| Clone Name | rbaet122h04 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 682 bits (344), Expect = 0.0 Identities = 344/344 (100%) Strand = Plus / Minus Query: 39 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1020 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 961 Query: 99 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 960 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 901 Query: 159 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 900 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 841 Query: 219 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 840 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 781 Query: 279 ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 780 ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 721 Query: 339 ccagtacacccactggtacccccactcccagctgacgagggcgg 382 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 720 ccagtacacccactggtacccccactcccagctgacgagggcgg 677
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 274 bits (138), Expect = 2e-70 Identities = 138/138 (100%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726 Query: 365 cccagctgacgagggcgg 382 |||||||||||||||||| Sbjct: 725 cccagctgacgagggcgg 708 Score = 63.9 bits (32), Expect = 4e-07 Identities = 66/76 (86%), Gaps = 6/76 (7%) Strand = Plus / Minus Query: 6 aactcaactgaacttgaaattactcgggcgga-----cgaattcacaggttttacacaag 60 ||||||||| ||||||||||||||||||||| ||||||||||| ||||||| ||| Sbjct: 1101 aactcaactcaacttgaaattactcgggcgggacgggcgaattcacag-ttttacagaag 1043 Query: 61 caaattgacagggtcg 76 ||||||||||| |||| Sbjct: 1042 caaattgacagtgtcg 1027 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 aagcaaacttaaacgactcatg 172 |||||||||||||||||||||| Sbjct: 977 aagcaaacttaaacgactcatg 956
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 254 bits (128), Expect = 2e-64 Identities = 137/140 (97%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635 Query: 363 ctcccagctgacgagggcgg 382 |||||||||||||||||||| Sbjct: 634 ctcccagctgacgagggcgg 615
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 254 bits (128), Expect = 2e-64 Identities = 137/140 (97%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730 Query: 363 ctcccagctgacgagggcgg 382 |||||||||||||||||||| Sbjct: 729 ctcccagctgacgagggcgg 710
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 246 bits (124), Expect = 4e-62 Identities = 136/140 (97%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 362 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731 Query: 363 ctcccagctgacgagggcgg 382 |||||||||||||||||||| Sbjct: 730 ctcccagctgacgagggcgg 711
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 246 bits (124), Expect = 4e-62 Identities = 136/140 (97%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 362 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727 Query: 363 ctcccagctgacgagggcgg 382 |||||||||||||||||||| Sbjct: 726 ctcccagctgacgagggcgg 707
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Plus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 2544836 actgggactcccaggaccagctgacgagggc 2544866 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 8319519 acggacggacgggcgggcggg 8319499
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 125258 actgggactcccaggaccagctgacgagggc 125228
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Plus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 2544946 actgggactcccaggaccagctgacgagggc 2544976 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 8317354 acggacggacgggcgggcggg 8317334
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 724 actgggactcccaggaccagctgacgagggc 694
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 733 actgggactcccaggaccagctgacgagggc 703
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 735 actgggactcccaggaccagctgacgagggc 705
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 259 actgggactcccaggaccagctgacgagggc 229
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 204 bits (103), Expect = 2e-49 Identities = 139/151 (92%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 349 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732 Query: 350 actggtacccccactcccagctgacgagggc 380 ||||| || |||| ||||||||||||||| Sbjct: 731 actgggactcccaggaccagctgacgagggc 701
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 186 bits (94), Expect = 4e-44 Identities = 127/138 (92%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||| Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 362 ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || |||| Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634 Query: 363 ctcccagctgacgagggc 380 ||||||||||||||| Sbjct: 633 ggaccagctgacgagggc 616
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 155 bits (78), Expect = 1e-34 Identities = 93/98 (94%) Strand = Plus / Minus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 289 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630 Query: 290 gcagctcgtagatgacgccggcgaggccgccgccgatg 327 | | |||||||||||||||||||||||| ||||||||| Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 97.6 bits (49), Expect = 3e-17 Identities = 55/57 (96%) Strand = Plus / Plus Query: 230 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 286 ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 324 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggc 380 |||||| ||||| |||||||||||||||||| || |||| ||||||||||||||| Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggc 275
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 89.7 bits (45), Expect = 6e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 302 |||||| ||||||||||||||||||||||||||| |||||||||||| | || ||||| Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767 Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 ||| || || ||||| || || || || |||||||||||||| ||||| |||| Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Minus Query: 241 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag 282 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggag 796
