ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet13b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, compl... 40 2.2
2emb|BX663521.10| Zebrafish DNA sequence from clone DKEYP-50F5 in... 40 2.2
3emb|CR847890.19| Zebrafish DNA sequence from clone DKEYP-70H9 in... 40 2.2
4emb|CT030247.6| Mouse DNA sequence from clone RP23-340G24 on chr... 40 2.2
5gb|AC002209.1|AC002209 Homo sapiens (subclone 2_e10 from P1 H31)... 40 2.2
6emb|AL928882.10| Mouse DNA sequence from clone RP23-281I20 on ch... 40 2.2
7ref|XM_638433.1| Dictyostelium discoideum hypothetical protein (... 38 8.6
8gb|AC135080.2| Mus musculus BAC clone RP24-369P14 from chromosom... 38 8.6
9gb|AE014075.1| Escherichia coli CFT073, complete genome 38 8.6
10gb|AC145023.4| Medicago truncatula clone mth2-30j24, complete se... 38 8.6
11gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, com... 38 8.6
12gb|AC148227.14| Medicago truncatula clone mth2-8f11, complete se... 38 8.6
13gb|CP000243.1| Escherichia coli UTI89, complete genome 38 8.6
14emb|BX957222.1| Methanococcus maripaludis S2 complete genome; se... 38 8.6
15emb|AJ586889.1| Escherichia coli partial Genomic Island III, str... 38 8.6
16emb|BX248106.7| Zebrafish DNA sequence from clone CH211-123P13 i... 38 8.6
17gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, com... 38 8.6
18gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, com... 38 8.6
19gb|AC114497.1| Homo sapiens chromosome 1 clone RP11-568G23, comp... 38 8.6
20gb|AF414945.1| Arabidopsis thaliana holocarboxylase synthetase h... 38 8.6
21gb|AF414940.1| Arabidopsis thaliana holocarboxylase synthetase h... 38 8.6
22gb|AF414939.1| Arabidopsis thaliana holocarboxylase synthetase h... 38 8.6
23gb|AC108074.3| Homo sapiens BAC clone RP11-717H13 from 4, comple... 38 8.6
24gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-... 38 8.6
25emb|AL626767.15| Mouse DNA sequence from clone RP23-421C7 on chr... 38 8.6
26emb|BX890545.7| Zebrafish DNA sequence from clone CH211-253N4 in... 38 8.6
27emb|CT009540.10| M.truncatula DNA sequence from clone MTH2-39B3 ... 38 8.6

>gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, complete sequence
          Length = 84991

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 10    aataaattaataattcatgctcca 33
             |||| |||||||||||||||||||
Sbjct: 49447 aatagattaataattcatgctcca 49424



to top

>emb|BX663521.10| Zebrafish DNA sequence from clone DKEYP-50F5 in linkage group 14,
              complete sequence
          Length = 179663

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     cggttttacaggttcaatcc 77
              ||||||||||||||||||||
Sbjct: 113082 cggttttacaggttcaatcc 113101



to top

>emb|CR847890.19| Zebrafish DNA sequence from clone DKEYP-70H9 in linkage group 14,
             complete sequence
          Length = 217550

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     acaataaattaataattcat 27
             ||||||||||||||||||||
Sbjct: 64381 acaataaattaataattcat 64400



to top

>emb|CT030247.6| Mouse DNA sequence from clone RP23-340G24 on chromosome 9, complete
              sequence
          Length = 218753

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      cacacaataaattaataatt 24
              ||||||||||||||||||||
Sbjct: 208348 cacacaataaattaataatt 208329



to top

>gb|AC002209.1|AC002209 Homo sapiens (subclone 2_e10 from P1 H31) DNA sequence, complete
            sequence
          Length = 4858

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 10   aataaattaataattcatgctcca 33
            |||| |||||||||||||||||||
Sbjct: 4251 aatagattaataattcatgctcca 4274



to top

>emb|AL928882.10| Mouse DNA sequence from clone RP23-281I20 on chromosome 2, complete
             sequence
          Length = 147002

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     acacaataaattaataattc 25
             ||||||||||||||||||||
Sbjct: 83233 acacaataaattaataattc 83214



to top

>ref|XM_638433.1| Dictyostelium discoideum hypothetical protein (DDB0217701), partial
            mRNA
          Length = 5217

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 77   caacaccaacactaacggtaaca 99
            ||||||||||||||||| |||||
Sbjct: 1577 caacaccaacactaacgctaaca 1599



to top

>gb|AC135080.2| Mus musculus BAC clone RP24-369P14 from chromosome 1, complete sequence
          Length = 164994

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     caggttcaatccaacacca 84
              |||||||||||||||||||
Sbjct: 122038 caggttcaatccaacacca 122020



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 114     tcgacaacattaacggcga 132
               |||||||||||||||||||
Sbjct: 2732983 tcgacaacattaacggcga 2732965



to top

>gb|AC145023.4| Medicago truncatula clone mth2-30j24, complete sequence
          Length = 90381

