| Clone Name | rbaet117e02 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X57407.1|TAPPSBP Wheat PsbP mRNA for 23 kDa oxygen evolving protein of photosystem II Length = 967 Score = 414 bits (209), Expect = e-113 Identities = 260/274 (94%), Gaps = 5/274 (1%) Strand = Plus / Minus Query: 2 agggaaatcgacctcttagttcatccatcctcatgtacaaatcaaagaaacacacatgca 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 927 agggaaatcgacctcttagttcatccatcctcatgtacaaatcaaagaaacacacatgca 868 Query: 62 tgccctggatcggtctctacacggtgcttccctgaggagatt-ccattaaattcgccgat 120 ||||||| ||||||||||||| ||||| |||||||||| ||| |||||||| |||||| | Sbjct: 867 tgccctg-atcggtctctacatggtgcatccctgaggaaatttccattaaactcgccggt 809 Query: 121 cggtcatgtatatttatgcgacactgaaggatcctgcggcgttctcgacgaacttcttgg 180 ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 808 cggtcgtgtatatttatgcgacgctgaaggatcctgcggcgttctcgacgaacttcttgg 749 Query: 181 cgcccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagcttgccgtcgg 240 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 748 cgcccttgaaccacctcttgtctc---gttgcgccttgcagacgtagagcttgccgtcgg 692 Query: 241 cgacggtggcggtgatgagctggtgcttncctcc 274 |||||||||||||||||||||||||||| ||||| Sbjct: 691 cgacggtggcggtgatgagctggtgcttccctcc 658
>ref|NM_186247.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1114 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 872 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 813 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 812 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 753 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 752 tcagctggtgctt 740
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Plus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 2169273 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 2169332 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 2169333 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 2169392 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 2169393 tcagctggtgctt 2169405
>dbj|AP004010.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1351_C05 Length = 112465 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Plus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 37175 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 37234 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 37235 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 37294 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 37295 tcagctggtgctt 37307
>dbj|AK104722.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B02, full insert sequence Length = 1078 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 828 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 769 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 768 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 709 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 708 tcagctggtgctt 696
>dbj|AK065248.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J02, full insert sequence Length = 1114 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 872 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 813 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 812 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 753 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 752 tcagctggtgctt 740
>gb|AF052203.1|AF052203 Oryza sativa 23 kDa polypeptide of photosystem II mRNA, complete cds Length = 1107 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 847 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 788 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 787 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 728 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 727 tcagctggtgctt 715
>dbj|D49713.1|RICOSEE2 Rice OSOEE2 gene for 23 kDa polypeptide of photosystem II, complete cds Length = 1008 Score = 145 bits (73), Expect = 8e-32 Identities = 118/133 (88%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| |||||||||||||| |||||||||||||||||| Sbjct: 786 atgcgacgctgaaggagctggctgcgctctcgacgaacttcctggcgcccttgaaccacc 727 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| ||||| ||||||||||||| ||| |||||||||||| ||||||||| |||| Sbjct: 726 tcttgtcgccggcctgcgccttgcagatgtacagcttgccgtcgttgacggtggccgtga 667 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 666 tcagctggtgctt 654
>gb|AY103732.1| Zea mays PCO073407 mRNA sequence Length = 1083 Score = 137 bits (69), Expect = 2e-29 Identities = 102/113 (90%) Strand = Plus / Minus Query: 156 gcggcgttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgcc 215 ||||| |||||||| |||| ||||||||||||||||||||||||| ||||| |||||| Sbjct: 830 gcggccttctcgactcccttcctggcgcccttgaaccacctcttgtcgccggcctgcgcc 771 Query: 216 ttgcagacgtagagcttgccgtcggcgacggtggcggtgatgagctggtgctt 268 ||||||| ||||||||||||||||| ||||||||| | ||||||||||||||| Sbjct: 770 ttgcagatgtagagcttgccgtcggagacggtggccgcgatgagctggtgctt 718