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 71.9 bits (36), Expect = 1e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 67.9 bits (34), Expect = 2e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 297 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 344 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 63.9 bits (32), Expect = 4e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 241 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 300 ||||| || |||||||| |||||||||||||||||| | |||||||| | ||||||| Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358 Query: 301 atgacgccggcgaggccgccgccgatgagggggccgacccagta 344 |||| || ||||| || || ||||| ||||| ||||||||||| Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608
>ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 61.9 bits (31), Expect = 1e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 366 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453 Query: 367 cagctgacgag 377 |||| |||||| Sbjct: 452 cagccgacgag 442
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 61.9 bits (31), Expect = 1e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 366 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836 Query: 367 cagctgacgag 377 |||| |||||| Sbjct: 25641837 cagccgacgag 25641847
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 296 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||| || ||| ||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 296 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0594D10 Length = 143200 Score = 61.9 bits (31), Expect = 1e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 366 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809 Query: 367 cagctgacgag 377 |||| |||||| Sbjct: 95810 cagccgacgag 95820
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 296 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 60.0 bits (30), Expect = 5e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 298 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||| |||||||| || || |||||||| |||||||||||||| ||||| |||| Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggt 695
>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA Length = 969 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 807
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 26156
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 241 gcttagtagtcggtggtggggagctgctcgtgggtgc 277 ||||||||||| | ||||||||||||||||||||||| Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18186972
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 816
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 799
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 187
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 |||||||||||| |||||| || |||||||| |||||||||||| |||| Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18196225
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 56.0 bits (28), Expect = 9e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 |||||||||||||| || ||||| || ||||||||||||||||| Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869
>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence Length = 1237 Score = 54.0 bits (27), Expect = 3e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 293 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 352 ||||||||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821 Query: 353 ggt 355 ||| Sbjct: 820 ggt 818
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 54.0 bits (27), Expect = 3e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 ||||||||||||| |||||||| ||||||||| | ||||||| | ||||||||||| Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||||| || ||||||| ||| || ||| ||||||| ||||| |||| Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggt 657
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 54.0 bits (27), Expect = 3e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 ||||||||||||| |||||||||||||| ||| | |||||||| | |||||||||| Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 || |||| || ||||||| ||| || ||| ||||||||||||| |||| Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Minus Query: 319 ccgccgatgagggggccgacccagtacaccca 350 ||||||||||| ||||| |||||||||||||| Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtg 276 ||||||||| |||||||||||| ||||||||| Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 350 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgccgatgagg 330 ||||||| ||||||||||||||| |||| Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775
>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA Length = 336 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259
>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein Length = 936 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593
>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26) Length = 543 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200
>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 gene, complete cds Length = 1442 Score = 46.1 bits (23), Expect = 0.083 Identities = 89/111 (80%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137
>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene) Length = 1120 Score = 46.1 bits (23), Expect = 0.083 Identities = 41/47 (87%) Strand = Plus / Minus Query: 244 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 290 |||||||| || || ||||||||||||||||||| | ||||||||| Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791
>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, partial cds Length = 599 Score = 46.1 bits (23), Expect = 0.083 Identities = 89/111 (80%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.083 Identities = 23/23 (100%) Strand = Plus / Minus Query: 306 gccggcgaggccgccgccgatga 328 ||||||||||||||||||||||| Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccgatga 328 ||||||||||||| |||||||||| Sbjct: 505314 cgccggcgaggccaccgccgatga 505291
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence Length = 134793 Score = 46.1 bits (23), Expect = 0.083 Identities = 23/23 (100%) Strand = Plus / Plus Query: 213 cgggcgggcggggggcaggcggc 235 ||||||||||||||||||||||| Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens fiber (Mip), mRNA Length = 2075 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds Length = 9803 Score = 46.1 bits (23), Expect = 0.083 Identities = 23/23 (100%) Strand = Plus / Minus Query: 213 cgggcgggcggggggcaggcggc 235 ||||||||||||||||||||||| Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L Length = 1057 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 243 ttagtagtcggtggtggggagctgctcgtgggtgc 277 ||||||||| ||||| ||||||||||| ||||||| Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770
