| Clone Name | rbaet124d10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL078621.19|HSA395L14 Human DNA sequence from clone RP11-395L14. Contains (part of) up to six novel genes or pseudogenes, the gene for a novel forkhead protein similar to FOXD4 (forkhead box D4, FREAC5), the gene for a novel phosphoglucomutase like protein, a pseudogene similar to part of DEAD/H (Asp-Glu-Ala-Asp/His) box (S.cerevisiae CHL1-like helicase), an RPL23A (60S ribosomal protein L23A) pseudogene, the RABL2A gene for RAB-like 2A, the gene for a novel protein similar to small nuclear ribonucleoprotein polypeptide A' (SNRPA1) and the 3' part of the gene for a novel protein similar to acrosin (ACR). Contains ESTs, STSs, GSSs and nine putative CpG islands, complete sequence Length = 176734 Score = 42.1 bits (21), Expect = 0.56 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 accatggtctatggctttgaatcct 159 |||||| |||||||||||||||||| Sbjct: 94997 accatgatctatggctttgaatcct 94973
>gb|AC134577.4| Mus musculus BAC clone RP24-79G11 from chromosome 14, complete sequence Length = 189085 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 100 atggatactgaaataggcaaatga 123 |||||| ||||||||||||||||| Sbjct: 121562 atggatgctgaaataggcaaatga 121539
>gb|BC067227.1| Homo sapiens CXYorf1-related protein, mRNA (cDNA clone IMAGE:4594516), partial cds Length = 1750 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 835 ccatgatctatggctttgaatcct 812
>gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosome 14, complete sequence Length = 204588 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 100 atggatactgaaataggcaaatga 123 |||||| ||||||||||||||||| Sbjct: 2692 atggatgctgaaataggcaaatga 2669
>emb|AL928970.15| Human DNA sequence from clone XXyac-2039 on chromosome 9 Contains a pseudogene similar to part of DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11(CHL1-like helicase homolog, S. cerevisiae) (CHL1, KRG2, CHLR1, MGC9335) (DDX11), a novel pseudogene, a novel gene and two CpG islands, complete sequence Length = 23993 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 14191 ccatgatctatggctttgaatcct 14214
>emb|AL627309.15| Human DNA sequence from clone RP11-34P13 on chromosome 1 Contains a pseudogene similar to part of DEAD/H box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) (DDX11), two novel pseudogenes, nine novel genes, two novel proteins similar to the olfactory receptor family, a capicua homolog (Drosophila) (CIC) pseudogene and two CpG islands, complete sequence Length = 166904 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 13565 ccatgatctatggctttgaatcct 13588
>gb|AC008993.3| Homo sapiens chromosome 19 clone LLNL-R_222A1, complete sequence Length = 38561 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 32876 ccatgatctatggctttgaatcct 32853
>ref|XM_931031.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 46 (FLJ00038), mRNA Length = 8215 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_931024.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 45 (FLJ00038), mRNA Length = 9126 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_931018.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 44 (FLJ00038), mRNA Length = 9365 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_931012.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 43 (FLJ00038), mRNA Length = 10198 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_931007.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 42 (FLJ00038), mRNA Length = 9264 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930998.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 41 (FLJ00038), mRNA Length = 8608 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930989.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 40 (FLJ00038), mRNA Length = 9646 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930979.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 39 (FLJ00038), mRNA Length = 10159 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930971.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 38 (FLJ00038), mRNA Length = 10299 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930965.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 37 (FLJ00038), mRNA Length = 9863 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930957.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 36 (FLJ00038), mRNA Length = 10398 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930947.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 35 (FLJ00038), mRNA Length = 9507 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930941.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 34 (FLJ00038), mRNA Length = 10776 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930933.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 33 (FLJ00038), mRNA Length = 9643 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930924.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 32 (FLJ00038), mRNA Length = 8595 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930913.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 31 (FLJ00038), mRNA Length = 10957 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930907.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 30 (FLJ00038), mRNA Length = 10023 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930901.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 29 (FLJ00038), mRNA Length = 11093 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930896.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 28 (FLJ00038), mRNA Length = 10405 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930885.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 27 (FLJ00038), mRNA Length = 9440 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930877.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 26 (FLJ00038), mRNA Length = 10036 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930868.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 25 (FLJ00038), mRNA Length = 8888 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930858.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 24 (FLJ00038), mRNA Length = 10467 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 511 ccatgatctatggctttgaatcct 488
