ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet125d03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 747 0.0
2gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 147 3e-32
3gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 139 8e-30
4gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 135 1e-28
5gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 135 1e-28
6emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 135 1e-28
7gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 131 2e-27
8gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 131 2e-27
9gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 131 2e-27
10gb|AY103580.1| Zea mays PCO072544 mRNA sequence 131 2e-27
11gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 121 2e-24
12gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 121 2e-24
13gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 121 2e-24
14emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 109 7e-21
15dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
16dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
17dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
18gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 109 7e-21
19dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 109 7e-21
20ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 107 3e-20
21dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
22dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
23dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
24dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
25emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 105 1e-19
26dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 100 7e-18
27dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
28dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
29dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
30dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 92 2e-15
31emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 90 6e-15
32dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 90 6e-15
33gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 84 4e-13
34gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 82 2e-12
35emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 72 1e-09
36gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 72 1e-09
37gb|AY107675.1| Zea mays PCO112712 mRNA sequence 72 1e-09
38ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 70 6e-09
39emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 70 6e-09
40dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
41dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 70 6e-09
42emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 64 4e-07
43dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
44dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 60 6e-06
45emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 56 9e-05
46ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 54 3e-04
47gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 54 3e-04
48gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 50 0.005
49gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 50 0.005
50gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 50 0.005
51gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 50 0.005
52gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 50 0.005
53gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 50 0.005
54ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 48 0.022
55ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 48 0.022
56ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 48 0.022
57dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 48 0.022
58gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.022
59dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.022
60dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.022
61dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.022
62dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.022
63dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.022
64gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 48 0.022
65ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.085
66gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.085
67emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 46 0.085
68dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.085
69dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.085
70dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.085
71emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 46 0.085
72emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1 44 0.34
73gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 44 0.34
74ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA 44 0.34
75gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA 44 0.34
76emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.34
77gb|AY107589.1| Zea mays PCO085320 mRNA sequence 44 0.34
78gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 44 0.34
79ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 42 1.3
80gb|AC068467.7| Homo sapiens chromosome 8, clone RP11-643F5, comp... 42 1.3
81gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 42 1.3
82gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 42 1.3
83gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 42 1.3
84gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 42 1.3
85gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 42 1.3
86dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 42 1.3
87emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 42 1.3
88emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 42 1.3
89emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 42 1.3
90gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete c... 42 1.3
91gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 42 1.3
92gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 42 1.3
93dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
94emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 42 1.3
95gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 42 1.3
96dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 42 1.3
97gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.3
98ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 5.3
99ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 40 5.3
100ref|XM_550604.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.3
101ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 40 5.3
102gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 40 5.3
103gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 5.3
104emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 5.3
105emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel p... 40 5.3
106gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 5.3
107emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037... 40 5.3
108emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 5.3
109emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 40 5.3
110gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 5.3
111emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 40 5.3
112emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 5.3
113emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 40 5.3
114gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 5.3
115gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 5.3
116gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 5.3
117gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 5.3
118gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 5.3
119gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.3
120gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 5.3
121gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 5.3
122gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 5.3
123gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 5.3
124gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 5.3
125dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 5.3
126gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 40 5.3
127gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 5.3
128gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 40 5.3
129gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 40 5.3
130dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
131dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
132gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 40 5.3
133emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 40 5.3
134emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 5.3
135emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 5.3
136emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 5.3
137emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 5.3
138gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 5.3
139dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
140gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 5.3
141dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
142emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 5.3
143dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
144dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
145emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 5.3
146dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 40 5.3
147gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 5.3
148gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 40 5.3
149gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 5.3
150dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 5.3

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  747 bits (377), Expect = 0.0
 Identities = 389/393 (98%)
 Strand = Plus / Minus

                                                                        
Query: 1    ctggatttgcacaacaacgagcagtactacacaacaactgagcactgatgagattacata 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1189 ctggatttgcacaacaacgagcagtactacacaacaactgagcactgatgagattacata 1130

                                                                        
Query: 61   caagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagcacatcaaact 120
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1129 caagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagtacatcaaact 1070

                                                                        
Query: 121  tggaagacaaattggaattccacggtaacacggacgatgggaagagagggccgcccccat 180
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1069 tggaagacaaattggaattccacggtaacagggacgatgggaagagagggccgcccccat 1010

                                                                        
Query: 181  cagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatggcatctttctt 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1009 cagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatggcatctttctt 950

