ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet123g04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 101 bits (51), Expect = 6e-19 Identities = 54/55 (98%) Strand = Plus / Minus Query: 107 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 864 ttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacgggg 810
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 89.7 bits (45), Expect = 2e-15 Identities = 51/53 (96%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacgggg 1141
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 85.7 bits (43), Expect = 4e-14 Identities = 49/51 (96%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| ||||||||||||||||||||||| |||||||||||||||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacgggg 817
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 744
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 732
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacgggg 1756
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 1193
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 13930
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 30025081 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 23604275
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 21071
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 66974
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 803
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 802
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacgggg 808
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 1232
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 825
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 825
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 827
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacgggg 332
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 810
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacgggg 827
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 81.8 bits (41), Expect = 6e-13 Identities = 50/53 (94%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| ||||||| |||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacgggg 1756
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 79.8 bits (40), Expect = 2e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||||||||||| ||||||||||||||||||||||| || |||||||| |||||| Sbjct: 976 tttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacgggg 921
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 2535
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 2535
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 803
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 761
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 582
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 803
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 93253 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 96055
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 80949 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 78147
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 10793728
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 119
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 780
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 783
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 136
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 73.8 bits (37), Expect = 1e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 121 cgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||||||||||||||| |||||||||||||||||| Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacgggg 655
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 17451
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 130346
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacgggg 2667
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 1048
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||||||||||| ||||||||||| ||||||| |||||||||||||||||| Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacgggg 756
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 796
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 801
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 803
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 801
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 801
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 73.8 bits (37), Expect = 1e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgac 778
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| || |||||||||||| ||||||| |||||||||||||||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacgggg 786
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||||||||||| ||||||||| ||||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacgggg 1480
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 73.8 bits (37), Expect = 1e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacgggg 782
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 69.9 bits (35), Expect = 2e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| ||||||||||||||| ||||||| ||||||||||| |||||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacgggg 810
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 69.9 bits (35), Expect = 2e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||||||| ||||||||||||||| ||||||| |||||||||||||| Sbjct: 1676 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgac 1630
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 69.9 bits (35), Expect = 2e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| ||||||||||||||| ||||||| ||||||||||| |||||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacgggg 819
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 69.9 bits (35), Expect = 2e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 107 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||||| || |||||||||||||| ||||| || ||||||||||||||| Sbjct: 810 ttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacgggg 756
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 67.9 bits (34), Expect = 9e-09 Identities = 43/46 (93%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgtt 783
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 65.9 bits (33), Expect = 3e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||||||| ||||||| |||||||||||||| Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgac 800
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 65.9 bits (33), Expect = 3e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgac 325
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 65.9 bits (33), Expect = 3e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||||||||| ||||||||||||||| ||||||| || ||||||||||| Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgac 773
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 63.9 bits (32), Expect = 1e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||| ||||||||||||||| | ||||| |||||||||||||||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacgggg 342
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 61.9 bits (31), Expect = 5e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacgggg 765
