ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet117h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 767 0.0
2gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 159 9e-36
3gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 151 2e-33
4gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 143 5e-31
5gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 143 5e-31
6gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 143 5e-31
7emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 143 5e-31
8gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 143 5e-31
9gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 143 5e-31
10gb|AY103580.1| Zea mays PCO072544 mRNA sequence 143 5e-31
11gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 133 5e-28
12gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 129 8e-27
13gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 129 8e-27
14emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 121 2e-24
15dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
16dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
17dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
18gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 121 2e-24
19dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 121 2e-24
20ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 119 8e-24
21dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
22dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
23dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
24dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
25dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 115 1e-22
26emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 113 5e-22
27dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 103 4e-19
28dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
29dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
30dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
31emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 98 3e-17
32dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-17
33gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 96 1e-16
34gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 96 1e-16
35emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 86 1e-13
36emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 82 2e-12
37gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 82 2e-12
38gb|AY107675.1| Zea mays PCO112712 mRNA sequence 82 2e-12
39ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 78 3e-11
40dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
41dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 78 3e-11
42emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 70 6e-09
43gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 70 6e-09
44dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
45dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 66 1e-07
46ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 62 2e-06
47emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 62 2e-06
48gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 60 6e-06
49ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 58 2e-05
50gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 58 2e-05
51gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 58 2e-05
52gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 58 2e-05
53gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 58 2e-05
54dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 58 2e-05
55gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 58 2e-05
56emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
57emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
58emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
59gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 58 2e-05
60gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 58 2e-05
61gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 58 2e-05
62ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 56 9e-05
63ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 56 9e-05
64ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 56 9e-05
65ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 56 9e-05
66emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 56 9e-05
67emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 56 9e-05
68gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 56 9e-05
69gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 56 9e-05
70emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
71dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 56 9e-05
72dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
73dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
74dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
75dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
76dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
77gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 56 9e-05
78gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 56 9e-05
79ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
80dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 54 4e-04
81dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 54 4e-04
82dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
83ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.001
84gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 52 0.001
85gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 52 0.001
86gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 52 0.001
87dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
88dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
89gb|AY107589.1| Zea mays PCO085320 mRNA sequence 52 0.001
90gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 50 0.006
91emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 50 0.006
92gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 50 0.006
93dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
94dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 50 0.006
95emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 50 0.006
96ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 48 0.023
97gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 48 0.023
98dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.023
99gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 48 0.023
100gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 48 0.023
101dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.023
102gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.023
103dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.023
104dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.023
105dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 48 0.023
106gb|AY109332.1| Zea mays CL502_5 mRNA sequence 48 0.023
107gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 48 0.023
108dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 48 0.023
109ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 46 0.090
110gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 46 0.090
111gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 46 0.090
112ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 46 0.090
113ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 46 0.090
114gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.090
115emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 46 0.090
116ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 46 0.090
117gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 46 0.090
118gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 46 0.090
119gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 46 0.090
120gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 46 0.090
121dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 46 0.090
122gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 46 0.090
123gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 46 0.090
124emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 46 0.090
125dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 46 0.090
126dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 46 0.090
127gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (A... 44 0.36
128gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 44 0.36
129gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.36
130gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.36
131emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 44 0.36
132emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 44 0.36
133emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1 44 0.36
134emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 44 0.36
135gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 44 0.36
136ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA 44 0.36
137gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA 44 0.36
138gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 44 0.36
139emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.36
140gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 44 0.36
141gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 44 0.36
142dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 44 0.36
143gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 42 1.4
144gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 42 1.4
145emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.4
146emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.4
147emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.4
148emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 42 1.4
149gb|AC022118.5| Homo sapiens chromosome 5 clone CTC-548H10, compl... 42 1.4
150gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 42 1.4
151gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.4
152gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 42 1.4
153gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 42 1.4
154gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete c... 42 1.4
155dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
156dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 42 1.4
157dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
158dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
159ref|NM_211463.1| Eremothecium gossypii AGL266Cp (AGL266C), mRNA 42 1.4
160dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
161gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 42 1.4
162dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 42 1.4
163gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.6
164ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 5.6
165gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 40 5.6
166ref|XM_550604.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.6
167ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed... 40 5.6
168ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 40 5.6
169ref|NM_001005210.1| Homo sapiens leucine rich repeat containing ... 40 5.6
170gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 40 5.6
171gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 40 5.6
172gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 5.6
173gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 40 5.6
174gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 40 5.6
175emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 5.6
176gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 5.6
177emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA 40 5.6
178emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chr... 40 5.6
179emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037... 40 5.6
180emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 5.6
181emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 40 5.6
182emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 40 5.6
183emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 40 5.6
184gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 5.6
185emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 40 5.6
186emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 40 5.6
187emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 5.6
188gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 5.6
189gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 5.6
190gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 5.6
191gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 5.6
192gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 5.6
193dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443 40 5.6
194gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.6
195gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 5.6
196gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 5.6
197gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 5.6
198gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, compl... 40 5.6
199gb|AC091980.4| Homo sapiens chromosome 5 clone RP11-546B8, compl... 40 5.6
200gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 5.6
201gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 40 5.6
202gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 40 5.6
203dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 5.6
204gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 5.6
205gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 40 5.6
206gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 40 5.6
207dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
208gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 40 5.6
209emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 5.6
210emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 5.6
211emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 5.6
212emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 5.6
213gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 5.6
214gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 40 5.6
215gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 5.6
216gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 40 5.6
217dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
218dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
219dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
220emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 5.6
221emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 5.6
222dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
223dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
224dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
225dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
226dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
227dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
228dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
229dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
230dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
231dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 5.6
232gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte... 40 5.6
233gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 40 5.6
234gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 40 5.6
235gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 5.6
236gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 40 5.6
237gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 40 5.6
238dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 5.6

