ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet13c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_474123.1| Oryza sativa (japonica cultivar-group), predic... 74 3e-10
2dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 74 3e-10
3dbj|AK103112.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
4emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 74 3e-10
5emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 74 3e-10
6emb|AL606635.3|OSJN00057 Oryza sativa genomic DNA, chromosome 4,... 74 3e-10
7emb|AJ401322.1|SHY401322 Saccharum hybrid cultivar R570 microsat... 56 7e-05
8gb|BT024071.1| Zea mays clone EL01N0501E06 mRNA sequence 50 0.005
9emb|AJ401342.1|SHY401342 Saccharum hybrid cultivar R570 microsat... 48 0.018
10gb|AC121334.5| Homo sapiens 12 BAC RP11-242C24 (Roswell Park Can... 44 0.28
11gb|AC004553.1| Homo sapiens X GSHB-223P11 (Genome Systems Human ... 44 0.28
12emb|CR378663.1| Photobacterium profundum SS9; segment 1/12 42 1.1
13ref|NM_125258.3| Arabidopsis thaliana ROC7; peptidyl-prolyl cis-... 40 4.4
14gb|AC099596.6| Mus musculus chromosome 15, clone RP23-26P23, com... 40 4.4
15gb|AY165702.1| Bombus sp. SLB-2003 cytochrome c oxidase subunit ... 40 4.4
16gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, com... 40 4.4
17gb|AC125188.4| Mus musculus BAC clone RP23-303O19 from chromosom... 40 4.4
18gb|AY094017.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, com... 40 4.4
19gb|AC093283.3| Homo sapiens chromosome 5 clone RP11-428C6, compl... 40 4.4
20gb|AC022138.5| Homo sapiens chromosome 5 clone CTD-2252A20, comp... 40 4.4
21gb|AY048227.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, com... 40 4.4
22gb|AC016749.4|AC016749 Homo sapiens clone RP11-504E20, complete ... 40 4.4
23emb|BX832221.1|CNS09ZS2 Arabidopsis thaliana Full-length cDNA Co... 40 4.4
24emb|BX830463.1|CNS09ZYM Arabidopsis thaliana Full-length cDNA Co... 40 4.4
25gb|AY086471.1| Arabidopsis thaliana clone 25325 mRNA, complete s... 40 4.4
26dbj|AB020755.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 4.4
27gb|AF192490.1|AF192490 Arabidopsis thaliana cyclophilin (ROC7) m... 40 4.4
28gb|AC147636.3| Mus musculus BAC clone RP23-201C3 from 9, complet... 40 4.4
29emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chr... 40 4.4
30gb|AF084916.1|AF084916 Bombus ternarius cytochrome oxidase I gen... 40 4.4
31gb|AC145211.3| Mus musculus BAC clone RP23-419G4 from 8, complet... 40 4.4

>ref|XM_474123.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2751

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 258  atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
            ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 2720 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 2661

                 
Query: 318  ttgct 322
            |||||
Sbjct: 2660 ttgct 2656



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 258      atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
                ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 33120026 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 33119967

                     
Query: 318      ttgct 322
                |||||
Sbjct: 33119966 ttgct 33119962



to top

>dbj|AK103112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119E14, full
            insert sequence
          Length = 3116

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 258  atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
            ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 2825 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 2766

                 
Query: 318  ttgct 322
            |||||
Sbjct: 2765 ttgct 2761



to top

>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 258   atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
             ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 10856 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 10797

                  
Query: 318   ttgct 322
             |||||
Sbjct: 10796 ttgct 10792



to top

>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
            complete sequence
          Length = 165745

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 258  atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
            ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 2676 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 2617

                 
Query: 318  ttgct 322
            |||||
Sbjct: 2616 ttgct 2612



to top

>emb|AL606635.3|OSJN00057 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010D21,
              complete sequence
          Length = 140626

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                          
Query: 258    atggcatcccttctccttcctgtcaggatcctcttgagcaagttggggttccccttctgc 317
              ||||| ||| |||||||||||| ||| ||||| || |||||||||| |||||||||||||
Sbjct: 129607 atggcttcctttctccttcctgccagaatccttttcagcaagttggtgttccccttctgc 129548

                   
Query: 318    ttgct 322
              |||||
Sbjct: 129547 ttgct 129543



to top

>emb|AJ401322.1|SHY401322 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR45
          Length = 473

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 279 gtcaggatcctcttgagcaagttggggttccccttctgcttgctggggacaacggc 334
           |||||||||||||| |||| | ||  ||||||||||||||| || |||||||||||
Sbjct: 143 gtcaggatcctcttcagcaggctgccgttccccttctgctttctcgggacaacggc 88



to top

>gb|BT024071.1| Zea mays clone EL01N0501E06 mRNA sequence
          Length = 2118

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 270  ctccttcctgtcaggatcctcttgagcaagttggggttccccttctgcttgctggggaca 329
            ||||| || |||||||||||||| |||| |  |  ||||||||||||||| || ||||||
Sbjct: 1683 ctcctgcccgtcaggatcctcttcagcaggccgccgttccccttctgctttctcgggaca 1624

                 
Query: 330  acggc 334
            |||||
Sbjct: 1623 acggc 1619



to top

>emb|AJ401342.1|SHY401342 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR65
          Length = 477

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 279 gtcaggatcctcttgagcaagttggggttccccttctgcttgctggggacaacggc 334
           |||||||||||||| |||| | ||  ||||||||||||||| || |||| ||||||
Sbjct: 146 gtcaggatcctcttcagcaggctgccgttccccttctgctttctcgggataacggc 91



to top

>gb|AC121334.5| Homo sapiens 12 BAC RP11-242C24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 185847