                                                                        
Query: 241  tgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggta 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 949  tgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggta 890

                                                                        
Query: 301  gatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgacca 360
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 889  gatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgacca 830

                                             
Query: 361  ggcgtgctccctgttgaagatgatggccgcgcc 393
            |||||||||||||||| ||||||||||||||||
Sbjct: 829  ggcgtgctccctgttgtagatgatggccgcgcc 797



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  147 bits (74), Expect = 3e-32
 Identities = 128/146 (87%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||||||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                                                       
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgc 367
           ||||| || ||||| ||||||||||||||||||| |||||| |||||   ||||||||| 
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccagaagatccaatggtcgttccaggcgtga 816

                                     
Query: 368 tccctgttgaagatgatggccgcgcc 393
           ||||||||| |||||||||| |||||
Sbjct: 815 tccctgttgtagatgatggcagcgcc 790



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  139 bits (70), Expect = 8e-30
 Identities = 115/130 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| ||||| || ||||||| ||||||||||||||||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||||||||||||||||| |||||| |||||   ||||||||||||||||||| ||||||
Sbjct: 352 tgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagatga 293

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 292 tggcagcgcc 283



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  135 bits (68), Expect = 1e-28
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                                                   
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggc 363
           |||||||||||||||||| |||||||||||| | ||||||
Sbjct: 365 tgaaggggccgacccagaagatccagtggtcagcccaggc 326



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  135 bits (68), Expect = 1e-28
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                                                   
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggc 363
           |||||||||||||||||| |||||||||||| | ||||||
Sbjct: 796 tgaaggggccgacccagaagatccagtggtcagcccaggc 757



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  135 bits (68), Expect = 1e-28
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                                                   
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggc 363
           |||||||||||||||||| |||||||||||| | ||||||
Sbjct: 853 tgaaggggccgacccagaagatccagtggtcagcccaggc 814



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                                                       
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgc 367
           ||||| |||||||||||||||||||||||||||| |||||| |||||   ||| || || 
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 715

                                     
Query: 368 tccctgttgaagatgatggccgcgcc 393
           |||| |||| |||||||||| |||||
Sbjct: 714 tcccggttgtagatgatggcggcgcc 689



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                                                       
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgc 367
           ||||| |||||||||||||||||||||||||||| |||||| |||||   ||| || || 
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 865

                                     
Query: 368 tccctgttgaagatgatggccgcgcc 393
           |||| |||| |||||||||| |||||
Sbjct: 864 tcccggttgtagatgatggcggcgcc 839



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                                                       
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgc 367
           ||||| |||||||||||||||||||||||||||| |||||| |||||   ||| || || 
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 860

                                     
Query: 368 tccctgttgaagatgatggccgcgcc 393
           |||| |||| |||||||||| |||||
Sbjct: 859 tcccggttgtagatgatggcggcgcc 834



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Minus

                                                                        
Query: 248  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                                                        
Query: 308  gccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgc 367
            ||||| |||||||||||||||||||||||||||| |||||| |||||   ||| || || 
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 1189

                                      
Query: 368  tccctgttgaagatgatggccgcgcc 393
            |||| |||| |||||||||| |||||
Sbjct: 1188 tcccggttgtagatgatggcggcgcc 1163



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  121 bits (61), Expect = 2e-24
 Identities = 91/101 (90%)
 Strand = Plus / Plus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                                    
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatcca 348
           ||||| |||||||||||||||||||||||||||| ||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccagaagatcca 344



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  121 bits (61), Expect = 2e-24
 Identities = 91/101 (90%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 307
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                                    
Query: 308 gccagcgcggcgccgatgaaggggccgacccagacgatcca 348
           ||||| |||||||||||||||||||||||||||| ||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccagaagatcca 433



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 249 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 308
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                                                       
Query: 309 ccagcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgct 368
           |||| || || || ||||||||||||||||||| |||||| |||||   |||||| || |
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccagaagatccaatggtcgctccaggcatgat 240

                                    
Query: 369 ccctgttgaagatgatggccgcgcc 393
           |||||||| |||||||||| |||||
Sbjct: 239 ccctgttgtagatgatggcagcgcc 215



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 836 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 777

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 776 ttgttgtagatgatggcagcgcc 754



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 809 ttgttgtagatgatggcagcgcc 787



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 924 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 865

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 864 ttgttgtagatgatggcagcgcc 842