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  767 bits (387), Expect = 0.0
 Identities = 396/399 (99%)
 Strand = Plus / Minus

                                                                        
Query: 18   aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 77
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1199 aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 1140

                                                                        
Query: 78   agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagc 137
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1139 agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagt 1080

                                                                        
Query: 138  acatcaaacttggaagacaaattggaattccacggtaacacagacgatgggaagagaggg 197
            ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 1079 acatcaaacttggaagacaaattggaattccacggtaacagggacgatgggaagagaggg 1020

                                                                        
Query: 198  ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 257
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1019 ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 960

                                                                        
Query: 258  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 317
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 959  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 900

                                                                        
Query: 318  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 377
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 899  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 840

                                                   
Query: 378  ggtctgaccaggcgtgctccctgttgtagatgatggccg 416
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 839  ggtctgaccaggcgtgctccctgttgtagatgatggccg 801



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  159 bits (80), Expect = 9e-36
 Identities = 125/140 (89%)
 Strand = Plus / Minus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||||||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                                                       
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 394
           ||||| || ||||| |||||||||||||||||||||||||| |||||   ||||||||| 
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccagaagatccaatggtcgttccaggcgtga 816

                               
Query: 395 tccctgttgtagatgatggc 414
           ||||||||||||||||||||
Sbjct: 815 tccctgttgtagatgatggc 796



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  151 bits (76), Expect = 2e-33
 Identities = 112/124 (90%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| ||||| || ||||||| ||||||||||||||||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           ||||||||||||||||||||||||| |||||   ||||||||||||||||||||||||||
Sbjct: 352 tgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagatga 293

               
Query: 411 tggc 414
           ||||
Sbjct: 292 tggc 289



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                                                       
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 394
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 715

                               
Query: 395 tccctgttgtagatgatggc 414
           |||| |||||||||||||||
Sbjct: 714 tcccggttgtagatgatggc 695



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  143 bits (72), Expect = 5e-31
 Identities = 93/100 (93%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                                                   
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggc 390
           ||||||||||||||||||||||||||||||| | ||||||
Sbjct: 365 tgaaggggccgacccagaagatccagtggtcagcccaggc 326



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  143 bits (72), Expect = 5e-31
 Identities = 93/100 (93%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                                                   
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggc 390
           ||||||||||||||||||||||||||||||| | ||||||
Sbjct: 796 tgaaggggccgacccagaagatccagtggtcagcccaggc 757



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  143 bits (72), Expect = 5e-31
 Identities = 93/100 (93%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                                                   
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggc 390
           ||||||||||||||||||||||||||||||| | ||||||
Sbjct: 853 tgaaggggccgacccagaagatccagtggtcagcccaggc 814



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                                                       
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 394
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 865

                               
Query: 395 tccctgttgtagatgatggc 414
           |||| |||||||||||||||
Sbjct: 864 tcccggttgtagatgatggc 845



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                                                       
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 394
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 860

                               
Query: 395 tccctgttgtagatgatggc 414
           |||| |||||||||||||||
Sbjct: 859 tcccggttgtagatgatggc 840



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                                                        
Query: 335  gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 394
            ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 1189

                                
Query: 395  tccctgttgtagatgatggc 414
            |||| |||||||||||||||
Sbjct: 1188 tcccggttgtagatgatggc 1169



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score =  133 bits (67), Expect = 5e-28
 Identities = 121/139 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 335
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                                                       
Query: 336 ccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgct 395
           |||| || || || |||||||||||||||||||||||||| |||||   |||||| || |
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccagaagatccaatggtcgctccaggcatgat 240

                              
Query: 396 ccctgttgtagatgatggc 414
           |||||||||||||||||||
Sbjct: 239 ccctgttgtagatgatggc 221



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  129 bits (65), Expect = 8e-27
 Identities = 92/101 (91%)
 Strand = Plus / Plus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                                    
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatcca 375
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccagaagatcca 344



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  129 bits (65), Expect = 8e-27
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                       
Query: 275 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 334
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                                    
Query: 335 gccagcgcggcgccgatgaaggggccgacccagaagatcca 375
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccagaagatcca 433



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 836 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 777

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 776 ttgttgtagatgatggc 760



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 809 ttgttgtagatgatggc 793



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 924 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 865

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 864 ttgttgtagatgatggc 848



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 809 ttgttgtagatgatggc 793



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 864 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 805

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 804 ttgttgtagatgatggc 788



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                                                       
Query: 338 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 397
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 867 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 808

                            
Query: 398 ctgttgtagatgatggc 414
            ||||||||||||||||
Sbjct: 807 ttgttgtagatgatggc 791



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  119 bits (60), Expect = 8e-24
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 778 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 719

               
Query: 411 tggc 414
           ||||
Sbjct: 718 tggc 715



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  119 bits (60), Expect = 8e-24
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 855 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 796

               
Query: 411 tggc 414
           ||||
Sbjct: 795 tggc 792



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  119 bits (60), Expect = 8e-24
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 856 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 797

               
Query: 411 tggc 414
           ||||
Sbjct: 796 tggc 793



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  119 bits (60), Expect = 8e-24
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 858 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 799

               
Query: 411 tggc 414
           ||||
Sbjct: 798 tggc 795



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  119 bits (60), Expect = 8e-24
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                        
Query: 291  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
            |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                                                                        
Query: 351  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
            |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 1154 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 1095

                
Query: 411  tggc 414
            ||||
Sbjct: 1094 tggc 1091



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                       
Query: 305 gctctgatgaccacctggtggtagatggcggccagcgcggcgccgatgaaggggccgacc 364
           |||||||||| |||||||||||||| ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