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 170    taatttacacatggaaatggaattta 195
              ||||||||| ||||||||||||||||
Sbjct: 164734 taatttacaaatggaaatggaattta 164759



to top

>gb|AC004553.1| Homo sapiens X GSHB-223P11 (Genome Systems Human BAC library) complete
             sequence
          Length = 80659

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   tttacacatggaaatggaattt 194
             ||||||||||||||||||||||
Sbjct: 23731 tttacacatggaaatggaattt 23710



to top

>emb|CR378663.1| Photobacterium profundum SS9; segment 1/12
          Length = 348044

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 133    tgacaagaacaccctcaacaagcaa 157
              ||||||| |||||||||||||||||
Sbjct: 236950 tgacaagcacaccctcaacaagcaa 236974



to top

>ref|NM_125258.3| Arabidopsis thaliana ROC7; peptidyl-prolyl cis-trans isomerase
           AT5G58710 (ROC7) mRNA, complete cds
          Length = 917

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 361 tttacacatggaaatggaat 380



to top

>gb|AC099596.6| Mus musculus chromosome 15, clone RP23-26P23, complete sequence
          Length = 210022

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 306    ttccccttctgcttgctggg 325
              ||||||||||||||||||||
Sbjct: 125619 ttccccttctgcttgctggg 125600



to top

>gb|AY165702.1| Bombus sp. SLB-2003 cytochrome c oxidase subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 624

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  taataatactgtaatacata 46
           ||||||||||||||||||||
Sbjct: 516 taataatactgtaatacata 497



to top

>gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, complete sequence
          Length = 204724

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 167   gcttaatttacacatggaaatgga 190
             |||||||||||||||||| |||||
Sbjct: 55890 gcttaatttacacatggagatgga 55913



to top

>gb|AC125188.4| Mus musculus BAC clone RP23-303O19 from chromosome 9, complete sequence
          Length = 194053

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    attatggcatcccttctcct 274
              ||||||||||||||||||||
Sbjct: 181806 attatggcatcccttctcct 181787



to top

>gb|AY094017.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, complete cds
          Length = 615

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 313 tttacacatggaaatggaat 332



to top

>gb|AC093283.3| Homo sapiens chromosome 5 clone RP11-428C6, complete sequence
          Length = 206254

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    aagttggggttccccttctg 316
              ||||||||||||||||||||
Sbjct: 198924 aagttggggttccccttctg 198905



to top

>gb|AC022138.5| Homo sapiens chromosome 5 clone CTD-2252A20, complete sequence
          Length = 174627

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   aagttggggttccccttctg 316
             ||||||||||||||||||||
Sbjct: 94698 aagttggggttccccttctg 94717



to top

>gb|AY048227.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, complete cds
          Length = 832

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 327 tttacacatggaaatggaat 346



to top

>gb|AC016749.4|AC016749 Homo sapiens clone RP11-504E20, complete sequence
          Length = 187117

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    taataatactgtaatacata 46
             ||||||||||||||||||||
Sbjct: 40733 taataatactgtaatacata 40752



to top

>emb|BX832221.1|CNS09ZS2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH5ZA06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 358 tttacacatggaaatggaat 377



to top

>emb|BX830463.1|CNS09ZYM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZF05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 839

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 339 tttacacatggaaatggaat 358



to top

>gb|AY086471.1| Arabidopsis thaliana clone 25325 mRNA, complete sequence
          Length = 780

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 356 tttacacatggaaatggaat 375



to top

>dbj|AB020755.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1
          Length = 81672

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   tttacacatggaaatggaat 192
             ||||||||||||||||||||
Sbjct: 53532 tttacacatggaaatggaat 53551



to top

>gb|AF192490.1|AF192490 Arabidopsis thaliana cyclophilin (ROC7) mRNA, complete cds
          Length = 761

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tttacacatggaaatggaat 192
           ||||||||||||||||||||
Sbjct: 336 tttacacatggaaatggaat 355



to top

>gb|AC147636.3| Mus musculus BAC clone RP23-201C3 from 9, complete sequence
          Length = 202197

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 255    attatggcatcccttctcct 274
              ||||||||||||||||||||
Sbjct: 161331 attatggcatcccttctcct 161350



to top

>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete
              sequence
          Length = 168760

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 167    gcttaatttacacatggaaatgga 190
              |||||||||||||||||| |||||
Sbjct: 120789 gcttaatttacacatggagatgga 120812



to top

>gb|AF084916.1|AF084916 Bombus ternarius cytochrome oxidase I gene, partial cds;
          mitochondrial gene for mitochondrial product
          Length = 333

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 27 taataatactgtaatacata 46
          ||||||||||||||||||||
Sbjct: 81 taataatactgtaatacata 62



to top

>gb|AC145211.3| Mus musculus BAC clone RP23-419G4 from 8, complete sequence
          Length = 191166

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 292    tgagcaagttggggttcccc 311
              ||||||||||||||||||||
Sbjct: 103819 tgagcaagttggggttcccc 103838


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,090,665
Number of Sequences: 3902068
Number of extensions: 3090665
Number of successful extensions: 58830
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58771
Number of HSP's gapped (non-prelim): 58
length of query: 335
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 313
effective length of database: 17,147,199,772
effective search space: 5367073528636
effective search space used: 5367073528636
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top