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 60.0 bits (30), Expect = 2e-06 Identities = 58/66 (87%), Gaps = 1/66 (1%) Strand = Plus / Minus Query: 97 tttcaagtgttt-acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttg 155 ||||||||| || |||||||||| || ||||||||||| || ||||| || ||||||||| Sbjct: 483 tttcaagtgcttcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttg 424 Query: 156 acgggg 161 |||||| Sbjct: 423 acgggg 418
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 757
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 127
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 792
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 703
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 16158 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || |||||||| ||||||||||| |||||||||||||| Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgac 22492 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 19846
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || |||||||||||||||||||| ||||||||||| Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 974
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || |||||||| ||||||||||| |||||||||||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgac 807
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 821
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 712
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 79026
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 21808790
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||| ||||| || ||||| ||||| |||||||| |||||||||||||||||| Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacgggg 163 Score = 54.0 bits (27), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 104 tgtttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| |||| ||||| || ||||| |||||||||||||| ||||||||||| Sbjct: 8568 tgttcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgtt 8618
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 807
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 807
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || |||||||| ||||||||||| |||||||||||||| Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgac 754
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 754
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| |||||||||||||| |||||||| || ||||||||||| Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || |||||||| ||||||||||| |||||||||||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgac 807
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 806
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 754
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 800
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 806
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 819
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 21801819
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 471
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 58.0 bits (29), Expect = 8e-06 Identities = 41/45 (91%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgt 153 |||| ||||| ||||||||||||||| ||||||| |||||||||| Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgt 794
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 58.0 bits (29), Expect = 8e-06 Identities = 45/49 (91%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||| ||||||||||||||||| |||||||||||||| Sbjct: 830 actttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgac 783
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 821
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 1051
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || |||||||| ||||||||||| |||||||||||||| Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgac 960
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgac 899
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| |||||||||||||| ||||||| |||||||||||||| Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 789
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 58.0 bits (29), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 364
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacgggg 778
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||| ||||||||||||||| ||||||| || |||||||| |||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacgggg 845
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 56.0 bits (28), Expect = 3e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 ||||||| || || || |||||||||||| ||||||| |||||||||||||| Sbjct: 852 tttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgac 801
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||| |||||||| ||||||||||||||| | ||||| ||||||||| ||||||| Sbjct: 579 tttagttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacgggg 524
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 56.0 bits (28), Expect = 3e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||||||||||||||||||| | | |||||||||||||||||| Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgac 951
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 54.0 bits (27), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| |||||||||||||| ||||||| ||||||||| | |||||| Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacgggg 834
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 54.0 bits (27), Expect = 1e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttg 152 ||||| ||||||||||||||| ||||||| ||||||||| Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttg 2979
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 54.0 bits (27), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||| |||||||||||||| ||||||| ||||||||| | |||||| Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacgggg 1912
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 54.0 bits (27), Expect = 1e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 123 aagttggtggcgaaggcccacgcgttgttgttgac 157 |||||||||||| ||||||| |||||||||||||| Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgac 788
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 54.0 bits (27), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||| || |||||||||||||| ||||||| ||||||||||| |||||| Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacgggg 235
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 54.0 bits (27), Expect = 1e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttg 152 ||||| ||||||||||||||| ||||||| ||||||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttg 801
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 52.0 bits (26), Expect = 5e-04 Identities = 38/42 (90%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttg 152 |||||||| ||||||||||||||| | ||||| ||||||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 50.1 bits (25), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 120 acgaagttggtggcgaaggcccacgcgttgttgttgacggg 160 |||||||||||||| || ||||| || |||||||||||||| Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacggg 621
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| || ||||| |||||||||||||| Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgac 803