                                                             
Query: 365 cagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 414
           ||||||||||| |||||   |||||| || ||||||||||||||||||||
Sbjct: 867 cagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  113 bits (57), Expect = 5e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                     
Query: 319  ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 41/41 (100%)
 Strand = Plus / Minus

                                                    
Query: 376 gtggtctgaccaggcgtgctccctgttgtagatgatggccg 416
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 680 gtggtctgaccaggcgtgctccctgttgtagatgatggccg 640



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  103 bits (52), Expect = 4e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 885 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 826

               
Query: 411 tggc 414
           ||||
Sbjct: 825 tggc 822



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                            
Query: 278      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                                      
Query: 338      agcgcggcgccgatgaaggggccgacccagaagatcca 375
                || || ||||| | |||||| || ||||||||||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccagaagatcca 27065556



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                            
Query: 291      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
                ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 35369403 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 35369344

                                         
Query: 351      tgaaggggccgacccagaagatcca 375
                |||| || || |||||||| |||||
Sbjct: 35369343 tgaacggaccaacccagaaaatcca 35369319



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 319      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
                ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 25184661 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 25184605



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                         
Query: 278   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                                   
Query: 338   agcgcggcgccgatgaaggggccgacccagaagatcca 375
             || || ||||| | |||||| || ||||||||||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccagaagatcca 37205



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                          
Query: 278    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 337
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                                    
Query: 338    agcgcggcgccgatgaaggggccgacccagaagatcca 375
              || || ||||| | |||||| || ||||||||||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccagaagatcca 118758



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                         
Query: 291   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
             |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                                      
Query: 351   tgaaggggccgacccagaagatcca 375
             |||||||||| ||||||||||||||
Sbjct: 28609 tgaaggggccaacccagaagatcca 28585



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                            
Query: 291      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
                |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                         
Query: 351      tgaaggggccgacccagaagatcca 375
                |||||||||| ||||||||||||||
Sbjct: 28021383 tgaaggggccaacccagaagatcca 28021359



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 319      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
                ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 26074808 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 111/132 (84%)
 Strand = Plus / Minus

                                                                       
Query: 285 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 344
           |||||| |||||| || || ||||||||||||||||||||||| |  || || || ||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggtataaagctgctagtgcgg 828

                                                                       
Query: 345 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 404
           | || ||||| || || ||||||||||||||||||||   ||| ||||| ||| ||||||
Sbjct: 827 ccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgt 768

                       
Query: 405 agatgatggccg 416
           ||||||||||||
Sbjct: 767 agatgatggccg 756



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| ||||| || ||||| ||||||  |||||||||||| |||||||| || ||||
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                                                                       
Query: 351 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 410
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 870 tgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 811

               
Query: 411 tggc 414
           ||||
Sbjct: 810 tggc 807



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 285 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 344
           ||||| ||||||||||||| |||||||| ||||||   ||||| |  || ||||  || |
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctg 788

                                                                       
Query: 345 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 404
           |||| ||||| || || ||||||||||||||||||||   ||||||||| ||||||||||
Sbjct: 787 cgccaatgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgt 728

                  
Query: 405 agatgat 411
           |||||||
Sbjct: 727 agatgat 721



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 847

                                            
Query: 382 tgaccaggcgtgctccctgttgtagatgatggc 414
              ||| |||||   ||||||||||| ||||||
Sbjct: 846 gttccatgcgtgggacctgttgtagacgatggc 814



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 838

                                            
Query: 382 tgaccaggcgtgctccctgttgtagatgatggc 414
              ||| |||||   ||||||||||| ||||||
Sbjct: 837 gttccatgcgtgggacctgttgtagacgatggc 805



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 271

                                            
Query: 382 tgaccaggcgtgctccctgttgtagatgatggc 414
              ||| |||||   ||||||||||| ||||||
Sbjct: 270 gttccatgcgtgggacctgttgtagacgatggc 238



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 291  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                                           
Query: 351  tgaaggggccgacccagaagatccagtggtc 381
            |||| || || |||||||| |||||||||||
Sbjct: 948  tgaacggaccaacccagaaaatccagtggtc 918



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 291  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                                           
Query: 351  tgaaggggccgacccagaagatccagtggtc 381
            |||| || || |||||||| |||||||||||
Sbjct: 947  tgaacggaccaacccagaaaatccagtggtc 917



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                                          
Query: 351 tgaaggggccgacccagaagatccagtggtc 381
           |||| || || |||||||| |||||||||||
Sbjct: 925 tgaacggaccaacccagaaaatccagtggtc 895



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           ||||||| || || ||||||||||| | |||||||||||  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                                          
Query: 351 tgaaggggccgacccagaagatccagtggtc 381
           |||| ||||| ||||||||||||||||||||
Sbjct: 871 tgaaagggccaacccagaagatccagtggtc 841



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 288 tggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgc 347
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                                                       
Query: 348 cgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtaga 407
           | |||||||| || |||||||| |||||   |||   |||||| ||||| ||||||||||
Sbjct: 847 caatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtaga 788

                  
Query: 408 tgatggc 414
           |||||||
Sbjct: 787 tgatggc 781



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 291   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
             ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 29951 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 29892

                                      
Query: 351   tgaaggggccgacccagaagatcca 375
             |||| || || |||||||| |||||
Sbjct: 29891 tgaacggaccaacccagaaaatcca 29867



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 291  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 4906 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 4847

                                     
Query: 351  tgaaggggccgacccagaagatcca 375
            |||| || || |||||||| |||||
Sbjct: 4846 tgaacggaccaacccagaaaatcca 4822



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  ||||||||||||| ||| || |||||||||||||||||
Sbjct: 816 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatccagtg 757