>ref|XM_930847.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 23 (FLJ00038), mRNA Length = 10553 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 597 ccatgatctatggctttgaatcct 574
>ref|XM_930839.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 22 (FLJ00038), mRNA Length = 10338 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930826.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 21 (FLJ00038), mRNA Length = 8983 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930803.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 19 (FLJ00038), mRNA Length = 9123 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930792.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 18 (FLJ00038), mRNA Length = 7388 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930782.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 17 (FLJ00038), mRNA Length = 10147 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930773.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 16 (FLJ00038), mRNA Length = 10238 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930756.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 14 (FLJ00038), mRNA Length = 8494 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930746.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 13 (FLJ00038), mRNA Length = 8437 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930643.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 5 (FLJ00038), mRNA Length = 7909 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930619.1| PREDICTED: Homo sapiens CXYorf1-related protein, transcript variant 3 (FLJ00038), mRNA Length = 8259 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1001 ccatgatctatggctttgaatcct 978
>ref|XM_930625.1| PREDICTED: Homo sapiens similar to CXYorf1-related protein, transcript variant 3 (LOC653037), mRNA Length = 7800 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 2141 ccatgatctatggctttgaatcct 2118
>ref|XM_930614.1| PREDICTED: Homo sapiens similar to CXYorf1-related protein, transcript variant 2 (LOC653037), mRNA Length = 7502 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 1843 ccatgatctatggctttgaatcct 1820
>ref|XM_925777.1| PREDICTED: Homo sapiens similar to CXYorf1-related protein, transcript variant 1 (LOC653037), mRNA Length = 6256 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 597 ccatgatctatggctttgaatcct 574
>gb|AC140725.3| Homo sapiens chromosome 15, clone, complete sequence Length = 181240 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 14307 ccatgatctatggctttgaatcct 14330
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 attccaacaaaggtttattc 25 |||||||||||||||||||| Sbjct: 3037757 attccaacaaaggtttattc 3037738
>dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0011G08 Length = 139490 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 attccaacaaaggtttattc 25 |||||||||||||||||||| Sbjct: 119274 attccaacaaaggtttattc 119255
>dbj|AK024448.1| Homo sapiens mRNA for FLJ00038 protein, partial cds Length = 4404 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 831 ccatgatctatggctttgaatcct 808
>ref|NM_208405.1| Eremothecium gossypii ABR105Cp (ABR105C), mRNA Length = 933 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 ggctttgaatcctcctgggc 166 |||||||||||||||||||| Sbjct: 890 ggctttgaatcctcctgggc 871
>dbj|AP006221.1| Homo sapiens genomic DNA, chromosome Un, clone:CMC-190A2, telomere region, complete sequence Length = 36731 Score = 40.1 bits (20), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 ccatggtctatggctttgaatcct 159 ||||| |||||||||||||||||| Sbjct: 22809 ccatgatctatggctttgaatcct 22786
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 ggctttgaatcctcctgggc 166 |||||||||||||||||||| Sbjct: 575145 ggctttgaatcctcctgggc 575164
>dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0433F09 Length = 150150 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 attccaacaaaggtttattc 25 |||||||||||||||||||| Sbjct: 5797 attccaacaaaggtttattc 5778
>emb|AL590785.7| Human DNA sequence from clone RP11-321C1 on chromosome 6, complete sequence Length = 188159 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 138 atggtctatggctttgaat 156 ||||||||||||||||||| Sbjct: 160529 atggtctatggctttgaat 160511
>gb|AC163654.2| Mus musculus BAC clone RP23-259M14 from chromosome 16, complete sequence Length = 159273 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 110 aaataggcaaatgacttca 128 ||||||||||||||||||| Sbjct: 129947 aaataggcaaatgacttca 129929 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,981,477 Number of Sequences: 3902068 Number of extensions: 1981477 Number of successful extensions: 77371 Number of sequences better than 10.0: 54 Number of HSP's better than 10.0 without gapping: 54 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77284 Number of HSP's gapped (non-prelim): 87 length of query: 178 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 156 effective length of database: 17,147,199,772 effective search space: 2674963164432 effective search space used: 2674963164432 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)