>gb|AF022732.1|AF022732 Oryza sativa 23kDa polypeptide of photosystem II mRNA, complete cds Length = 1031 Score = 121 bits (61), Expect = 1e-24 Identities = 115/133 (86%) Strand = Plus / Minus Query: 136 atgcgacactgaaggatcctgcggcgttctcgacgaacttcttggcgcccttgaaccacc 195 ||||||| |||||||| | || ||| ||||||| |||||| |||||||||||||||||| Sbjct: 830 atgcgacgctgaaggagctggctgcgctctcgacaaacttcctggcgcccttgaaccacc 771 Query: 196 tcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcgacggtggcggtga 255 ||||||| |||| ||||||||||||| || |||||||||||| ||||||||| |||| Sbjct: 770 tcttgtcgccgggctgcgccttgcagatgttcagcttgccgtcgttgacggtggccgtga 711 Query: 256 tgagctggtgctt 268 | ||||||||||| Sbjct: 710 tcagctggtgctt 698
>emb|X05511.1|SOOEC23 Spinach mRNA 23 kDa protein of the photosynthetic oxygen-evolving complex (OEC) Length = 1000 Score = 79.8 bits (40), Expect = 4e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| |||||||| || ||||||||||| ||||||||||| ||||| |||||||||| Sbjct: 806 tctcgacaaacttcttagcacccttgaaccatctcttgtctccagcttgagccttgcaga 747 Query: 223 cgtagagcttgccgtc 238 ||| ||||| ||||| Sbjct: 746 tgtaaagcttaccgtc 731
>gb|AF037458.1|AF037458 Fritillaria agrestis photosystem II oxygen evolving complex protein 2 precursor (psbP) mRNA, complete cds Length = 970 Score = 75.8 bits (38), Expect = 6e-11 Identities = 56/62 (90%) Strand = Plus / Minus Query: 171 aacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagc 230 ||||||||||| ||||||||||| |||||||| ||||| || |||||||||| ||||||| Sbjct: 767 aacttcttggctcccttgaaccatctcttgtccccggcctgtgccttgcagatgtagagc 708 Query: 231 tt 232 || Sbjct: 707 tt 706
>ref|NM_100545.2| Arabidopsis thaliana PSBP (OXYGEN-EVOLVING ENHANCER PROTEIN 2); calcium ion binding AT1G06680 (PSBP) mRNA, complete cds Length = 1085 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 824 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 765 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 764 tgtaaagctt 755
>gb|BT015556.1| Arabidopsis thaliana At1g06680 mRNA sequence Length = 561 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 532 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 473 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 472 tgtaaagctt 463
>gb|AY096487.1| Arabidopsis thaliana putative 23 kDa polypeptide of oxygen-evolving complex (OEC) (At1g06680) mRNA, complete cds Length = 823 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 763 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 704 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 703 tgtaaagctt 694
>gb|AY074308.1| Arabidopsis thaliana putative 23 kDa polypeptide of oxygen-evolving comlex protein (At1g06680) mRNA, complete cds Length = 1046 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 820 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 761 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 760 tgtaaagctt 751
>gb|AY070469.1| Arabidopsis thaliana At1g06680/F4H5_18 mRNA, complete cds Length = 937 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 818 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 759 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 758 tgtaaagctt 749
>gb|AY056416.1| Arabidopsis thaliana At1g06680/F4H5_18 mRNA, complete cds Length = 935 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 818 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 759 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 758 tgtaaagctt 749
>dbj|AK221243.1| Arabidopsis thaliana mRNA for PSII-P protein, partial cds, clone: RAFL24-01-M24 Length = 292 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 72 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 13 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 12 tgtaaagctt 3
>emb|BX813852.1|CNS0AEBT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZH11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 948 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 806 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 747 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 746 tgtaaagctt 737
>emb|BX813677.1|CNS0AE2Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZA05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 739 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 544 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 485 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 484 tgtaaagctt 475
>emb|BX815468.1|CNS0ACDF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZH01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 922 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 777 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 718 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 717 tgtaaagctt 708
>emb|BX814211.1|CNS0ACB9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZH06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 994 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 804 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 745 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 744 tgtaaagctt 735