              
Query: 379 gtc 381
           |||
Sbjct: 756 gtc 754



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 289 ggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgcc 348
           |||||||||||| || ||||||||||| | |||||||||||| || || || || || ||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggtagattgcagcaagggcagctcc 815

                                  
Query: 349 gatgaaggggccgacccagaaga 371
            |||||||| || ||||||||||
Sbjct: 814 aatgaagggaccaacccagaaga 792



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 99/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 293 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 352
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                                                                       
Query: 353 aaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatg 412
           || || || |||||||| ||||| |||||   ||| |||||    |||||||||||||||
Sbjct: 876 aatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttgtagatgatg 817

             
Query: 413 gc 414
           ||
Sbjct: 816 gc 815



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 787 gatgatggc 779



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 293 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 352
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                                        
Query: 353 aaggggccgacccagaagatccagtggtc 381
           || || || |||||||| ||||| |||||
Sbjct: 116 aatggcccaacccagaaaatccaatggtc 88



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||||||||| || || ||||||||||||||||||||
Sbjct: 782 gcggcgccgatgaatggacccacccagaagatccagtggtc 742



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 858 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 799

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 798 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 739

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 738 gatgatggc 730



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 787 gatgatggc 779



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 163 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 104

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 103 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 44

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 43  gatgatggc 35



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||||||||| || || ||||||||||||||||||||
Sbjct: 837 gcggcgccgatgaatggacccacccagaagatccagtggtc 797



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 231 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 172

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 171 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 112

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 111 gatgatggc 103



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 490 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 431

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 430 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 371

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 370 gatgatggc 362



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 871 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 812

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 811 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 752

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 751 gatgatggc 743



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 104/129 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 905 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 846

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 845 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 786

                    
Query: 406 gatgatggc 414
           |||||||||
Sbjct: 785 gatgatggc 777



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
           ||||||||||| ||| || | ||| |||||||| | |||||||||||||||||||||
Sbjct: 890 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 834



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 792 gcggcgccgatgaacgggccaacccagaagatccactggtc 752



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 975 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 916

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 915 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 856



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 881 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 822

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 821 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 762



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 862 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 803

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 802 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 743



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 903 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 844

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 843 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 784



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 893 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 834

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 833 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 774



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 467 gcggcgccgacgaacgggccgacccagaagatccattggt 428



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 495 gcggcgccgacgaacgggccgacccagaagatccaatggt 456



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||| |||||||||||||||||||| ||||
Sbjct: 891 gcggcgccgacgaacgggccgacccagaagatccaatggt 852



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

              
Query: 379 gtc 381
           |||
Sbjct: 820 gtc 818



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 341      gcggcgccgatgaaggggccgacccagaagatcca 375
                |||||||||| ||| ||||||||||||||||||||
Sbjct: 15355775 gcggcgccgacgaacgggccgacccagaagatcca 15355741



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 347      ccgatgaaggggccgacccagaagatcca 375
                |||||||| || |||||||||||||||||
Sbjct: 15316506 ccgatgaacggcccgacccagaagatcca 15316478



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 344      gcgccgatgaaggggccgacccagaagatcca 375
                ||||||||||| || || ||||||||||||||
Sbjct: 15306473 gcgccgatgaacggcccaacccagaagatcca 15306442



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 341   gcggcgccgatgaaggggccgacccagaagatcca 375
             |||||||||| ||| ||||||||||||||||||||
Sbjct: 62774 gcggcgccgacgaacgggccgacccagaagatcca 62740



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 347   ccgatgaaggggccgacccagaagatcca 375
             |||||||| || |||||||||||||||||
Sbjct: 23505 ccgatgaacggcccgacccagaagatcca 23477



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 344   gcgccgatgaaggggccgacccagaagatcca 375
             ||||||||||| || || ||||||||||||||
Sbjct: 13472 gcgccgatgaacggcccaacccagaagatcca 13441



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

              
Query: 379 gtc 381
           |||
Sbjct: 820 gtc 818



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 390
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 755 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 706



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 341      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 390
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36057599 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36057550



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 341    gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 390
              |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 119110 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 119061



to top

>gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete
           cds
          Length = 1123

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 104/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 285 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 344
           |||||| ||||||||| || |||||||| || || |||||||| |  || || || || |
Sbjct: 907 acttggacttgaatggaattgctctgatcacaacttggtggtatagagctgctagagctg 848

                                                                       
Query: 345 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 404
           | || ||||| || || |||||||| |||||||||||   ||| ||||| |||  |||||
Sbjct: 847 ccccaatgaatggtccaacccagaatatccagtggtcattccatgcgtgttcctggttgt 788

                     
Query: 405 agatgatggc 414
           ||||||||||
Sbjct: 787 agatgatggc 778



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 341      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 390
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36147673 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36147624



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 390
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 843 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 794



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtg 378
           |||||||||||||  |||||||||||||| ||||||||
Sbjct: 209 gcggcgccgatgagtgggccgacccagaatatccagtg 172



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                                    
Query: 351 tgaaggggccgacccagaagatcca 375
           |||| || || ||||||||||||||
Sbjct: 849 tgaaaggtcccacccagaagatcca 825



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 350 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 409
           ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||||||
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                
Query: 410 atggc 414
           |||||
Sbjct: 772 atggc 768



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 350
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                                    
Query: 351 tgaaggggccgacccagaagatcca 375
           |||| || || ||||||||||||||
Sbjct: 850 tgaacggtcccacccagaagatcca 826



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 319   ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
             ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 85054 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 84998



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 362 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 414
           |||||||| |||||||||||   |||||| |||| | ||||||||||||||||
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggc 826



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 319    ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
              ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 109135 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 683 gcggcgccgacgaaggggccgagccagtagacccagtggt 644