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 147   tgaagagtgaaaacggcga 165
             |||||||||||||||||||
Sbjct: 41130 tgaagagtgaaaacggcga 41112



to top

>gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, complete sequence
          Length = 165387

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     caggttcaatccaacacca 84
              |||||||||||||||||||
Sbjct: 148102 caggttcaatccaacacca 148120



to top

>gb|AC148227.14| Medicago truncatula clone mth2-8f11, complete sequence
          Length = 116139

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 147   tgaagagtgaaaacggcga 165
             |||||||||||||||||||
Sbjct: 63132 tgaagagtgaaaacggcga 63114



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 114     tcgacaacattaacggcga 132
               |||||||||||||||||||
Sbjct: 2583583 tcgacaacattaacggcga 2583565



to top

>emb|BX957222.1| Methanococcus maripaludis S2 complete genome; segment 4/5
          Length = 349607

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     cacacaataaattaataat 23
             |||||||||||||||||||
Sbjct: 51552 cacacaataaattaataat 51570



to top

>emb|AJ586889.1| Escherichia coli partial Genomic Island III, strain Nissle 1917
          Length = 37881

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 114   tcgacaacattaacggcga 132
             |||||||||||||||||||
Sbjct: 10854 tcgacaacattaacggcga 10836



to top

>emb|BX248106.7| Zebrafish DNA sequence from clone CH211-123P13 in linkage group 17,
             complete sequence
          Length = 140228

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aataaattaataattcatg 28
             |||||||||||||||||||
Sbjct: 19223 aataaattaataattcatg 19241



to top

>gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, complete sequence
          Length = 175936

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 9      caataaattaataattcat 27
              |||||||||||||||||||
Sbjct: 173418 caataaattaataattcat 173436



to top

>gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, complete sequence
          Length = 121660

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     caataaattaataattcat 27
             |||||||||||||||||||
Sbjct: 36359 caataaattaataattcat 36341



to top

>gb|AC114497.1| Homo sapiens chromosome 1 clone RP11-568G23, complete sequence
          Length = 127715

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aataaattaataattcatg 28
             |||||||||||||||||||
Sbjct: 97574 aataaattaataattcatg 97556



to top

>gb|AF414945.1| Arabidopsis thaliana holocarboxylase synthetase hcs2.h mRNA,
           partial sequence
          Length = 543

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 70  ttcaatccaacaccaacactaac 92
           |||||||| ||||||||||||||
Sbjct: 473 ttcaatcccacaccaacactaac 451



to top

>gb|AF414940.1| Arabidopsis thaliana holocarboxylase synthetase hcs2.c mRNA,
           complete cds
          Length = 932

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 70  ttcaatccaacaccaacactaac 92
           |||||||| ||||||||||||||
Sbjct: 511 ttcaatcccacaccaacactaac 489



to top

>gb|AF414939.1| Arabidopsis thaliana holocarboxylase synthetase hcs2.b mRNA,
           complete cds
          Length = 1139

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 70  ttcaatccaacaccaacactaac 92
           |||||||| ||||||||||||||
Sbjct: 718 ttcaatcccacaccaacactaac 696



to top

>gb|AC108074.3| Homo sapiens BAC clone RP11-717H13 from 4, complete sequence
          Length = 128635

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 15     attaataattcatgctcca 33
              |||||||||||||||||||
Sbjct: 122027 attaataattcatgctcca 122045



to top

>gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-735498 strain AX4,
             complete sequence
          Length = 154071

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 77    caacaccaacactaacggtaaca 99
             ||||||||||||||||| |||||
Sbjct: 98668 caacaccaacactaacgctaaca 98646



to top

>emb|AL626767.15| Mouse DNA sequence from clone RP23-421C7 on chromosome 4, complete
              sequence
          Length = 199694

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      acacaataaattaataatt 24
              |||||||||||||||||||
Sbjct: 125008 acacaataaattaataatt 124990



to top

>emb|BX890545.7| Zebrafish DNA sequence from clone CH211-253N4 in linkage group 4,
             complete sequence
          Length = 186267

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 132   acaaggagtaataactgaa 150
             |||||||||||||||||||
Sbjct: 51430 acaaggagtaataactgaa 51412



to top

>emb|CT009540.10| M.truncatula DNA sequence from clone MTH2-39B3 on chromosome 3,
             complete sequence
          Length = 127327

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     atcacacaataaattaata 21
             |||||||||||||||||||
Sbjct: 95274 atcacacaataaattaata 95292


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,685,964
Number of Sequences: 3902068
Number of extensions: 1685964
Number of successful extensions: 130774
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130649
Number of HSP's gapped (non-prelim): 125
length of query: 175
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 153
effective length of database: 17,147,199,772
effective search space: 2623521565116
effective search space used: 2623521565116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top