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 809 ttgttgtagatgatggcagcgcc 787



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 864 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 805

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 804 ttgttgtagatgatggcagcgcc 782



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                                                       
Query: 311 agcgcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctcc 370
           || || ||||| | |||||| || ||||||| |||||| |||||   |||||| || |||
Sbjct: 867 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 808

                                  
Query: 371 ctgttgaagatgatggccgcgcc 393
            ||||| |||||||||| |||||
Sbjct: 807 ttgttgtagatgatggcagcgcc 785



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||||||||| ||||||| |||||| |||||   |||||| ||  |||||||| ||||||
Sbjct: 778 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 719

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 718 tggcagcgcc 709



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||||||||| ||||||| |||||| |||||   |||||| ||  |||||||| ||||||
Sbjct: 855 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 796

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 795 tggcagcgcc 786



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||||||||| ||||||| |||||| |||||   |||||| ||  |||||||| ||||||
Sbjct: 856 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 797

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 796 tggcagcgcc 787



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||||||||| ||||||| |||||| |||||   |||||| ||  |||||||| ||||||
Sbjct: 858 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 799

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 798 tggcagcgcc 789



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
            |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                                                                        
Query: 324  tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
            |||||||||| ||||||| |||||| |||||   |||||| ||  |||||||| ||||||
Sbjct: 1154 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 1095

                      
Query: 384  tggccgcgcc 393
            |||| |||||
Sbjct: 1094 tggcagcgcc 1085



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  105 bits (53), Expect = 1e-19
 Identities = 56/57 (98%)
 Strand = Plus / Minus

                                                                     
Query: 292  ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
            |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 349 gtggtctgaccaggcgtgctccctgttgaagatgatggccgcgcc 393
           |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 680 gtggtctgaccaggcgtgctccctgttgtagatgatggccgcgcc 636



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gctctgatgaccacctggtggtagatggcggccagcgcggcgccgatgaaggggccgacc 337
           |||||||||| |||||||||||||| ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

                                                             
Query: 338 cagacgatccagtggtctgaccaggcgtgctccctgttgaagatgatggc 387
           |||| |||||| |||||   |||||| || ||||||||| ||||||||||
Sbjct: 867 cagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                            
Query: 251      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                                      
Query: 311      agcgcggcgccgatgaaggggccgacccagacgatcca 348
                || || ||||| | |||||| || ||||||| ||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccagaagatcca 27065556



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                            
Query: 264      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
                ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 35369403 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 35369344

                                  
Query: 324      tgaaggggccgacccaga 341
                |||| || || |||||||
Sbjct: 35369343 tgaacggaccaacccaga 35369326



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 292      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
                ||||||||||  |||||| |  ||||||||||| | |||||| ||||||| ||||||
Sbjct: 25184661 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 25184605



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                         
Query: 251   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                                   
Query: 311   agcgcggcgccgatgaaggggccgacccagacgatcca 348
             || || ||||| | |||||| || ||||||| ||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccagaagatcca 37205



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                          
Query: 251    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 310
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                                    
Query: 311    agcgcggcgccgatgaaggggccgacccagacgatcca 348
              || || ||||| | |||||| || ||||||| ||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccagaagatcca 118758



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||| || || ||||||| ||||||||||||   ||| || |||| | ||||| ||||||
Sbjct: 885 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 826

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 825 tggcggcgcc 816



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                         
Query: 264   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
             |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                                      
Query: 324   tgaaggggccgacccagacgatcca 348
             |||||||||| ||||||| ||||||
Sbjct: 28609 tgaaggggccaacccagaagatcca 28585



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                            
Query: 264      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
                |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                         
Query: 324      tgaaggggccgacccagacgatcca 348
                |||||||||| ||||||| ||||||
Sbjct: 28021383 tgaaggggccaacccagaagatcca 28021359



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 292      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
                ||||||||||  |||||| |  ||||||||||||| ||| || ||||||| ||||||
Sbjct: 26074808 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| ||||| || ||||| ||||||  |||||||||||| |||||||| || ||||
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||| || || ||||||| ||||||||||||   ||| || |||| | ||||| ||||||
Sbjct: 870 tgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 811

                     
Query: 384 tggccgcgcc 393
           |||| |||||
Sbjct: 810 tggcggcgcc 801



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 317
           |||||| |||||| || || ||||||||||||||||||||||| |  || || || ||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggtataaagctgctagtgcgg 828

                                                                       
Query: 318 cgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttga 377
           | || ||||| || || ||||||| ||||||||||||   ||| ||||| ||| ||||| 
Sbjct: 827 ccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgt 768

                        
Query: 378 agatgatggccgc 390
           |||||||||||||
Sbjct: 767 agatgatggccgc 755



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           ||||||||||||||| || || || |||||||||||||| ||||||| ||||||||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 847



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           ||||||||||||||| || || || |||||||||||||| ||||||| ||||||||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 838



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           ||||||||||||||| || || || |||||||||||||| ||||||| ||||||||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 271



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                                           
Query: 324  tgaaggggccgacccagacgatccagtggtc 354
            |||| || || |||||||  |||||||||||
Sbjct: 948  tgaacggaccaacccagaaaatccagtggtc 918



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 258 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 317
           ||||| ||||||||||||| |||||||| ||||||   ||||| |  || ||||  || |
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctg 788

                                                                       
Query: 318 cgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttga 377
           |||| ||||| || || ||||||| ||||||||||||   ||||||||| ||||||||| 
Sbjct: 787 cgccaatgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgt 728

                  
Query: 378 agatgat 384
           |||||||
Sbjct: 727 agatgat 721



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                                           
Query: 324  tgaaggggccgacccagacgatccagtggtc 354
            |||| || || |||||||  |||||||||||
Sbjct: 947  tgaacggaccaacccagaaaatccagtggtc 917



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                                          
Query: 324 tgaaggggccgacccagacgatccagtggtc 354
           |||| || || |||||||  |||||||||||
Sbjct: 925 tgaacggaccaacccagaaaatccagtggtc 895



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           ||||||| || || ||||||||||| | |||||||||||  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                                                                       
Query: 324 tgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatga 383
           |||| ||||| ||||||| ||||||||||||   ||| || || ||  ||||||||||||
Sbjct: 871 tgaaagggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatga 812

               
Query: 384 tggc 387
           ||||
Sbjct: 811 tggc 808



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                         
Query: 264   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
             ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 29951 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 29892

                               
Query: 324   tgaaggggccgacccaga 341
             |||| || || |||||||
Sbjct: 29891 tgaacggaccaacccaga 29874



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 4906 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 4847

                              
Query: 324  tgaaggggccgacccaga 341
            |||| || || |||||||
Sbjct: 4846 tgaacggaccaacccaga 4829



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 ggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgcc 321
           |||||||||||| || ||||||||||| | |||||||||||| || || || || || ||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggtagattgcagcaagggcagctcc 815

                               
Query: 322 gatgaaggggccgacccaga 341
            |||||||| || |||||||
Sbjct: 814 aatgaagggaccaacccaga 795



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 292 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtg 351
           ||||||||||  |||||| |  ||||||||||||| ||| || ||||||| |||||||||
Sbjct: 816 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatccagtg 757

              
Query: 352 gtc 354
           |||
Sbjct: 756 gtc 754



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/127 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 tggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgc 320
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                                                       
Query: 321 cgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaaga 380
           | |||||||| || |||||||  |||||   |||   |||||| ||||| |||||| |||
Sbjct: 847 caatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtaga 788

                  
Query: 381 tgatggc 387
           |||||||
Sbjct: 787 tgatggc 781



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 325
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                                        
Query: 326 aaggggccgacccagacgatccagtggtc 354
           || || || |||||||  ||||| |||||
Sbjct: 116 aatggcccaacccagaaaatccaatggtc 88



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 782 gcggcgccgatgaatggacccacccagaagatccagtggtc 742



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 837 gcggcgccgatgaatggacccacccagaagatccagtggtc 797



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 292 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
           ||||||||||| ||| || | ||| |||||||| | |||||||||||||| ||||||
Sbjct: 890 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 834



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 325
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                                        
Query: 326 aaggggccgacccagacgatccagtggtc 354
           || || || |||||||  ||||| |||||
Sbjct: 876 aatggcccaacccagaatatccaatggtc 848



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggtc 354
           |||||||||||||| ||||| ||||||| |||||| |||||
Sbjct: 792 gcggcgccgatgaacgggccaacccagaagatccactggtc 752



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctg 373
           |||||||||| ||| ||||||||||||| |||||| ||||    |||||| | |||  ||
Sbjct: 467 gcggcgccgacgaacgggccgacccagaagatccattggttgtgccaggccttctcgttg 408