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           |||||||||||| |||||||| || | ||||||||| | ||| || || || || || ||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctccaat 852

                                   
Query: 352 gaaggggccgacccagaagatcca 375
           |||||| || |||||||| |||||
Sbjct: 851 gaagggtccaacccagaaaatcca 828



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                        
Query: 341      gcggcgccgatgaaggggccgacccagaagatccagtggt 380
                |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 43108744 gcggcgccgacgaaggggccgagccagtagacccagtggt 43108783



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 890 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 831

                                           
Query: 379 gtctgaccaggcgtgctccctgttgtagatga 410
           |||   |||||| |  ||| ||||||||||||
Sbjct: 830 gtcgtcccaggccttgtccttgttgtagatga 799



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                        
Query: 292  cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
            |||||| ||||| || |||| ||| ||||||||||| |  || || ||||| || |||  
Sbjct: 1074 cttgaaggggatggccctgaggacgacctggtggtacaccgccgcaagcgccgctccggc 1015

                                        
Query: 352  gaaggggccgacccagaagatccagtgg 379
            ||| ||||| ||||||||||||||||||
Sbjct: 1014 gaacgggcccacccagaagatccagtgg 987



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 341    gcggcgccgatgaaggggccgacccagaagatccagtggt 380
              |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 105773 gcggcgccgacgaaggggccgagccagtagacccagtggt 105812



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 292 cttgaatgggatcgctctgatgaccacctggtggta 327
           |||||||||||| |||||||| || |||||||||||
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggta 902



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 707 gcggcgccgacgaaggggccgagccagtagacccagtggt 668



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 756 gcggcgccgacgaaggggccgagccagtagacccagtggt 717



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggt 380
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 693 gcggcgccgacgaaggggccgagccagtagacccagtggt 654



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 318 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 259

                                           
Query: 379 gtctgaccaggcgtgctccctgttgtagatga 410
           |||   |||||| |  ||| ||||||||||||
Sbjct: 258 gtcgtcccaggccttgtccttgttgtagatga 227



to top

>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 350 atgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtc 847



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 287 ttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcg 346
           |||||||||||||| || ||||||||||  | ||||||||| |  || || || || || 
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggtaaactgcagcgagagcagct 831

                                           
Query: 347 ccgatgaaggggccgacccagaagatccagtg 378
           || ||||| || || |||||||||||||||||
Sbjct: 830 ccaatgaatggtccaacccagaagatccagtg 799



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ggggccgacccagaagatccagtggtc 381
           |||||| ||||||||||||||||||||
Sbjct: 833 ggggcccacccagaagatccagtggtc 807



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 328    gatggcggccagcgcggcgccga 350
              |||||||||||||||||||||||
Sbjct: 310343 gatggcggccagcgcggcgccga 310365



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 98/123 (79%)
 Strand = Plus / Minus

                                                                       
Query: 292 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 351
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 867 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 808

                                                                       
Query: 352 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 411
           ||| || |||||||| |||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 807 gaatggtccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 748

              
Query: 412 ggc 414
           |||
Sbjct: 747 ggc 745



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| ||||| |||||||||||||| |||||
Sbjct: 872 ccgatgaacgggcccacccagaagatccactggtc 838



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||| | |||||| |  ||||| |||||||| || || |||||||| ||||||||
Sbjct: 886 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 827

              
Query: 379 gtc 381
           |||
Sbjct: 826 gtc 824



to top

>gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-1 mRNA, partial cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||| |||||||||||
Sbjct: 341 ccgatgaacggcccgacccagaaaatccagtggtc 307



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || || ||||||||||||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 95     tctgtctgggttcaggtgaatacagag 121
              ||||||||||| |||||||||||||||
Sbjct: 225070 tctgtctgggtacaggtgaatacagag 225044



to top

>dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, partial cds
          Length = 273

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||| |||||||||||
Sbjct: 233 ccgatgaacggcccgacccagaaaatccagtggtc 199



to top

>dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, complete cds
          Length = 945

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 347 ccgatgaaggggccgacccagaagatccagtggtc 381
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (AT)X27, closest to
           marker S733, genomic sequence
          Length = 254

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 385 ccaggcgtgctccctgttgtagatgatggc 414
           |||||| || ||||||||||||||||||||
Sbjct: 39  ccaggcatggtccctgttgtagatgatggc 10



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 356 gggccgacccagaagatccagtggtc 381
           ||||| ||||||||||||||||||||
Sbjct: 780 gggcccacccagaagatccagtggtc 755



to top

>gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete sequence
          Length = 95941

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 347  ccgatgaaggggccgacccagaagatccagtggt 380
            |||||||| || || |||||||||||||||||||
Sbjct: 8298 ccgatgaatggaccaacccagaagatccagtggt 8265



to top

>gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete sequence
          Length = 164457

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 347    ccgatgaaggggccgacccagaagatccagtggt 380
              |||||||| || || |||||||||||||||||||
Sbjct: 110004 ccgatgaatggaccaacccagaagatccagtggt 109971



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 286   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 75731 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 75672

                                           
Query: 346   gccgatgaaggggccgacccagaagatcca 375
              || ||||| || |||||||||||||||||
Sbjct: 75671 accaatgaatggaccgacccagaagatcca 75642



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 286   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 34199 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 34140

                                           
Query: 346   gccgatgaaggggccgacccagaagatcca 375
              || ||||| || |||||||||||||||||
Sbjct: 34139 accaatgaatggaccgacccagaagatcca 34110



to top

>emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1
          Length = 34127

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 312  tgaccacctggtggtagatggc 333
            ||||||||||||||||||||||
Sbjct: 9156 tgaccacctggtggtagatggc 9135