>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence Length = 479 Score = 46.1 bits (23), Expect = 0.083 Identities = 53/63 (84%) Strand = Plus / Plus Query: 293 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 352 ||||| ||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338 Query: 353 ggt 355 ||| Sbjct: 339 ggt 341
>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM) mRNA, partial cds Length = 789 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 313 aggccgccgccgatgagggggccgacccagtacacccactggt 355 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA Length = 6870 Score = 46.1 bits (23), Expect = 0.083 Identities = 23/23 (100%) Strand = Plus / Minus Query: 213 cgggcgggcggggggcaggcggc 235 ||||||||||||||||||||||| Sbjct: 688 cgggcgggcggggggcaggcggc 666
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 307 ccggcgaggccgccgccgatga 328 |||||||||||||||||||||| Sbjct: 213784 ccggcgaggccgccgccgatga 213805
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 11 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 1 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 10 (LOC479191), mRNA Length = 4663 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 9 (LOC479191), mRNA Length = 4438 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 7 (LOC479191), mRNA Length = 4777 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 6 (LOC479191), mRNA Length = 4696 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 3 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.33 Identities = 31/34 (91%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 actggtacccccactcccagc 370 ||||||||||||||||||||| Sbjct: 290624 actggtacccccactcccagc 290604
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence Length = 136354 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 94084 acggacggacgggcgggcggg 94104
>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105), mRNA Length = 2606 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 315 gccgccgccgatgagggggcc 335 ||||||||||||||||||||| Sbjct: 22 gccgccgccgatgagggggcc 42
>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor (omaA) gene, complete cds Length = 1435 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgatg 327 ||||||||||||||||||||| Sbjct: 698 ccggcgaggccgccgccgatg 678
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete sequence Length = 160805 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 155955 acggacggacgggcgggcggg 155935
>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK00920) partial mRNA Length = 2340 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 actggtacccccactcccagc 370 ||||||||||||||||||||| Sbjct: 2133 actggtacccccactcccagc 2113
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence Length = 166421 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 7846 acggacggacgggcgggcggg 7826
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence Length = 240151 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 37973 acggacggacgggcgggcggg 37953
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence Length = 148259 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 37509 acggacggacgggcgggcggg 37489 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 201 cacacggacggacgggcgggcggg 224 ||||||||||||||| |||||||| Sbjct: 37516 cacacggacggacggacgggcggg 37493
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA clone MGC:19255 IMAGE:3967218), complete cds Length = 2176 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 23 acggacggacgggcgggcggg 43
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome Length = 9778 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 213 cgggcgggcggggggcaggcggcgg 237 ||||||||| ||||||||||||||| Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta), mRNA Length = 2547 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C (LOC654951), mRNA Length = 3244 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccga 325 ||||||||||||||||||||| Sbjct: 1642 cgccggcgaggccgccgccga 1622
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 309 ggcgaggccgccgccgatgag 329 ||||||||||||||||||||| Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1 Length = 68478 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 42894 acggacggacgggcgggcggg 42914 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 201 cacacggacggacgggcgggcggg 224 ||||||||||||||| |||||||| Sbjct: 42887 cacacggacggacggacgggcggg 42910
>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene) Length = 716 Score = 42.1 bits (21), Expect = 1.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 244 tagtagtcggtggtggggagctgctcgtgggtg 276 |||||||| ||||| ||||| |||||||||||| Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 27616 acggacggacgggcgggcggg 27596
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920074L06 product:Rab geranylgeranyl transferase, a subunit, full insert sequence Length = 2422 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 41 acggacggacgggcgggcggg 61
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 331 gggccgacccagtacacccactggt 355 |||||||||||||||||||| |||| Sbjct: 682 gggccgacccagtacacccagtggt 658
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11, complete sequence Length = 126040 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 56775 acggacggacgggcgggcggg 56755
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1), mRNA Length = 1544 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 205 cggacggacgggcgggcggggggca 229 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete genome Length = 11864 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccga 325 ||||||||||||||||||||| Sbjct: 2650 cgccggcgaggccgccgccga 2630
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2466 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2435 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2492 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2338 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2395 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccga 325 ||||||||||||||||||||| Sbjct: 2570348 cgccggcgaggccgccgccga 2570368 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccgatga 328 ||||||| |||||||||||||||| Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccga 325 ||||||||||||||||||||| Sbjct: 1841115 cgccggcgaggccgccgccga 1841095