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 50.1 bits (25), Expect = 0.002 Identities = 44/49 (89%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgac 792
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 50.1 bits (25), Expect = 0.002 Identities = 46/53 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||| ||||| || ||||| ||||| ||||||||||| |||||||| |||||| Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacgggg 977
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 50.1 bits (25), Expect = 0.002 Identities = 46/53 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||| ||||| || ||||| ||||| ||||||||||| |||||||| |||||| Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacgggg 135
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| ||||||| |||||||||||||| Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgac 802
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 50.1 bits (25), Expect = 0.002 Identities = 46/53 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 |||||||||| ||||||||||||||| | | ||| ||||||||| ||||||| Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacgggg 770
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 48.1 bits (24), Expect = 0.008 Identities = 48/56 (85%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||||| ||||| || ||||| ||||| ||||||| ||||||||||| |||||| Sbjct: 1306 tttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacgggg 1251
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 48.1 bits (24), Expect = 0.008 Identities = 42/48 (87%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||| || ||||| |||||||| ||||| ||||||||||| |||||| Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacgggg 744
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 48.1 bits (24), Expect = 0.008 Identities = 48/56 (85%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 161 ||||||| ||||| || ||||| ||||| ||||||| ||||||||||| |||||| Sbjct: 2709 tttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacgggg 2654
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 44.1 bits (22), Expect = 0.13 Identities = 40/46 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| ||||||||||| || |||||||| || |||||||| Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgtt 829
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 44.1 bits (22), Expect = 0.13 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Plus Query: 109 acttgccgggcacgaagttggtggcgaaggccc-acgcgttgttgttgac 157 |||| ||||| || |||||||| |||||||||| | |||||||||||||| Sbjct: 53 actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgac 102
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 44.1 bits (22), Expect = 0.13 Identities = 40/46 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || ||||| ||||| |||||||| ||||||||||| Sbjct: 837 actttccgggaacaaagtttgtggcaaaggcccaagcgttgttgtt 792
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 44.1 bits (22), Expect = 0.13 Identities = 40/46 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || ||||| ||||| |||||||| ||||||||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgtt 304
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 44.1 bits (22), Expect = 0.13 Identities = 40/46 (86%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||| ||||| || ||||| ||||| |||||||| ||||||||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgtt 304
>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial sequence; nuclear gene for chloroplast product Length = 255 Score = 42.1 bits (21), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggc 133 |||| |||||||||||||||||||| Sbjct: 183 acttcccgggcacgaagttggtggc 159
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 42.1 bits (21), Expect = 0.50 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaa-ggcccacgcgttgttgttgacgggg 161 ||||| |||||||| ||||| || |||||| ||||||||||| |||||| Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacgggg 636
>gb|AC091947.4| Homo sapiens chromosome 5 clone RP11-367F9, complete sequence Length = 170063 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 ctcaattgtaaacatctttga 26 ||||||||||||||||||||| Sbjct: 100293 ctcaattgtaaacatctttga 100273
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 42.1 bits (21), Expect = 0.50 Identities = 42/49 (85%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| ||||||| || ||||||||||| Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgac 765
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 42.1 bits (21), Expect = 0.50 Identities = 30/33 (90%) Strand = Plus / Minus Query: 129 gtggcgaaggcccacgcgttgttgttgacgggg 161 ||||| ||||||||||| |||||||| |||||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacgggg 868
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 42.1 bits (21), Expect = 0.50 Identities = 42/49 (85%) Strand = Plus / Minus Query: 106 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 ||||||| ||||| || ||||||||||| ||||||| || |||||||| Sbjct: 825 tttactttccggggacaaagttggtggcataggcccatgcattgttgtt 777
>gb|AY653733.1| Acanthamoeba polyphaga mimivirus, complete genome Length = 1181404 Score = 42.1 bits (21), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Minus Query: 32 tacaacatcaacgatccgatattag 56 ||||||||||| ||||||||||||| Sbjct: 68412 tacaacatcaaggatccgatattag 68388
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 42.1 bits (21), Expect = 0.50 Identities = 42/49 (85%) Strand = Plus / Minus Query: 109 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 |||| ||||| || ||||||||||| ||||||| || ||||||||||| Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgac 942
>gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, complete sequence Length = 220334 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 58 catacatccagagtacacacatac 81 ||||||| |||||||||||||||| Sbjct: 92264 catacatacagagtacacacatac 92287
>gb|BC052945.1| Homo sapiens cDNA clone IMAGE:5268504 Length = 3651 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 3435 ccctcaattgtaaacatctt 3416
>gb|AC183109.2| Pan troglodytes BAC clone CH251-317D18 from chromosome 5, complete sequence Length = 169688 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 101948 ccctcaattgtaaacatctt 101929
>ref|XM_944925.1| PREDICTED: Homo sapiens hypothetical protein LOC649241, transcript variant 1 (LOC649242), mRNA Length = 3631 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 3429 ccctcaattgtaaacatctt 3410
>ref|XM_932161.1| PREDICTED: Homo sapiens hypothetical protein LOC643200, transcript variant 1 (LOC643201), mRNA Length = 3631 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 3429 ccctcaattgtaaacatctt 3410
>gb|AC139491.2| Homo sapiens chromosome 5 clone RP11-826N14, complete sequence Length = 186722 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 21773 ccctcaattgtaaacatctt 21754
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 40.1 bits (20), Expect = 2.0 Identities = 41/48 (85%) Strand = Plus / Minus Query: 107 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 154 |||||| ||||| ||||||||||| || || ||||| || |||||||| Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgttgtt 760
>gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H24, complete sequence Length = 104325 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ccctcaattgtaaacatctt 23 |||||||||||||||||||| Sbjct: 78023 ccctcaattgtaaacatctt 78004
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 40.1 bits (20), Expect = 2.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 120 acgaagttggtggcgaaggcccacgcgttgtt 151 |||||||||||||| |||||||| || ||||| Sbjct: 860 acgaagttggtggcaaaggcccaggcattgtt 829
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 111 ttgccgggcacgaagttggtggcg 134 |||||||||||||| ||||||||| Sbjct: 1742 ttgccgggcacgaacttggtggcg 1719
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 40.1 bits (20), Expect = 2.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 123 aagttggtggcgaaggcccacgcgttgttgtt 154 ||||| |||||||||||||| || |||||||| Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgtt 769
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 40.1 bits (20), Expect = 2.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 ||||| || ||||| ||||| |||||||| || ||||||||||| Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgac 748
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 40.1 bits (20), Expect = 2.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 114 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 157 ||||| || ||||| |||||||||||||| || ||||| ||||| Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgac 956
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 aattgtaaacatctttgat 27 ||||||||||||||||||| Sbjct: 138542 aattgtaaacatctttgat 138524
>emb|Z29560.1|CEK03H1 Caenorhabditis elegans Cosmid K03H1, complete sequence Length = 34583 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 34565 acatcaacgatccgatatt 34547
>emb|Z68011.1|CET21B6 Caenorhabditis elegans Cosmid T21B6, complete sequence Length = 30716 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 10 attgtaaacatctttgata 28 ||||||||||||||||||| Sbjct: 21003 attgtaaacatctttgata 21021
>emb|Z29561.2|CER10E12 Caenorhabditis elegans Cosmid R10E12, complete sequence Length = 30501 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 1048 acatcaacgatccgatatt 1030
>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17 Length = 147295 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 33 acaacatcaacgatccgat 51 ||||||||||||||||||| Sbjct: 77330 acaacatcaacgatccgat 77348
>emb|CR759941.1| Rat DNA sequence from clone RP32-551O16 on chromosome Y, complete sequence Length = 174940 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 atctttgatagtgtacaac 37 ||||||||||||||||||| Sbjct: 20990 atctttgatagtgtacaac 20972
>gb|AC073359.12| Homo sapiens 3 BAC RP11-439C8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 178336 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 aattgtaaacatctttgat 27 ||||||||||||||||||| Sbjct: 41589 aattgtaaacatctttgat 41571
>gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 genomic sequence, complete sequence Length = 143961 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 122 gaagttggtggcgaaggcccacg 144 |||| |||||||||||||||||| Sbjct: 18054 gaaggtggtggcgaaggcccacg 18032
>ref|NM_077427.3| Caenorhabditis elegans T21B6.2 (T21B6.2) mRNA, complete cds Length = 1273 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 10 attgtaaacatctttgata 28 ||||||||||||||||||| Sbjct: 582 attgtaaacatctttgata 564
>ref|NM_001027544.1| Caenorhabditis elegans ALIX (Apoptosis-linked gene 2 interacting protein X) homolog family member (alx-1) (alx-1) mRNA, complete cds Length = 1497 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 400 acatcaacgatccgatatt 382
>ref|NM_001027542.1| Caenorhabditis elegans ALIX (Apoptosis-linked gene 2 interacting protein X) homolog family member (alx-1) (alx-1) mRNA, complete cds Length = 2778 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 400 acatcaacgatccgatatt 382
>ref|NM_001027543.1| Caenorhabditis elegans ALIX (Apoptosis-linked gene 2 interacting protein X) homolog family member (alx-1) (alx-1) mRNA, complete cds Length = 2698 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 400 acatcaacgatccgatatt 382
>ref|NM_066812.4| Caenorhabditis elegans ALIX (Apoptosis-linked gene 2 interacting protein X) homolog family member (alx-1) (alx-1) mRNA, complete cds Length = 2758 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 401 acatcaacgatccgatatt 383
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 122 gaagttggtggcgaaggcccacg 144 |||| |||||||||||||||||| Sbjct: 22366031 gaaggtggtggcgaaggcccacg 22366009
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 38.2 bits (19), Expect = 7.8 Identities = 28/31 (90%) Strand = Plus / Minus Query: 122 gaagttggtggcgaaggcccacgcgttgttg 152 ||||||||||||| | ||||| ||||||||| Sbjct: 1379 gaagttggtggcgtaagcccaggcgttgttg 1349
>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome Length = 5277274 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 102 agtgtttacttgccgggca 120 ||||||||||||||||||| Sbjct: 2316063 agtgtttacttgccgggca 2316081
>ref|XM_321513.2| Anopheles gambiae str. PEST ENSANGP00000018135 (ENSANGG00000015646), partial mRNA Length = 5643 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 33 acaacatcaacgatccgat 51 ||||||||||||||||||| Sbjct: 3548 acaacatcaacgatccgat 3566
>gb|AY530951.1| Zea mays putative growth-regulating factor 1 (Z214A02.12), putative 40S ribosomal protein S8 (Z214A02.25), and putative casein kinase I (Z214A02.27) genes, complete cds Length = 158797 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 49 gatattagtcatacatcca 67 ||||||||||||||||||| Sbjct: 86847 gatattagtcatacatcca 86865
>gb|AF093624.1|AF093624 Mus musculus Nsp-like 1 protein (Nspl1) gene, complete cds; tRNA-Sec gene, complete sequence; and FosB protein (Fosb) gene, complete cds Length = 28825 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 73 cacacatactcatgagaac 91 ||||||||||||||||||| Sbjct: 15582 cacacatactcatgagaac 15600
>gb|U73679.1|CEU73679 Caenorhabditis elegans YNK1-a mRNA, complete cds Length = 2770 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 acatcaacgatccgatatt 54 ||||||||||||||||||| Sbjct: 412 acatcaacgatccgatatt 394
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 122 gaagttggtggcgaaggcccacg 144 |||| |||||||||||||||||| Sbjct: 22378099 gaaggtggtggcgaaggcccacg 22378077
>emb|AL845462.6| Mouse DNA sequence from clone RP23-236D15 on chromosome 2, complete sequence Length = 190994 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 gatattagtcatacatcca 67 ||||||||||||||||||| Sbjct: 94364 gatattagtcatacatcca 94346 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,302,665 Number of Sequences: 3902068 Number of extensions: 1302665 Number of successful extensions: 88593 Number of sequences better than 10.0: 190 Number of HSP's better than 10.0 without gapping: 190 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 88232 Number of HSP's gapped (non-prelim): 361 length of query: 161 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 139 effective length of database: 17,147,199,772 effective search space: 2383460768308 effective search space used: 2383460768308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