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 312  tgaccacctggtggtagatggc 333
            ||||||||||||||||||||||
Sbjct: 5054 tgaccacctggtggtagatggc 5033



to top

>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 332 gcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||| ||||| ||||||||||| || |||||||| || | |||||||||
Sbjct: 880 gcggcgagcgctgcgccgatgaatggtccgacccaaaatacccagtggtc 831



to top

>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 312   tgaccacctggtggtagatggc 333
             ||||||||||||||||||||||
Sbjct: 34675 tgaccacctggtggtagatggc 34654



to top

>ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA
          Length = 3292

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 312  tgaccacctggtggtagatggc 333
            ||||||||||||||||||||||
Sbjct: 2313 tgaccacctggtggtagatggc 2292



to top

>gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA
          Length = 2897

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 312  tgaccacctggtggtagatggc 333
            ||||||||||||||||||||||
Sbjct: 1897 tgaccacctggtggtagatggc 1876



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 356 gggccgacccagaagatccagtggtc 381
           ||||| ||||||||||||||||||||
Sbjct: 851 gggcccacccagaagatccagtggtc 826



to top

>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggta 327
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928



to top

>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete
              sequence
          Length = 310993

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 312    tgaccacctggtggtagatggc 333
              ||||||||||||||||||||||
Sbjct: 239024 tgaccacctggtggtagatggc 239045



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 317 acctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccag 376
           |||||||||||||  || || || || || |||||||| || || |||||||||||||||
Sbjct: 867 acctggtggtagagtgcagcgagagccgcaccgatgaatggtcccacccagaagatccag 808

             
Query: 377 tg 378
           ||
Sbjct: 807 tg 806



to top

>dbj|AB002147.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1112

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 103/130 (79%)
 Strand = Plus / Minus

                                                                       
Query: 285 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 344
           |||||| ||| |||||||| || ||||| |||||||| ||||| |  || || || || |
Sbjct: 901 acttggacttaaatgggattgccctgatcaccacctgttggtacagagctgctagtgctg 842

                                                                       
Query: 345 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 404
           | || ||||| || || |||||||| |||||||||||   ||| ||||| ||   |||||
Sbjct: 841 ctccaatgaaaggtccaacccagaaaatccagtggtcatcccatgcgtggtcttggttgt 782

                     
Query: 405 agatgatggc 414
           ||||||||||
Sbjct: 781 agatgatggc 772



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 910 gcggcaccaatgaagggtccgacccagaaaatccattggtc 870



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                       
Query: 286 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 345
           |||| ||||||| || || ||||||||||| | |||||| ||||  ||||| |  || ||
Sbjct: 292 cttgctcttgaaaggaatggctctgatgacaatctggtgatagagtgcggctaaagctgc 233

                                                                       
Query: 346 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 405
            || ||||| || ||||||||||| ||||| |||||   ||| | ||| ||| |||||||
Sbjct: 232 tccaatgaatggtccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgta 173

                    
Query: 406 gatgatggc 414
           ||| |||||
Sbjct: 172 gataatggc 164



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 341 gcggcgccgatgaaggggccgacccagaagatccagtggtc 381
           ||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 827 gcggccccaatgaaaggcccgacccagaagatccaatggtc 787



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 352 gaaggggccgacccagaagatccagtggt 380
           |||||| || |||||||||||||||||||
Sbjct: 781 gaagggtccaacccagaagatccagtggt 753



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 350 atgaaggggccgacccagaagatccagtg 378
           ||||||||||| |||||||| ||||||||
Sbjct: 888 atgaaggggccaacccagaaaatccagtg 860



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 356 gggccgacccagaagatccagtggt 380
           |||||||||||| ||||||||||||
Sbjct: 744 gggccgacccagtagatccagtggt 720



to top

>gb|AC022118.5| Homo sapiens chromosome 5 clone CTC-548H10, complete sequence
          Length = 104094

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 360   cgacccagaagatccagtggt 380
             |||||||||||||||||||||
Sbjct: 41186 cgacccagaagatccagtggt 41166



to top

>gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 210101

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 138   acatcaaacttggaagacaaa 158
             |||||||||||||||||||||
Sbjct: 24157 acatcaaacttggaagacaaa 24177



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 352    gaaggggccgacccagaagatccagtggt 380
              ||||||||||| |||| ||||||||||||
Sbjct: 208925 gaaggggccgatccagtagatccagtggt 208953



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 406
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414

                
Query: 407 atgat 411
           |||||
Sbjct: 413 atgat 409



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 406
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744

                
Query: 407 atgat 411
           |||||
Sbjct: 743 atgat 739



to top

>gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete cds; NarL-like (narL)
            and NarX-like (narX) genes, complete sequence; NarK
            (narK), NarM (narM), NarG (narG), NarH (narH), NarJ
            (narJ), and NarI (narI) genes, complete cds; and unknown
            gene
          Length = 15150

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 343  ggcgccgatgaaggggccgacccag 367
            |||||||||||||||||||| ||||
Sbjct: 5753 ggcgccgatgaaggggccgatccag 5729



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 347    ccgatgaaggggccgacccagaagatcca 375
              |||||||| || |||||||||||||||||
Sbjct: 102519 ccgatgaacggcccgacccagaagatcca 102491



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 344   gcgccgatgaaggggccgacccagaagatcca 375
             ||||||||||| || || ||||||||||||||
Sbjct: 92486 gcgccgatgaacggcccaacccagaagatcca 92455



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 362 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 414
           |||||||| |||||||||||   |||||| |||  | ||||||||||||||||
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggc 822



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 362 acccagaagatccagtggtct 382
           |||||||||||||||||||||
Sbjct: 798 acccagaagatccagtggtct 778