                           
Query: 374 ttgaagatgatggccg 389
           |||||||||| |||||
Sbjct: 407 ttgaagatgacggccg 392



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 265 cttgaatgggatcgctctgatgaccacctggtggta 300
           |||||||||||| |||||||| || |||||||||||
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggta 902



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 495 gcggcgccgacgaacgggccgacccagaagatccaatggt 456



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||| ||||||||||||| |||||| ||||
Sbjct: 891 gcggcgccgacgaacgggccgacccagaagatccaatggt 852



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtg 351
           ||||||||||  |||||| |  ||||||||||| | |||||| ||||||| |||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

              
Query: 352 gtc 354
           |||
Sbjct: 820 gtc 818



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 301    gatggcggccagcgcggcgccga 323
              |||||||||||||||||||||||
Sbjct: 310343 gatggcggccagcgcggcgccga 310365



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 98/123 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 867 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 808

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || |||||||| | || ||| |||||   ||| ||||  ||| |||||||||||||
Sbjct: 807 gaatggtccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 748

              
Query: 385 ggc 387
           |||
Sbjct: 747 ggc 745



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                   
Query: 314      gcggcgccgatgaaggggccgacccagacgatcca 348
                |||||||||| ||| ||||||||||||| ||||||
Sbjct: 15355775 gcggcgccgacgaacgggccgacccagaagatcca 15355741



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 314   gcggcgccgatgaaggggccgacccagacgatcca 348
             |||||||||| ||| ||||||||||||| ||||||
Sbjct: 62774 gcggcgccgacgaacgggccgacccagaagatcca 62740



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatccagtg 351
           ||||||||||  |||||| |  ||||||||||| | |||||| ||||||| |||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

              
Query: 352 gtc 354
           |||
Sbjct: 820 gtc 818



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 68     tctgtctgggttcaggtgaatacagag 94
              ||||||||||| |||||||||||||||
Sbjct: 225070 tctgtctgggtacaggtgaatacagag 225044



to top

>emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1
          Length = 34127

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 285  tgaccacctggtggtagatggc 306
            ||||||||||||||||||||||
Sbjct: 9156 tgaccacctggtggtagatggc 9135



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 285  tgaccacctggtggtagatggc 306
            ||||||||||||||||||||||
Sbjct: 5054 tgaccacctggtggtagatggc 5033



to top

>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 285   tgaccacctggtggtagatggc 306
             ||||||||||||||||||||||
Sbjct: 34675 tgaccacctggtggtagatggc 34654



to top

>ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA
          Length = 3292

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 285  tgaccacctggtggtagatggc 306
            ||||||||||||||||||||||
Sbjct: 2313 tgaccacctggtggtagatggc 2292



to top

>gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA
          Length = 2897

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 285  tgaccacctggtggtagatggc 306
            ||||||||||||||||||||||
Sbjct: 1897 tgaccacctggtggtagatggc 1876



to top

>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggta 300
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtg 351
           |||||||||||||  |||||||||||||  ||||||||
Sbjct: 209 gcggcgccgatgagtgggccgacccagaatatccagtg 172



to top

>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete
              sequence
          Length = 310993

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 285    tgaccacctggtggtagatggc 306
              ||||||||||||||||||||||
Sbjct: 239024 tgaccacctggtggtagatggc 239045



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 787 gatgatggc 779



to top

>gb|AC068467.7| Homo sapiens chromosome 8, clone RP11-643F5, complete sequence
          Length = 185895

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 364    gtgctccctgttgaagatgat 384
              |||||||||||||||||||||
Sbjct: 140650 gtgctccctgttgaagatgat 140630



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 858 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 799

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 798 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 739

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 738 gatgatggc 730



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                                    
Query: 324 tgaaggggccgacccagacgatcca 348
           |||| || || ||||||| ||||||
Sbjct: 849 tgaaaggtcccacccagaagatcca 825



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           |||||||||||| |||||||| || | ||||||||| | ||| || || || || || ||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctccaat 852

                            
Query: 325 gaaggggccgacccaga 341
           |||||| || |||||||
Sbjct: 851 gaagggtccaacccaga 835



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 787 gatgatggc 779



to top

>gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 210101

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 111   acatcaaacttggaagacaaa 131
             |||||||||||||||||||||
Sbjct: 24157 acatcaaacttggaagacaaa 24177



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 163 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 104