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 331 gggccgacccagtacacccactggt 355 |||||||||||||||||||| |||| Sbjct: 329 gggccgacccagtacacccagtggt 353
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20, complete sequence Length = 80017 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 44968 acggacggacgggcgggcggg 44988
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23, complete sequence Length = 142417 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 45131 acggacggacgggcgggcggg 45151
>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase (gnuK), and gluconate permease (gnuT) genes, complete cds Length = 3554 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccga 325 ||||||||||||||||||||| Sbjct: 427 cgccggcgaggccgccgccga 407
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence Length = 207280 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 13760 acggacggacgggcgggcggg 13780
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcgggcggggggcaggcggcggtg 239 ||||||||||||||| ||||||||| Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480
>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete sequence Length = 251037 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 108741 acggacggacgggcgggcggg 108721
>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13, complete sequence Length = 121689 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 73151 acggacggacgggcgggcggg 73131
>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA, complete cds Length = 1544 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 205 cggacggacgggcgggcggggggca 229 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds Length = 4536 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcggg 224 ||||||||||||||||||||| Sbjct: 745 acggacggacgggcgggcggg 765
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791
>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete sequence Length = 181893 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 94623 acggacggacgggcgggcgg 94642
>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence Length = 197907 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 cgggcgggcggggggcaggc 232 |||||||||||||||||||| Sbjct: 122681 cgggcgggcggggggcaggc 122700
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 318 gccgccgatgagggggccga 337 |||||||||||||||||||| Sbjct: 1305526 gccgccgatgagggggccga 1305507
>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit variant 1-like mRNA, complete sequence Length = 1190 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 cgggcgggcggggggcaggcggcg 236 ||||||||||| |||||||||||| Sbjct: 38 cgggcgggcggcgggcaggcggcg 15
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 412353 gccggcgaggccgccgccga 412372
>ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 618 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 303 gacgccggcgaggccgccgccgatgagg 330 ||||||| ||||||||||||||| |||| Sbjct: 133 gacgccgacgaggccgccgccgaggagg 160
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence Length = 124050 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 72221 acggacggacgggcgggcgg 72202
>ref|NM_001025266.1| Homo sapiens hypothetical gene supported by AK091454 (LOC285382), mRNA Length = 5901 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgc 322 |||||||||||||||||||| Sbjct: 217 gacgccggcgaggccgccgc 198
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 cggcgaggccgccgccgatg 327 |||||||||||||||||||| Sbjct: 622954 cggcgaggccgccgccgatg 622973
>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094P07, complete sequence Length = 162311 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 15954 cgccggcgaggccgccgccg 15935
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 1776040 gccggcgaggccgccgccga 1776021
>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA Length = 1761 Score = 40.1 bits (20), Expect = 5.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 321 gccgatgagggggccgacccagtacacccactggta 356 |||||| || || ||||||||||||||||| ||||| Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336
>ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain containing protein 1 (LOC428624), mRNA Length = 1530 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 1364 cgccggcgaggccgccgccg 1345
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 cggcgaggccgccgccgatg 327 |||||||||||||||||||| Sbjct: 49687 cggcgaggccgccgccgatg 49668
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 3021559 gccggcgaggccgccgccga 3021540
>gb|DQ356948.1| Crocodilepox virus, complete genome Length = 190054 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 101116 cgccggcgaggccgccgccg 101135
>gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, complete cds Length = 1224 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 76 gccggcgaggccgccgccga 95
>gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminase precursor, gene, complete cds Length = 1809 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 653 gccggcgaggccgccgccga 672
>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete sequence Length = 153947 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 attcattcattcaaagcaaa 157 |||||||||||||||||||| Sbjct: 143356 attcattcattcaaagcaaa 143337
>gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, complete sequence Length = 154859 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 133 gatggattcattcattcaaa 152 |||||||||||||||||||| Sbjct: 68036 gatggattcattcattcaaa 68017
>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR Length = 3811 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 cgggcgggcggggggcaggc 232 |||||||||||||||||||| Sbjct: 3619 cgggcgggcggggggcaggc 3600
>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33 Contains 3' end of the DAB1 gene for disabled homolog 1 (Drosophila), a novel gene and the 5' end of a novel gene, complete sequence Length = 60856 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 133 gatggattcattcattcaaa 152 |||||||||||||||||||| Sbjct: 53885 gatggattcattcattcaaa 53904
>gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0088N01, complete sequence Length = 123954 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 68770 cgccggcgaggccgccgccg 68751
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 1203 agtagtctgtggttgggagctgctcgtg 1176