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 362 acccagaagatccagtggtct 382
           |||||||||||||||||||||
Sbjct: 796 acccagaagatccagtggtct 776



to top

>ref|NM_211463.1| Eremothecium gossypii AGL266Cp (AGL266C), mRNA
          Length = 1353

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 352  gaaggggccgacccagaagatccagtggt 380
            ||||||||||| |||| ||||||||||||
Sbjct: 1260 gaaggggccgatccagtagatccagtggt 1232



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 362 acccagaagatccagtggtct 382
           |||||||||||||||||||||
Sbjct: 791 acccagaagatccagtggtct 771



to top

>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 138    acatcaaacttggaagacaaa 158
              |||||||||||||||||||||
Sbjct: 121183 acatcaaacttggaagacaaa 121203



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 362  acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 414
            |||||||| | |||||||||   |||||| |||| | ||||||||||||||||
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggc 963



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 326     tagatggcggccagcgcggcgccgatga 353
               ||||| ||||||||| ||||||||||||
Sbjct: 3446908 tagatcgcggccagcccggcgccgatga 3446881



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 347 ccgatgaaggggccgacccagaagatccagtg 378
           |||||||| || ||||||||||| ||||||||
Sbjct: 840 ccgatgaatggcccgacccagaaaatccagtg 809



to top

>ref|XM_550604.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 343 ggcgccgatgaaggggccga 362
           ||||||||||||||||||||
Sbjct: 987 ggcgccgatgaaggggccga 968



to top

>ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed sequence AI841794
           (LOC466584), mRNA
          Length = 1269

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  tgctggatttgcacaacaac 45
           ||||||||||||||||||||
Sbjct: 407 tgctggatttgcacaacaac 426



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 344 gcgccgatgaaggggccgacccagaagatcca 375
           ||||||||||| || || ||||||||||||||
Sbjct: 876 gcgccgatgaacggcccaacccagaagatcca 845



to top

>ref|NM_001005210.1| Homo sapiens leucine rich repeat containing 55 (LRRC55), mRNA
          Length = 3797

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  tgctggatttgcacaacaac 45
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573



to top

>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence
          Length = 136866

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 343   ggcgccgatgaaggggccga 362
             ||||||||||||||||||||
Sbjct: 82946 ggcgccgatgaaggggccga 82927



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 854 acccagaagatccagtggtc 835



to top

>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 824 acccagaagatccagtggtc 805



to top

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 91  acccagaagatccagtggtc 72



to top

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   cagaaagaaattcactcaga 227
             ||||||||||||||||||||
Sbjct: 53978 cagaaagaaattcactcaga 53997



to top

>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    cagagcaagagcaagagtag 136
              ||||||||||||||||||||
Sbjct: 155822 cagagcaagagcaagagtag 155841



to top

>emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 agatccagtggtctgaccag 388
           ||||||||||||||||||||
Sbjct: 365 agatccagtggtctgaccag 384



to top

>emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chromosome 10 Contains a
             CpG island, complete sequence
          Length = 159305

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   gacccagaagatccagtggt 380
             ||||||||||||||||||||
Sbjct: 96077 gacccagaagatccagtggt 96058



to top

>emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037B9 on chromosome 20p12.1-13
             Contains STSs, GSSs and a putative CpG island, complete
             sequence
          Length = 82183

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   cacatcaaacttggaagaca 156
             ||||||||||||||||||||
Sbjct: 72891 cacatcaaacttggaagaca 72872



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 347 ccgatgaaggggccgacccagaagatccagtg 378
           |||||||| || ||||||||||| ||||||||
Sbjct: 806 ccgatgaatggcccgacccagaaaatccagtg 775



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 863 acccagaagatccagtggtc 844



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 886 cttgaatgggatggctctgatgac 863



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 794 acccagaagatccagtggtc 775



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 605 acccagaagatccagtggtc 586



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 328    gatggcggccagcgcggcgc 347
              ||||||||||||||||||||
Sbjct: 539763 gatggcggccagcgcggcgc 539782



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 201     cccccatcagaaagaaattcactc 224
               ||||||||||||| ||||||||||
Sbjct: 1961051 cccccatcagaaacaaattcactc 1961028



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 328     gatggcggccagcgcggcgccgat 351
               |||||| |||||||||||||||||
Sbjct: 1468545 gatggccgccagcgcggcgccgat 1468568



to top

>gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromosome 19, complete
              sequence
          Length = 165954

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 258    catctttctttgtagcagcagctt 281
              |||||||| |||||||||||||||
Sbjct: 108793 catctttcattgtagcagcagctt 108770



to top

>dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443
          Length = 3797

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  tgctggatttgcacaacaac 45
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 330     tggcggccagcgcggcgccg 349
               ||||||||||||||||||||
Sbjct: 4507898 tggcggccagcgcggcgccg 4507879



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 292   cttgaatgggatcgctctgatgac 315
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249



to top

>gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, complete sequence
          Length = 163936

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 147    ttggaagacaaattggaatt 166
              ||||||||||||||||||||
Sbjct: 159892 ttggaagacaaattggaatt 159873



to top

>gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, complete sequence
          Length = 164009

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 205   catcagaaagaaattcactcagaa 228
             ||||||||| ||||||||||||||
Sbjct: 52709 catcagaaaaaaattcactcagaa 52732



to top

>gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, complete sequence
          Length = 175154

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 361    gacccagaagatccagtggt 380
              ||||||||||||||||||||
Sbjct: 140637 gacccagaagatccagtggt 140656



to top

>gb|AC091980.4| Homo sapiens chromosome 5 clone RP11-546B8, complete sequence
          Length = 153133