>emb|BX814208.1|CNS0ACB8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZH01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 661 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 450 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 391 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 390 tgtaaagctt 381
>emb|BX815307.1|CNS0ABGV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS50ZF04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 804 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 745 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 744 tgtaaagctt 735
>emb|BX815232.1|CNS0ABDH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS44ZE08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 806 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 747 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 746 tgtaaagctt 737
>emb|BX814903.1|CNS0AAGT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 570 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 374 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 315 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 314 tgtaaagctt 305
>emb|BX814881.1|CNS0AAH2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS16ZA07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 709 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 461 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 402 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 401 tgtaaagctt 392
>gb|AC007592.4|AC007592 Genomic sequence for Arabidopsis thaliana BAC F12K11 from chromosome I, complete sequence Length = 93724 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Plus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 4853 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 4912 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 4913 tgtaaagctt 4922
>gb|AY087305.1| Arabidopsis thaliana clone 33922 mRNA, complete sequence Length = 1067 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 825 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 766 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 765 tgtaaagctt 756
>gb|AC011001.2|AC011001 Arabidopsis thaliana chromosome I BAC F4H5 genomic sequence, complete sequence Length = 91608 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Plus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 85939 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 85998 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 85999 tgtaaagctt 86008
>emb|X98108.1|ATPSPB A.thaliana psbP gene Length = 1683 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 163 tctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||||| || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 1508 tctcgacaaatttcctggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 1449 Query: 223 cgtagagctt 232 ||| ||||| Sbjct: 1448 tgtaaagctt 1439
>emb|Y08886.1|BJ23OESP2 B.juncea mRNA for 23 kD protein of oxygen evolving system of photosystem II Length = 754 Score = 60.0 bits (30), Expect = 4e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 177 ttggcgcccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 611 ttggctcccttgaaccacctcttgtctccagcttgtgctttgcaga 566
>ref|NM_128632.2| Arabidopsis thaliana calcium ion binding AT2G30790 mRNA, complete cds Length = 786 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 758 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 700
>gb|BT015608.1| Arabidopsis thaliana At2g30790 mRNA sequence Length = 581 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 553 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 495
>emb|X17213.1|SA23KDP2 S.alba psbP gene for 23 kDa polypeptide of the oxygen-evolving complex of photosystem II Length = 1936 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 177 ttggcgcccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagcttgcc 235 ||||| || |||||||||||||||||||| ||||| || ||||||| || |||||||| Sbjct: 1424 ttggctcctttgaaccacctcttgtctccagcttgtgctttgcagatataaagcttgcc 1366
>gb|AC002340.3| Arabidopsis thaliana chromosome 2 BAC T11J7 genomic sequence, complete sequence Length = 79574 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 72957 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 73015
>gb|BT022094.1| Arabidopsis thaliana At2g30790 mRNA, complete cds Length = 833 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 765 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 707
>dbj|AK175934.1| Arabidopsis thaliana mRNA for putative photosystem II oxygen-evolving complex 23K protein, complete cds, clone: RAFL22-60-I02 Length = 936 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 793 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 735
