacttggtgaatccccactttctgct 290

---

>dbj|AB001891.1| Solanum melongena mRNA for QM family protein, complete cds
          Length = 820

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 301 tgaacttggtgaaaccccacttcctgct 328
           ||||||||||||| |||||||| |||||
Sbjct: 565 tgaacttggtgaatccccactttctgct 538

---

>dbj|AB007170.1| Homo sapiens gene for ribosomal protein L10, partial cds
          Length = 379

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 300 ttgaacttggtgaaaccccacttc 323
           |||||||||||||| |||||||||
Sbjct: 205 ttgaacttggtgaagccccacttc 182


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,246,962
Number of Sequences: 3902068
Number of extensions: 3246962
Number of successful extensions: 60668
Number of sequences better than 10.0: 166
Number of HSP's better than 10.0 without gapping: 166
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60401
Number of HSP's gapped (non-prelim): 257
length of query: 336
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 314
effective length of database: 17,147,199,772
effective search space: 5384220728408
effective search space used: 5384220728408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---