>gb|AY968589.1| Triticum aestivum ice recrystallization inhibition protein 2
            precursor, mRNA, complete cds
          Length = 1596

 Score =  343 bits (173), Expect = 2e-91
 Identities = 260/289 (89%)
 Strand = Plus / Minus

                                                                        
Query: 4    taaaacgttttgtggatatttaagtagtaaaaggatactatacccatgaagttacaaata 63
            ||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 1407 taaaacgttttgtggatattttagtagtaataggattctatacccatgaagttacaaata 1348

                                                                        
Query: 64   cgcgattgggctcatcaagcgattgtaaactacattgaacttggacaaggacatgagctc 123
            ||||||||| | || |||| |||||| ||||||| |||||||||||||||||||||||||
Sbjct: 1347 cgcgattggccccaccaagggattgtgaactacactgaacttggacaaggacatgagctc 1288

                                                                        
Query: 124  ctcgggggaagagggaatcaatccactcacatatcactatcctccagttactactttgtt 183
            ||| || ||||||||||| |||||||| ||| ||||||| ||||||||||| ||||||||
Sbjct: 1287 ctccggagaagagggaattaatccactgacagatcactaacctccagttacgactttgtt 1228

                                                                        
Query: 184  gttcccagatacgacatggttgccccctgatacaacattgttgctccctgtcacaacatt 243
             |||||||||||||||||||| | ||| ||||||||||| |||||||| || || |||||
Sbjct: 1227 attcccagatacgacatggtttctcccagatacaacattattgctcccagttacgacatt 1168

                                                             
Query: 244  gtttctcccggatacaacattgttgctcccatacacaacatggtttctc 292
            ||| ||||||||||| ||||||| ||||||| | |||||||||||||||
Sbjct: 1167 gttcctcccggatacgacattgtcgctcccagaaacaacatggtttctc 1119

>gb|AY968588.1| Triticum aestivum ice recrystallization inhibition protein 1
           precursor, mRNA, complete cds
          Length = 1079

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 179 ttgttgttcccagatacgacatggttgccccctgataca 217
           |||||| ||||||||||||||||||||| ||| ||||||
Sbjct: 923 ttgttgctcccagatacgacatggttgctcccagataca 885

>gb|AC132471.4| Mus musculus BAC clone RP23-106E17 from 10, complete sequence
          Length = 197822

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 92    actacattgaacttggacaagg 113
             ||||||||||||||||||||||
Sbjct: 64135 actacattgaacttggacaagg 64156

>gb|AC145945.2| Gallus gallus chromosome UNK clone CH261-23M4, complete sequence
          Length = 199148

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 16     tggatatttaagtagtaaaag 36
              |||||||||||||||||||||
Sbjct: 197509 tggatatttaagtagtaaaag 197489

>emb|AL713889.19| Human DNA sequence from clone RP11-354A16 on chromosome 1 Contains the
             5' end of the ILF2 gene for interleukin enhancer binding
             factor 2, 45kDa, the NPR1 gene for natriuretic peptide
             receptor A/guanylate cyclase A (atrionatriuretic peptide
             receptor A), a novel gene and a CpG island, complete
             sequence
          Length = 54184

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   ctcctcgggggaagagggaa 140
             ||||||||||||||||||||
Sbjct: 14953 ctcctcgggggaagagggaa 14934

>gb|AC007645.4|AC007645 Drosophila melanogaster, chromosome 3R, region 86C-86D, BAC clone
              BACR04L09, complete sequence
          Length = 165136

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    acaacattgttgctcccata 276
              ||||||||||||||||||||
Sbjct: 113218 acaacattgttgctcccata 113199

>gb|AC107033.3| Homo sapiens 12 BAC RP11-669N7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 182000

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   gggaatcaatccactcacat 155
             ||||||||||||||||||||
Sbjct: 40721 gggaatcaatccactcacat 40702

>emb|AJ277399.1|LPE277399 Lolium perenne partial mRNA for ice recrystallisation inhibition
           protein
          Length = 357

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 176 actttgttgttcccagatacgacatggttgccccctgatacaacattgttgctccc 231
           ||||||||| | |||||||| || ||||||| ||| |||||   ||||||||||||
Sbjct: 341 actttgttgcttccagatacaacgtggttgctcccagatacggtattgttgctccc 286

>gb|AF190631.1|AF190631 Homo sapiens natriuretic peptide receptor A (NPR1) gene, complete
           cds
          Length = 15810

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 121 ctcctcgggggaagagggaa 140
           ||||||||||||||||||||
Sbjct: 41  ctcctcgggggaagagggaa 22

>emb|BX936416.11| Zebrafish DNA sequence from clone CH211-194I16 in linkage group 18,
              complete sequence
          Length = 214763

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttgtggatatttaagtagt 31
              ||||||||||||||||||||
Sbjct: 141532 tttgtggatatttaagtagt 141513

>gb|AE003689.2| Drosophila melanogaster chromosome 3R, section 27 of 118 of the complete
              sequence
          Length = 215899

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    acaacattgttgctcccata 276
              ||||||||||||||||||||
Sbjct: 205712 acaacattgttgctcccata 205693

>dbj|AB012188.1| Homo sapiens gene for ANP type A receptor, promoter region
          Length = 2075

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 121  ctcctcgggggaagagggaa 140
            ||||||||||||||||||||
Sbjct: 1305 ctcctcgggggaagagggaa 1286


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,250,684
Number of Sequences: 3902068
Number of extensions: 2250684
Number of successful extensions: 39388
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39364
Number of HSP's gapped (non-prelim): 23
length of query: 292
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 270
effective length of database: 17,147,199,772
effective search space: 4629743938440
effective search space used: 4629743938440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)