ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet11e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC154626.2| Mus musculus BAC clone RP23-311B8 from chromosome... 40 0.71
2gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 38 2.8
3gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, com... 38 2.8
4gb|AC161350.3| Mus musculus chromosome 3, clone RP24-356H12, com... 38 2.8
5emb|AL135798.5| Human DNA sequence from clone RP4-655N15 on chro... 38 2.8
6emb|AL662792.21| Mouse DNA sequence from clone RP23-52L14 on chr... 38 2.8
7emb|AL669931.9| Mouse DNA sequence from clone RP23-31D18 on chro... 38 2.8
8emb|CR925752.5| Mouse DNA sequence from clone RP24-106O24 on chr... 38 2.8
9gb|AC160945.5| Mus musculus 10 BAC RP24-187J13 (Roswell Park Can... 38 2.8
10gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Canc... 38 2.8
11gb|AC119998.13| Mus musculus chromosome 17, clone RP24-128A6, co... 38 2.8

>gb|AC154626.2| Mus musculus BAC clone RP23-311B8 from chromosome 14, complete sequence
          Length = 194638

 Score = 40.1 bits (20), Expect = 0.71
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 5      gaaaaagtcatcatgggaca 24
              ||||||||||||||||||||
Sbjct: 110963 gaaaaagtcatcatgggaca 110982



to top

>gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-203F1, complete
             sequence
          Length = 148170

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    aaaaggaacacagggaaaa 43
             |||||||||||||||||||
Sbjct: 24384 aaaaggaacacagggaaaa 24402



to top

>gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, complete sequence
          Length = 219739

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 27     aaggaacacagggaaaaca 45
              |||||||||||||||||||
Sbjct: 113868 aaggaacacagggaaaaca 113850



to top

>gb|AC161350.3| Mus musculus chromosome 3, clone RP24-356H12, complete sequence
          Length = 156180

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     atcatgggacaaaaaggaa 32
              |||||||||||||||||||
Sbjct: 117174 atcatgggacaaaaaggaa 117156



to top

>emb|AL135798.5| Human DNA sequence from clone RP4-655N15 on chromosome 1p13.1-13.3
             Contains a neurofilament, heavy polypeptide 200kDa (NEFH)
             pseudogene, the CD2 gene for CD2 antigen (p50) sheep red
             blood cell receptor and a ferritin heavy polypeptide 1
             (FTH1) pseudogene, complete sequence
          Length = 103209

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    gggacaaaaaggaacacag 37
             |||||||||||||||||||
Sbjct: 71045 gggacaaaaaggaacacag 71063



to top

>emb|AL662792.21| Mouse DNA sequence from clone RP23-52L14 on chromosome 11, complete
             sequence
          Length = 164120

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    aaaaggaacacagggaaaa 43
             |||||||||||||||||||
Sbjct: 62307 aaaaggaacacagggaaaa 62289



to top

>emb|AL669931.9| Mouse DNA sequence from clone RP23-31D18 on chromosome 11 Contains the
              Stc2 gene for stanniocalcin 2 and three CpG islands,
              complete sequence
          Length = 252980

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     aaaaaggaacacagggaaa 42
              |||||||||||||||||||
Sbjct: 176740 aaaaaggaacacagggaaa 176722



to top

>emb|CR925752.5| Mouse DNA sequence from clone RP24-106O24 on chromosome 4, complete
             sequence
          Length = 103739

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    aaaaggaacacagggaaaa 43
             |||||||||||||||||||
Sbjct: 16747 aaaaggaacacagggaaaa 16765



to top

>gb|AC160945.5| Mus musculus 10 BAC RP24-187J13 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 168109

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    aaaaaggaacacagggaaa 42
             |||||||||||||||||||
Sbjct: 48041 aaaaaggaacacagggaaa 48023



to top

>gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 279677

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    aaaaaggaacacagggaaa 42
             |||||||||||||||||||
Sbjct: 29110 aaaaaggaacacagggaaa 29128



to top

>gb|AC119998.13| Mus musculus chromosome 17, clone RP24-128A6, complete sequence
          Length = 172124

 Score = 38.2 bits (19), Expect = 2.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 19    gggacaaaaaggaacacag 37
             |||||||||||||||||||
Sbjct: 58377 gggacaaaaaggaacacag 58359


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 914,660
Number of Sequences: 3902068
Number of extensions: 914660
Number of successful extensions: 64568
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64543
Number of HSP's gapped (non-prelim): 25
length of query: 71
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 50
effective length of database: 17,151,101,840
effective search space: 857555092000
effective search space used: 857555092000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top