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 103 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 44

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 43  gatgatggc 35



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 231 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 172

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 171 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 112

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 111 gatgatggc 103



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 490 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 431

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 430 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 371

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 370 gatgatggc 362



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 871 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 812

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 811 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 752

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 751 gatgatggc 743



to top

>gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete cds; NarL-like (narL)
            and NarX-like (narX) genes, complete sequence; NarK
            (narK), NarM (narM), NarG (narG), NarH (narH), NarJ
            (narJ), and NarI (narI) genes, complete cds; and unknown
            gene
          Length = 15150

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 316  ggcgccgatgaaggggccgacccag 340
            |||||||||||||||||||| ||||
Sbjct: 5753 ggcgccgatgaaggggccgatccag 5729



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 318
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 905 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 846

                                                                       
Query: 319 gccgatgaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaa 378
            || ||||| || |||||||||| |||||| |||||   ||| || || ||| ||||| |
Sbjct: 845 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 786

                    
Query: 379 gatgatggc 387
           |||||||||
Sbjct: 785 gatgatggc 777



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 323
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                                    
Query: 324 tgaaggggccgacccagacgatcca 348
           |||| || || ||||||| ||||||
Sbjct: 850 tgaacggtcccacccagaagatcca 826



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 292   ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
             ||||||||||  |||||| |  ||||||||||| | |||||| ||||||| ||||||
Sbjct: 85054 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 84998



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292    ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagacgatcca 348
              ||||||||||  |||||| |  ||||||||||||| ||| || ||||||| ||||||
Sbjct: 109135 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



to top

>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 111    acatcaaacttggaagacaaa 131
              |||||||||||||||||||||
Sbjct: 121183 acatcaaacttggaagacaaa 121203



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 260 ttggtcttgaatgggatcgctctgatgaccacctggtggta 300
           |||||||||||||| || ||||||||||  | |||||||||
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggta 850



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 299     tagatggcggccagcgcggcgccgatga 326
               ||||| ||||||||| ||||||||||||
Sbjct: 3446908 tagatcgcggccagcccggcgccgatga 3446881



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 975 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 916

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 915 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 856



to top

>ref|XM_550604.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ggcgccgatgaaggggccga 335
           ||||||||||||||||||||
Sbjct: 987 ggcgccgatgaaggggccga 968



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 683 gcggcgccgacgaaggggccgagccagtagacccagtggt 644



to top

>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence
          Length = 136866

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   ggcgccgatgaaggggccga 335
             ||||||||||||||||||||
Sbjct: 82946 ggcgccgatgaaggggccga 82927



to top

>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648



to top

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   cagaaagaaattcactcaga 200
             ||||||||||||||||||||
Sbjct: 53978 cagaaagaaattcactcaga 53997



to top

>emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel protein, partial
          Length = 821

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tccctgttgaagatgatggc 387
           ||||||||||||||||||||
Sbjct: 413 tccctgttgaagatgatggc 394



to top

>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     cagagcaagagcaagagtag 109
              ||||||||||||||||||||
Sbjct: 155822 cagagcaagagcaagagtag 155841



to top

>emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037B9 on chromosome 20p12.1-13
             Contains STSs, GSSs and a putative CpG island, complete
             sequence
          Length = 82183

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   cacatcaaacttggaagaca 129
             ||||||||||||||||||||
Sbjct: 72891 cacatcaaacttggaagaca 72872



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 886 cttgaatgggatggctctgatgac 863



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 881 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 822

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 821 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 762



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 862 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 803

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 802 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 743



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    gatggcggccagcgcggcgc 320
              ||||||||||||||||||||
Sbjct: 539763 gatggcggccagcgcggcgc 539782



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 174     cccccatcagaaagaaattcactc 197
               ||||||||||||| ||||||||||
Sbjct: 1961051 cccccatcagaaacaaattcactc 1961028



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 301     gatggcggccagcgcggcgccgat 324
               |||||| |||||||||||||||||
Sbjct: 1468545 gatggccgccagcgcggcgccgat 1468568



to top

>gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromosome 19, complete
              sequence
          Length = 165954

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    catctttctttgtagcagcagctt 254
              |||||||| |||||||||||||||
Sbjct: 108793 catctttcattgtagcagcagctt 108770



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 303     tggcggccagcgcggcgccg 322
               ||||||||||||||||||||
Sbjct: 4507898 tggcggccagcgcggcgccg 4507879