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete cds Length = 787 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 754 agtagtctgtggttgggagctgctcgtg 727
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma, aquaporin (At2g36830) mRNA, complete cds Length = 1030 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 812 agtagtctgtggttgggagctgctcgtg 785
>gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, promoter and 5' untranslated region Length = 1201 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 883 acggacggacgggcgggcgg 864
>gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, promoter and 5' untranslated region Length = 1197 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 884 acggacggacgggcgggcgg 865
>gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, promoter and 5' untranslated region Length = 1195 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 882 acggacggacgggcgggcgg 863
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 2751481 gccggcgaggccgccgccga 2751462
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 40.1 bits (20), Expect = 5.1 Identities = 80/100 (80%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 304 ||||||| ||||| |||||||| || |||||| || |||||| | ||||| ||||| || Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771 Query: 305 cgccggcgaggccgccgccgatgagggggccgacccagta 344 |||||||| | | | |||| || |||||||||||||| Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagta 731
>emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 in linkage group 17, complete sequence Length = 141987 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 gggatggattcattcattca 150 |||||||||||||||||||| Sbjct: 10001 gggatggattcattcattca 10020
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 gccggcgaggccgccgccga 325 |||||||||||||||||||| Sbjct: 3009661 gccggcgaggccgccgccga 3009642
>gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, complete sequence Length = 177355 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 aatgggatggattcattcattcaa 151 |||||||| ||||||||||||||| Sbjct: 47407 aatgggattgattcattcattcaa 47384
>dbj|AK091454.1| Homo sapiens cDNA FLJ34135 fis, clone FCBBF3010695 Length = 2613 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgc 322 |||||||||||||||||||| Sbjct: 217 gacgccggcgaggccgccgc 198
>tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (HDC08154) gene, complete cds Length = 1399 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 1381 acggacggacgggcgggcgg 1362
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 76092 cgccggcgaggccgccgccg 76111
>gb|CP000136.1| Rhizobium etli CFN 42 plasmid p42c, complete sequence Length = 250948 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 cggcgaggccgccgccgatg 327 |||||||||||||||||||| Sbjct: 121334 cggcgaggccgccgccgatg 121315
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 3338605 cgccggcgaggccgccgccg 3338586
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence Length = 134151 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 7513 agtagtctgtggttgggagctgctcgtg 7486
>dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds, strain:OUH643 Length = 5119 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 797 acggacggacgggcgggcgg 778
>dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch synthase I Length = 5190 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch synthase I, complete cds Length = 5190 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, complete sequence Length = 171987 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 aatgggatggattcattcattcaa 151 |||||||| ||||||||||||||| Sbjct: 31404 aatgggattgattcattcattcaa 31381
>gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170900 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 32025 acggacggacgggcgggcgg 32006
>gb|DQ317109.1| Drosophila pseudoobscura Dscam gene, exons 3 through 24 Length = 53864 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 cggcgaggccgccgccgatg 327 |||||||||||||||||||| Sbjct: 28501 cggcgaggccgccgccgatg 28520
>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21, complete sequence Length = 153142 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 66723 acggacggacgggcgggcgg 66704
>emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 in linkage group 7, complete sequence Length = 182186 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 16609 acggacggacgggcgggcgg 16590
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 5281445 cgccggcgaggccgccgccg 5281464
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 20970315 cgccggcgaggccgccgccg 20970296
>emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039F02, complete sequence Length = 122499 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgccgatgagg 330 ||||||| ||||||||||||||| |||| Sbjct: 13449 gacgccgacgaggccgccgccgaggagg 13422
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 793 agtagtctgtggttgggagctgctcgtg 766
>emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB49ZC08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 929 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 797 agtagtctgtggttgggagctgctcgtg 770
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1009 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 783 agtagtctgtggttgggagctgctcgtg 756
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZD11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 798 agtagtctgtggttgggagctgctcgtg 771
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 799 agtagtctgtggttgggagctgctcgtg 772
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 975 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 799 agtagtctgtggttgggagctgctcgtg 772
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB5ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 797 agtagtctgtggttgggagctgctcgtg 770
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB18ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 798 agtagtctgtggttgggagctgctcgtg 771
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 797 agtagtctgtggttgggagctgctcgtg 770
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS84ZH08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 789 agtagtctgtggttgggagctgctcgtg 762
>gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplast, complete genome Length = 164921 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 aactgaacttgaaattactc 30 |||||||||||||||||||| Sbjct: 98129 aactgaacttgaaattactc 98148
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence Length = 1042 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 307 ccggcgaggccgccgccgat 326 |||||||||||||||||||| Sbjct: 1321538 ccggcgaggccgccgccgat 1321519
>gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, complete sequence Length = 180708 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 aatgggatggattcattcattcaa 151 |||||||| ||||||||||||||| Sbjct: 146597 aatgggattgattcattcattcaa 146620
>gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, complete sequence Length = 132353 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 aatgggatggattcattcattcaa 151 |||||||| ||||||||||||||| Sbjct: 74998 aatgggattgattcattcattcaa 74975
>gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, complete sequence Length = 194754 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 aatgggatggattcattcattcaa 151 |||||||| ||||||||||||||| Sbjct: 116188 aatgggattgattcattcattcaa 116211
>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1274F11 Length = 171257 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 62404 cgccggcgaggccgccgccg 62385
>dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds Length = 4535 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 400 acggacggacgggcgggcgg 381
>dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds, strain:OUH602 Length = 5190 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>dbj|AK112006.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-B09, full insert sequence Length = 1300 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 495 cgccggcgaggccgccgccg 514
>dbj|AK111927.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-C10, full insert sequence Length = 1463 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 519 cgccggcgaggccgccgccg 538
>emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus Length = 2311 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 133 acggacggacgggcgggcgg 114
>emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch synthase (EC 2.4.1.11) Length = 5153 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 938 acggacggacgggcgggcgg 919
>gb|AC007934.7|AC007934 Homo sapiens, clone RP11-29A1, complete sequence Length = 157625 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 303 gacgccggcgaggccgccgc 322 |||||||||||||||||||| Sbjct: 116714 gacgccggcgaggccgccgc 116695
>dbj|AK100873.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126C15, full insert sequence Length = 1535 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 110 cgccggcgaggccgccgccg 91
>dbj|AK069688.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034A08, full insert sequence Length = 1493 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 85 cgccggcgaggccgccgccg 66
>emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 in linkage group 20, complete sequence Length = 163231 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 60247 acggacggacgggcgggcgg 60266
>gb|AC006947.2|AC006947 Homo sapiens chromosome 17, clone hRPK.115_C_3, complete sequence Length = 175775 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 354 gtacccccactcccagctga 373 |||||||||||||||||||| Sbjct: 60837 gtacccccactcccagctga 60856
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete sequence Length = 304419 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 80644 acggacggacgggcgggcgg 80625
>gb|AC116680.21| Mus musculus chromosome 12, clone RP23-476M16, complete sequence Length = 215303 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 aactcaactgaacttgaaat 25 |||||||||||||||||||| Sbjct: 198046 aactcaactgaacttgaaat 198065
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 161987 acggacggacgggcgggcgg 162006
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete sequence Length = 170964 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 119772 acggacggacgggcgggcgg 119791
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 cgccggcgaggccgccgccg 324 |||||||||||||||||||| Sbjct: 5347922 cgccggcgaggccgccgccg 5347941
>gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length = 892 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 257 tggggagctgctcgtgggtgcggg 280 |||||||||||| ||||||||||| Sbjct: 375 tggggagctgctggtgggtgcggg 398
>gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length = 892 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 257 tggggagctgctcgtgggtgcggg 280 |||||||||||| ||||||||||| Sbjct: 375 tggggagctgctggtgggtgcggg 398
>gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length = 2663 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 257 tggggagctgctcgtgggtgcggg 280 |||||||||||| ||||||||||| Sbjct: 2143 tggggagctgctggtgggtgcggg 2166
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene, complete cds Length = 1398 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 245 agtagtcggtggtggggagctgctcgtg 272 ||||||| ||||| |||||||||||||| Sbjct: 1203 agtagtctgtggttgggagctgctcgtg 1176
>dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cultivar:Shonupana Length = 802 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 384 acggacggacgggcgggcgg 365
>dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cultivar:Senbon hadaka Length = 1011 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 acggacggacgggcgggcgg 223 |||||||||||||||||||| Sbjct: 399 acggacggacgggcgggcgg 380
>emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chromosome 2, complete sequence Length = 100090 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 attcattcattcaaagcaaa 157 |||||||||||||||||||| Sbjct: 53765 attcattcattcaaagcaaa 53784 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,323,680 Number of Sequences: 3902068 Number of extensions: 3323680 Number of successful extensions: 83377 Number of sequences better than 10.0: 231 Number of HSP's better than 10.0 without gapping: 233 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 81459 Number of HSP's gapped (non-prelim): 1914 length of query: 382 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 360 effective length of database: 17,147,199,772 effective search space: 6172991917920 effective search space used: 6172991917920 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)