>dbj|AK175821.1| Arabidopsis thaliana mRNA for putative photosystem II oxygen-evolving complex 23K protein, complete cds, clone: RAFL22-42-D16 Length = 936 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 793 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 735
>dbj|AK175738.1| Arabidopsis thaliana mRNA for putative photosystem II oxygen-evolving complex 23K protein, complete cds, clone: RAFL22-28-H07 Length = 936 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 162 ttctcgacgaacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgca 220 ||||| ||||||||| | || || |||||||||||||||||||| ||||| || ||||| Sbjct: 793 ttctcaacgaacttcctagctcctttgaaccacctcttgtctcctgcttgagctttgca 735
>emb|Y07498.1|SAOES23 Sinapis alba mRNA fragment for 23kD subunit of oxygen evolving system of photosystem II Length = 867 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 177 ttggcgcccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagcttgcc 235 ||||| || |||||||||||||||||||| ||||| || ||||||| || |||||||| Sbjct: 705 ttggctcctttgaaccacctcttgtctccagcttgtgctttgcagatataaagcttgcc 647
>dbj|AB236819.1| Trifolium pratense RNA for putative PSII-P protein, partial cds, clone: C214 Length = 915 Score = 52.0 bits (26), Expect = 0.001 Identities = 71/86 (82%) Strand = Plus / Minus Query: 183 cccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagcttgccgtcggcg 242 ||||| ||||||||||||||||| ||||| |||||||| | ||| || ||||| || Sbjct: 739 cccttaaaccacctcttgtctccagcttgagccttgcaaatgtatagtttgccatcattt 680 Query: 243 acggtggcggtgatgagctggtgctt 268 ||||| ||||| || ||||||||||| Sbjct: 679 acggttgcggtaatcagctggtgctt 654
>emb|X78816.1|NPOEC23 N.pseudonarcissus mRNA for OEC 23 Length = 932 Score = 52.0 bits (26), Expect = 0.001 Identities = 53/62 (85%) Strand = Plus / Minus Query: 171 aacttcttggcgcccttgaaccacctcttgtctccggcttgcgccttgcagacgtagagc 230 ||||||||||| ||||||||||| |||||||| || || || || ||||||| ||| ||| Sbjct: 793 aacttcttggctcccttgaaccatctcttgtcgccagcctgagctttgcagatgtaaagc 734 Query: 231 tt 232 || Sbjct: 733 tt 732
>dbj|AB032245.1| Cucumis sativus psbP mRNA for 23kDa polypeptide of the oxygen-evolving complex of photosystem II, complete cds Length = 1023 Score = 48.1 bits (24), Expect = 0.015 Identities = 30/32 (93%) Strand = Plus / Minus Query: 189 aaccacctcttgtctccggcttgcgccttgca 220 ||||||||||||||||| ||||| |||||||| Sbjct: 751 aaccacctcttgtctcctgcttgtgccttgca 720
>emb|X15552.1|PS23KDAP Pea mRNA for 23kDa polypeptide of the oxygen evolving complex of photosystem II Length = 987 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 183 cccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||| |||||||||||||| || ||||| |||||||||| Sbjct: 759 cccttaaaccacctcttgtcaccagcttgagccttgcaga 720
>dbj|D13296.1|PEAPSBP Pisum sativum mRNA for precursor for 23-kDa protein of photosystem II, complete cds Length = 1026 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 183 cccttgaaccacctcttgtctccggcttgcgccttgcaga 222 ||||| |||||||||||||| || ||||| |||||||||| Sbjct: 803 cccttaaaccacctcttgtcaccagcttgagccttgcaga 764
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 46.1 bits (23), Expect = 0.058 Identities = 29/31 (93%) Strand = Plus / Plus Query: 238 cggcgacggtggcggtgatgagctggtgctt 268 ||||||||| |||||||| |||||||||||| Sbjct: 4994412 cggcgacggcggcggtgaggagctggtgctt 4994442
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 46.1 bits (23), Expect = 0.058 Identities = 29/31 (93%) Strand = Plus / Minus Query: 212 cgccttgcagacgtagagcttgccgtcggcg 242 |||||||||| ||||| |||||||||||||| Sbjct: 3966281 cgccttgcagtcgtagggcttgccgtcggcg 3966251
>gb|AY486007.1| Thlaspi caerulescens oxygen-evolving system subunit-like mRNA, partial sequence Length = 861 Score = 42.1 bits (21), Expect = 0.90 Identities = 26/28 (92%) Strand = Plus / Minus Query: 178 tggcgcccttgaaccacctcttgtctcc 205 |||| |||||||||| |||||||||||| Sbjct: 749 tggctcccttgaaccncctcttgtctcc 722
>gb|AC113299.14| Mus musculus chromosome 5, clone RP23-429P17, complete sequence Length = 214124 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 tccatcctcatgtacaaatca 45 ||||||||||||||||||||| Sbjct: 136776 tccatcctcatgtacaaatca 136756
>emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase gene locus (PADI12346 genes) Length = 355060 Score = 42.1 bits (21), Expect = 0.90 Identities = 24/25 (96%) Strand = Plus / Plus Query: 1 gagggaaatcgacctcttagttcat 25 ||||||||||||||||| ||||||| Sbjct: 304548 gagggaaatcgacctctaagttcat 304572
>gb|AC004824.3| Homo sapiens PAC clone RP1-20B21 from 1, complete sequence Length = 137506 Score = 42.1 bits (21), Expect = 0.90 Identities = 24/25 (96%) Strand = Plus / Minus Query: 1 gagggaaatcgacctcttagttcat 25 ||||||||||||||||| ||||||| Sbjct: 103537 gagggaaatcgacctctaagttcat 103513
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 222 acgtagagcttgccgtcggcgacg 245 |||||| ||||||||||||||||| Sbjct: 1153026 acgtagggcttgccgtcggcgacg 1153049