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 265   cttgaatgggatcgctctgatgac 288
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249



to top

>gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, complete sequence
          Length = 163936

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    ttggaagacaaattggaatt 139
              ||||||||||||||||||||
Sbjct: 159892 ttggaagacaaattggaatt 159873



to top

>gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, complete sequence
          Length = 164009

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 178   catcagaaagaaattcactcagaa 201
             ||||||||| ||||||||||||||
Sbjct: 52709 catcagaaaaaaattcactcagaa 52732



to top

>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   ttggaagacaaattggaatt 139
             ||||||||||||||||||||
Sbjct: 50150 ttggaagacaaattggaatt 50131



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 903 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 844

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 843 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 784



to top

>dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial cds, clone:
           RAFL22-84-C08
          Length = 318

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 111 cttgaatgggatggctctgatgac 88



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 868 cttgaatgggatggctctgatgac 845



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 885 cttgaatgggatggctctgatgac 862



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 316     ggcgccgatgaaggggccga 335
               ||||||||||||||||||||
Sbjct: 1762730 ggcgccgatgaaggggccga 1762711



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                        
Query: 314      gcggcgccgatgaaggggccgacccagacgatccagtggt 353
                |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 43108744 gcggcgccgacgaaggggccgagccagtagacccagtggt 43108783



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 71/88 (80%)
 Strand = Plus / Minus

                                                                        
Query: 265  cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
            |||||| ||||| || |||| ||| ||||||||||| |  || || ||||| || |||  
Sbjct: 1074 cttgaaggggatggccctgaggacgacctggtggtacaccgccgcaagcgccgctccggc 1015

                                        
Query: 325  gaaggggccgacccagacgatccagtgg 352
            ||| ||||| ||||||| ||||||||||
Sbjct: 1014 gaacgggcccacccagaagatccagtgg 987



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 893 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 834

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 833 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 774



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 889 cttgaatgggatggctctgatgac 866



to top

>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 522 cttgaatgggatggctctgatgac 499



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 894 cttgaatgggatggctctgatgac 871



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 881 cttgaatgggatggctctgatgac 858



to top

>gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, complete sequence
          Length = 200430

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    catctttctttgtagcagcagctt 254
              |||||||| |||||||||||||||
Sbjct: 139931 catctttcattgtagcagcagctt 139908



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                      
Query: 314    gcggcgccgatgaaggggccgacccagacgatccagtggt 353
              |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 105773 gcggcgccgacgaaggggccgagccagtagacccagtggt 105812



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0679C08
          Length = 156266

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   ggcgccgatgaaggggccga 335
             ||||||||||||||||||||
Sbjct: 87879 ggcgccgatgaaggggccga 87860



to top

>emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 including spda, kora, spdb2 and
            rep genes
          Length = 9367

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 303  tggcggccagcgcggcgccg 322
            ||||||||||||||||||||
Sbjct: 4015 tggcggccagcgcggcgccg 3996



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 707 gcggcgccgacgaaggggccgagccagtagacccagtggt 668



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 756 gcggcgccgacgaaggggccgagccagtagacccagtggt 717



to top

>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 265  cttgaatgggatcgctctgatgac 288
            |||||||||||| |||||||||||
Sbjct: 1547 cttgaatgggatggctctgatgac 1524



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 314 gcggcgccgatgaaggggccgacccagacgatccagtggt 353
           |||||||||| ||||||||||| ||||  || ||||||||
Sbjct: 693 gcggcgccgacgaaggggccgagccagtagacccagtggt 654



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 95/120 (79%)
 Strand = Plus / Minus

                                                                       
Query: 265 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 324
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 325 gaaggggccgacccagacgatccagtggtctgaccaggcgtgctccctgttgaagatgat 384
           ||| || ||||||||||  |||||||||||   ||| ||||| ||| ||||| |||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 323 atgaaggggccgacccagacgatccagtggtc 354
           |||||||| || ||||||| ||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtc 847



to top

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 265 cttgaatgggatcgctctgatgac 288
           |||||||||||| |||||||||||
Sbjct: 870 cttgaatgggatggctctgatgac 847


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,816,087
Number of Sequences: 3902068
Number of extensions: 3816087
Number of successful extensions: 74664
Number of sequences better than 10.0: 150
Number of HSP's better than 10.0 without gapping: 140
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 74073
Number of HSP's gapped (non-prelim): 593
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top