ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet124f08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predic... 129 6e-27
2emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4,... 129 6e-27
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 129 6e-27
4dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 6e-27
5dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 6e-27
6dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 6e-27
7gb|AY103838.1| Zea mays PCO113775 mRNA sequence 121 2e-24
8gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein... 98 2e-17
9gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence 50 0.005
10gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 geno... 50 0.005
11gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 geno... 50 0.005
12gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 geno... 50 0.005
13gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 geno... 50 0.005
14gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 geno... 50 0.005
15gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 geno... 50 0.005
16gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 gen... 50 0.005
17gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 gen... 50 0.005
18gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 geno... 50 0.005
19gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 geno... 50 0.005
20gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 geno... 50 0.005
21gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 geno... 50 0.005
22gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 geno... 50 0.005
23gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 geno... 50 0.005
24gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 geno... 50 0.005
25gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 geno... 50 0.005
26gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of... 46 0.075
27ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra)... 44 0.30
28gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31r... 44 0.30
29gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31r... 44 0.30
30gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDN... 44 0.30
31gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosom... 44 0.30
32gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, c... 44 0.30
33gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosom... 44 0.30
34dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, co... 44 0.30
35gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete se... 42 1.2
36gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 40 4.6
37gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 4.6
38gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence 40 4.6
39emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chro... 40 4.6
40emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 4.6
41emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ... 40 4.6
42emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA... 40 4.6
43gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 4.6
44gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, comp... 40 4.6
45gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 4.6
46gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, compl... 40 4.6
47gb|DQ149245.1| Lactococcus lactis plasmid pSK11P, complete sequence 40 4.6 
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           |||| |||||||||||||| | |||||||
Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttg 669
to top
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21,
             complete sequence
          Length = 138969

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Plus

                                                                         
Query: 261   atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
             |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720

                                          
Query: 321   tggcaagcatggcgaggcgcgagtgcttg 349
             |||| |||||||||||||| | |||||||
Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttg 19749
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Plus

                                                                            
Query: 261      atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
                |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945

                                             
Query: 321      tggcaagcatggcgaggcgcgagtgcttg 349
                |||| |||||||||||||| | |||||||
Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttg 22810974
to top
>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full
           insert sequence
          Length = 1377

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Plus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 41  ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           |||| |||||||||||||| | |||||||
Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttg 129
to top
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full
           insert sequence
          Length = 1138

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           |||| |||||||||||||| | |||||||
Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttg 731
to top
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full
           insert sequence
          Length = 1144

 Score =  129 bits (65), Expect = 6e-27
 Identities = 83/89 (93%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           |||| |||||||||||||| | |||||||
Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttg 732
to top
>gb|AY103838.1| Zea mays PCO113775 mRNA sequence
          Length = 958

 Score =  121 bits (61), Expect = 2e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||||||||||||||||||||||||||| ||||||||||||||||||  |||||
Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           ||||||||||||||| ||| | |||||||
Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttg 723
to top
>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA,
           complete cds
          Length = 1040

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 320
           |||| ||||||||||||||  ||||||||||||| || |||||||||||||||  |||||
Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715

                                        
Query: 321 tggcaagcatggcgaggcgcgagtgcttg 349
           ||||||||||||||| ||| | |||||||
Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttg 686
to top
>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence
          Length = 757

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttg 721
to top
>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence
          Length = 755

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttg 719
to top
>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence
          Length = 755

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttg 719
to top
>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence
          Length = 755

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttg 719
to top
>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttg 349
           |||||||||||| |||||||||||||| | |||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttg 725
to top
>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome
          Length = 10294

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 271  cgcgccgagcggcgtcttgccct 293
            |||||||||||||||||||||||
Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291
to top
>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2728

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2748

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531
            IMAGE:30475340), complete cds
          Length = 2020

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1016 taaaagaagtcacggacacaga 995
to top
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete
             sequence
          Length = 198595

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 127   taaaagaagtcacggacacaga 148
             ||||||||||||||||||||||
Sbjct: 22923 taaaagaagtcacggacacaga 22902
to top
>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds
          Length = 2151

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 127 taaaagaagtcacggacacaga 148
           ||||||||||||||||||||||
Sbjct: 874 taaaagaagtcacggacacaga 853
to top
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete
             sequence
          Length = 189362

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 127   taaaagaagtcacggacacaga 148
             ||||||||||||||||||||||
Sbjct: 22495 taaaagaagtcacggacacaga 22516
to top
>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence
          Length = 51685

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 181  atcccattcaatccatgcgtc 201
            |||||||||||||||||||||
Sbjct: 5637 atcccattcaatccatgcgtc 5617
to top
>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    tatatattacatggtacata 74
             ||||||||||||||||||||
Sbjct: 53057 tatatattacatggtacata 53076
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420
to top
>gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence
          Length = 21034

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   cgaagtagaagatgagcatg 322
             ||||||||||||||||||||
Sbjct: 13041 cgaagtagaagatgagcatg 13022
to top
>emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chromosome 13, complete
             sequence
          Length = 145871

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    aaatgtcttttgcccattct 31
             ||||||||||||||||||||
Sbjct: 67934 aaatgtcttttgcccattct 67953
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382
to top
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaatcatcttatagaccgag 270
             ||||||||||||||||||||
Sbjct: 55520 aaatcatcttatagaccgag 55539
to top
>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaatcatcttatagaccgag 270
             ||||||||||||||||||||
Sbjct: 42512 aaatcatcttatagaccgag 42531
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 264    gaccgagcgcgccgagcggc 283
              ||||||||||||||||||||
Sbjct: 404087 gaccgagcgcgccgagcggc 404068
to top
>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence
          Length = 143534

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     actatatattacatggtaca 72
              ||||||||||||||||||||
Sbjct: 110106 actatatattacatggtaca 110125
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189
to top
>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence
          Length = 160030

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    tatatattacatggtacata 74
             ||||||||||||||||||||
Sbjct: 14348 tatatattacatggtacata 14329
to top
>gb|DQ149245.1| Lactococcus lactis plasmid pSK11P, complete sequence
          Length = 75814

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aatgaatcaaatgtcttttg 23
             ||||||||||||||||||||
Sbjct: 43229 aatgaatcaaatgtcttttg 43210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,134,543
Number of Sequences: 3902068
Number of extensions: 4134543
Number of successful extensions: 66362
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65911
Number of HSP's gapped (non-prelim): 451
length of query: 349
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 327
effective length of database: 17,147,199,772
effective search space: 5607134325444
effective search space used: 5607134325444
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top