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 361    gacccagaagatccagtggt 380
              ||||||||||||||||||||
Sbjct: 104828 gacccagaagatccagtggt 104809



to top

>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 147   ttggaagacaaattggaatt 166
             ||||||||||||||||||||
Sbjct: 50150 ttggaagacaaattggaatt 50131



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 359 ccgacccagaagatccagtg 378
           ||||||||||||||||||||
Sbjct: 749 ccgacccagaagatccagtg 730



to top

>gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA, complete cds
          Length = 819

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 359 ccgacccagaagatccagtg 378
           ||||||||||||||||||||
Sbjct: 650 ccgacccagaagatccagtg 631



to top

>dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial cds, clone:
           RAFL22-84-C08
          Length = 318

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 111 cttgaatgggatggctctgatgac 88



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 868 cttgaatgggatggctctgatgac 845



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 885 cttgaatgggatggctctgatgac 862



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 345      cgccgatgaaggggccgacccagaagatccag 376
                |||||| || ||||||||||||| ||||||||
Sbjct: 13251059 cgccgacgagggggccgacccagtagatccag 13251028



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 343     ggcgccgatgaaggggccga 362
               ||||||||||||||||||||
Sbjct: 1762730 ggcgccgatgaaggggccga 1762711



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||  |||||| |  |||||||| || |  ||||| |||||||||||||| ||
Sbjct: 900 ctggtggtaggcggcggcgatggcggcgccaatcagtgggcccacccagaagatccattg 841

                                           
Query: 379 gtctgaccaggcgtgctccctgttgtagatga 410
           |||   |||||| |  ||| ||||||||||||
Sbjct: 840 gtcgtcccaggccttgtccttgttgtagatga 809



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 889 cttgaatgggatggctctgatgac 866



to top

>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 522 cttgaatgggatggctctgatgac 499



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 894 cttgaatgggatggctctgatgac 871



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 881 cttgaatgggatggctctgatgac 858



to top

>gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, complete sequence
          Length = 200430

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 258    catctttctttgtagcagcagctt 281
              |||||||| |||||||||||||||
Sbjct: 139931 catctttcattgtagcagcagctt 139908



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 347 ccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||| || |||||||| ||||||||
Sbjct: 822 ccgatgaagggacccacccagaaaatccagtg 791



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 320 tggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 375
           ||||||||||||||||| |  || || || ||||| || ||||||||||| |||||
Sbjct: 884 tggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatcca 829



to top

>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0679C08
          Length = 156266

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 343   ggcgccgatgaaggggccga 362
             ||||||||||||||||||||
Sbjct: 87879 ggcgccgatgaaggggccga 87860



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 345   cgccgatgaaggggccgacccagaagatccag 376
             |||||| || ||||||||||||| ||||||||
Sbjct: 12869 cgccgacgagggggccgacccagtagatccag 12838



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 345    cgccgatgaaggggccgacccagaagatccag 376
              |||||| || ||||||||||||| ||||||||
Sbjct: 168247 cgccgacgagggggccgacccagtagatccag 168216



to top

>emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 including spda, kora, spdb2 and
            rep genes
          Length = 9367

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  tggcggccagcgcggcgccg 349
            ||||||||||||||||||||
Sbjct: 4015 tggcggccagcgcggcgccg 3996



to top

>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 292  cttgaatgggatcgctctgatgac 315
            |||||||||||| |||||||||||
Sbjct: 1547 cttgaatgggatggctctgatgac 1524



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 759 cgccgacgagggggccgacccagtagatccag 728



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 761 cgccgacgagggggccgacccagtagatccag 730



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 761 cgccgacgagggggccgacccagtagatccag 730



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 639 cgccgacgagggggccgacccagtagatccag 608



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 762 cgccgacgagggggccgacccagtagatccag 731



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 760 cgccgacgagggggccgacccagtagatccag 729



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 762 cgccgacgagggggccgacccagtagatccag 731



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 345 cgccgatgaaggggccgacccagaagatccag 376
           |||||| || ||||||||||||| ||||||||
Sbjct: 760 cgccgacgagggggccgacccagtagatccag 729



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 344 gcgccgatgaaggggccgacccagaagatcca 375
           ||||||||||| || || ||||||||||||||
Sbjct: 876 gcgccgatgaacggcccaacccagaagatcca 845



to top

>dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-176J24, complete
             sequences
          Length = 171744

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    tgctggatttgcacaacaac 45
             ||||||||||||||||||||
Sbjct: 92890 tgctggatttgcacaacaac 92909



to top

>gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte receptor
           diversity region (VLR) mRNA, partial cds
          Length = 534

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  tgctggatttgcacaacaac 45
           ||||||||||||||||||||
Sbjct: 263 tgctggatttgcacaacaac 282



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 359 ccgacccagaagatccagtg 378
           ||||||||||||||||||||
Sbjct: 749 ccgacccagaagatccagtg 730



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 825 acccagaagatccagtggtc 806



to top

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 acccagaagatccagtggtc 381
           ||||||||||||||||||||
Sbjct: 815 acccagaagatccagtggtc 796



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 347 ccgatgaaggggccgacccagaagatccagtg 378
           ||||||||||| || |||||||| ||||||||
Sbjct: 820 ccgatgaagggtccaacccagaaaatccagtg 789



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 cttgaatgggatcgctctgatgac 315
           |||||||||||| |||||||||||
Sbjct: 870 cttgaatgggatggctctgatgac 847


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,086,806
Number of Sequences: 3902068
Number of extensions: 4086806
Number of successful extensions: 78766
Number of sequences better than 10.0: 238
Number of HSP's better than 10.0 without gapping: 238
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 78018
Number of HSP's gapped (non-prelim): 734
length of query: 416
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 394
effective length of database: 17,147,199,772
effective search space: 6755996710168
effective search space used: 6755996710168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top