>gb|AC167561.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940117D9, complete sequence Length = 143368 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 cgtagagcttgccgtcggcg 242 |||||||||||||||||||| Sbjct: 88384 cgtagagcttgccgtcggcg 88365
>gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome 14, complete sequence Length = 187798 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 38 acaaatcaaagaaacacacatgca 61 |||||| ||||||||||||||||| Sbjct: 74134 acaaatgaaagaaacacacatgca 74157
>ref|XM_672016.1| Plasmodium berghei strain ANKA hypothetical protein (PB000859.01.0) partial mRNA Length = 1608 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 101 attccattaaattcgccgat 120 |||||||||||||||||||| Sbjct: 751 attccattaaattcgccgat 770
>gb|AF333150.1| Dermatocarpon miniatum var. complicatum isolate SH50 16S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; 28S ribosomal RNA gene, partial sequence Length = 555 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 233 gccgtcggcgacggtggcgg 252 |||||||||||||||||||| Sbjct: 371 gccgtcggcgacggtggcgg 390
>emb|X57568.1|SGAMYLASE S.griseus DNA for alpha amylase gene, amy Length = 2271 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 tgccgtcggcgacggtggcggtga 255 ||||| |||||||||||||||||| Sbjct: 1659 tgccggcggcgacggtggcggtga 1636
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 219 cagacgtagagcttgccgtcggcg 242 |||||||||| ||||||||||||| Sbjct: 1236698 cagacgtagatcttgccgtcggcg 1236721
>emb|AJ505987.1|SGA505987 Streptomyces galbus secD, secF and apt genes Length = 4312 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 169 cgaacttcttggcgcccttg 188 |||||||||||||||||||| Sbjct: 948 cgaacttcttggcgcccttg 929
>dbj|AK124745.1| Homo sapiens cDNA FLJ42755 fis, clone BRAWH3001475 Length = 3636 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 acaaatcaaagaaacacaca 57 |||||||||||||||||||| Sbjct: 1906 acaaatcaaagaaacacaca 1887
>gb|AC023283.10| Homo sapiens chromosome 10 clone RP11-539I5, complete sequence Length = 218074 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 acaaatcaaagaaacacaca 57 |||||||||||||||||||| Sbjct: 108556 acaaatcaaagaaacacaca 108575
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 233 gccgtcggcgacggtggcgg 252 |||||||||||||||||||| Sbjct: 2933968 gccgtcggcgacggtggcgg 2933987
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 ccgtcggcgacggtggcggtgatg 257 ||||||| |||||||||||||||| Sbjct: 2651022 ccgtcggggacggtggcggtgatg 2651045
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 ggtggcggtgatgagctggt 264 |||||||||||||||||||| Sbjct: 3268701 ggtggcggtgatgagctggt 3268682
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 tcgacgaacttcttggcgcc 184 |||||||||||||||||||| Sbjct: 2923401 tcgacgaacttcttggcgcc 2923420
>gb|AE004997.1| Halobacterium sp. NRC-1 section 28 of 170 of the complete genome Length = 17112 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 cgtcggcgacggtggcggtg 254 |||||||||||||||||||| Sbjct: 5429 cgtcggcgacggtggcggtg 5410
>dbj|AK110218.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-D08, full insert sequence Length = 3457 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 cgtcggcgacggtggcggtg 254 |||||||||||||||||||| Sbjct: 2578 cgtcggcgacggtggcggtg 2559
>gb|AC005661.1|AC005661 citb_54_o_2, complete sequence Length = 84633 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 acaaatcaaagaaacacaca 57 |||||||||||||||||||| Sbjct: 25815 acaaatcaaagaaacacaca 25834
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 gtcggcgacggtggcggtga 255 |||||||||||||||||||| Sbjct: 1946850 gtcggcgacggtggcggtga 1946869
>emb|CT485797.2| Medicago truncatula chromosome 5 clone mth4-11a3, COMPLETE SEQUENCE Length = 211224 Score = 40.1 bits (20), Expect = 3.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 189 aaccacctcttgtctccggcttgcgccttgca 220 ||||||||||||||||| ||||| || ||||| Sbjct: 39365 aaccacctcttgtctccagcttgagctttgca 39396
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 cgtagagcttgccgtcggcg 242 |||||||||||||||||||| Sbjct: 440189 cgtagagcttgccgtcggcg 440208
>gb|M18244.1|STMAMYSL Streptomyces limosus alpha-amylase gene, complete cds Length = 2291 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 tgccgtcggcgacggtggcggtga 255 ||||| |||||||||||||||||| Sbjct: 1652 tgccggcggcgacggtggcggtga 1629 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,229,742 Number of Sequences: 3902068 Number of extensions: 2229742 Number of successful extensions: 52140 Number of sequences better than 10.0: 74 Number of HSP's better than 10.0 without gapping: 74 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51610 Number of HSP's gapped (non-prelim): 527 length of query: 274 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 252 effective length of database: 17,147,199,772 effective search space: 4321094342544 effective search space used: 4321094342544 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)