ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet117b06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 825 0.0
2gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 190 3e-45
3gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 190 3e-45
4gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 151 2e-33
5ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 143 5e-31
6gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 135 1e-28
7dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 135 1e-28
8gb|AY109332.1| Zea mays CL502_5 mRNA sequence 135 1e-28
9dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 135 1e-28
10ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 131 2e-27
11gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 131 2e-27
12gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 131 2e-27
13dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
14gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 107 3e-20
15dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
16emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 105 1e-19
17gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 92 2e-15
18emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 90 7e-15
19emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 90 7e-15
20dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
21dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
22gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 88 3e-14
23gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 88 3e-14
24gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 82 2e-12
25gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 80 7e-12
26gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 80 7e-12
27gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 80 7e-12
28ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 78 3e-11
29ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 78 3e-11
30ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 78 3e-11
31gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 78 3e-11
32gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 78 3e-11
33emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 78 3e-11
34gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 78 3e-11
35dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 78 3e-11
36gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 78 3e-11
37dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
38dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
39dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
40dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
41dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
42gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 78 3e-11
43dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 76 1e-10
44dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 74 4e-10
45gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 74 4e-10
46emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 72 2e-09
47gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 72 2e-09
48ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 70 7e-09
49emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
50emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
51emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
52emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
53emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
54emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
55emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
56gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 70 7e-09
57dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 68 3e-08
58ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 66 1e-07
59ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 66 1e-07
60gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 66 1e-07
61gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 66 1e-07
62gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquapori... 66 1e-07
63gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 66 1e-07
64gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 66 1e-07
65gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 66 1e-07
66gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 66 1e-07
67emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
68emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
69emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
70emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
71gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 66 1e-07
72gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 66 1e-07
73dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 66 1e-07
74gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 66 1e-07
75dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 66 1e-07
76dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 66 1e-07
77ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 64 4e-07
78ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC4633... 64 4e-07
79ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 64 4e-07
80ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (... 64 4e-07
81gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) ... 64 4e-07
82gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) ... 64 4e-07
83gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mR... 64 4e-07
84emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from cl... 64 4e-07
85gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 64 4e-07
86emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta ... 64 4e-07
87gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds 64 4e-07
88gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 64 4e-07
89gb|U41518.1|HSU41518 Human channel-like integral membrane protei... 64 4e-07
90gb|S73482.1| uterine water channel=28 kda erythrocyte integral m... 64 4e-07
91gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds 64 4e-07
92dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
93dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
94dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
95dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
96dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
97gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 64 4e-07
98gb|U41517.1|HSU41517 Human channel-like integral membrane protei... 64 4e-07
99gb|M77829.1|HUMCHIP28A Human channel-like integral membrane prot... 64 4e-07
100ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5... 62 2e-06
101ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)... 62 2e-06
102gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 62 2e-06
103gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 62 2e-06
104emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins... 62 2e-06
105gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr... 62 2e-06
106gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ... 62 2e-06
107gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 62 2e-06
108dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in... 62 2e-06
109gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr... 62 2e-06
110gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 62 2e-06
111emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
112emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
113emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
114emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
115gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s... 62 2e-06
116emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 62 2e-06
117ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 60 6e-06
118gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 60 6e-06
119emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 60 6e-06
120gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 60 6e-06
121emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 60 6e-06
122emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA... 60 6e-06
123emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA... 60 6e-06
124gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 60 6e-06
125dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 60 6e-06
126dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 60 6e-06
127dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 60 6e-06
128dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 60 6e-06
129ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 58 2e-05
130gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 58 2e-05
131gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 58 2e-05
132gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 58 2e-05
133emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 58 2e-05
134emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 2e-05
135gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 58 2e-05
136gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 58 2e-05
137dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 58 2e-05
138gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 58 2e-05
139gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 58 2e-05
140emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
141emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
142emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
143emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
144dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 58 2e-05
145gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 58 2e-05
146gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 58 2e-05
147gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 58 2e-05
148gb|AY856055.1| Notomys alexis aquaporin 1 mRNA, partial cds 56 1e-04
149ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 56 1e-04
150gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 56 1e-04
151gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 56 1e-04
152gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 56 1e-04
153emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
154emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
155gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 54 4e-04
156ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 54 4e-04
157gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 54 4e-04
158gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence 54 4e-04
159emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 54 4e-04
160ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 54 4e-04
161gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 54 4e-04
162gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 54 4e-04
163gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 54 4e-04
164dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 54 4e-04
165gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 54 4e-04
166gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 54 4e-04
167gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 54 4e-04
168gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 52 0.002
169emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 52 0.002
170gb|AC148995.2| Medicago truncatula chromosome 7 BAC clone mth2-4... 52 0.002
171gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 52 0.002
172gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ... 52 0.002
173gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 52 0.002
174gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 52 0.002
175dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 52 0.002
176ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.006
177ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.006
178ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 50 0.006
179gb|AC146187.2| Pan troglodytes BAC clone RP43-25A10 from 7, comp... 50 0.006
180ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 50 0.006
181gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 50 0.006
182gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 50 0.006
183dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
184dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 50 0.006
185gb|AC092408.3| Papio anubis clone RP41-446H8, complete sequence 50 0.006
186gb|AC091620.3| Papio anubis clone RP41-400H11, complete sequence 50 0.006
187gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 50 0.006
188dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
189dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
190emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 50 0.006
191emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.006
192gb|AC005155.1|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p1... 50 0.006
193dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
194gb|AY953319.1| Homo sapiens aquaporin 1 (channel-forming integra... 50 0.006
195gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 50 0.006
196gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 50 0.006
197gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete... 50 0.006
198dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 50 0.006
199dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo... 50 0.006
200dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 50 0.006
201dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 50 0.006
202gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 48 0.024
203ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA 48 0.024
204gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:56... 48 0.024
205gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 48 0.024
206gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 48 0.024
207emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 48 0.024
208gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic prot... 48 0.024
209dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highl... 48 0.024
210dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 48 0.024
211gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 48 0.024
212dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.024
213dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 48 0.024
214dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.024
215dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 48 0.024
216dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.024
217dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 48 0.024
218dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 48 0.024
219gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ... 48 0.024
220gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, comp... 48 0.024
221ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 46 0.095
222ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channe... 46 0.095
223gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 46 0.095
224gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds 46 0.095
225emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral mem... 46 0.095
226emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 46 0.095
227emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 46 0.095
228emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 46 0.095
229emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 46 0.095
230emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 46 0.095
231emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral pr... 46 0.095
232emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA 46 0.095
233emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 46 0.095
234emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 46 0.095
235emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 46 0.095
236emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquopo... 46 0.095
237ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA 46 0.095
238gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.095
239gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 46 0.095
240gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 46 0.095
241gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 46 0.095
242emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 46 0.095
243gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds 46 0.095
244ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA 46 0.095
245gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete s... 46 0.095
246gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, comp... 46 0.095
247gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.095
248gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone M... 46 0.095
249gb|U60148.1|BVU60148 Beta vulgaris plasma membrane major intrins... 46 0.095
250gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) ... 46 0.095
251ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 44 0.37
252ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 44 0.37
253gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 44 0.37
254gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.37
255gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.37
256gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 44 0.37
257emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 44 0.37
258emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 44 0.37
259gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 44 0.37
260gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 44 0.37
261gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 44 0.37
262ref|NM_176253.1| Drosophila melanogaster CG17664-RB, transcript ... 44 0.37
263ref|NM_137967.2| Drosophila melanogaster CG17664-RA, transcript ... 44 0.37
264gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 44 0.37
265gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 44 0.37
266gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein ... 44 0.37
267gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 44 0.37
268gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 44 0.37
269gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 44 0.37
270gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 44 0.37
271gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 44 0.37
272gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r... 44 0.37
273emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 44 0.37
274emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 44 0.37
275dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane in... 44 0.37
276gb|AY069151.1| Drosophila melanogaster GH16993 full insert cDNA 44 0.37
277gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 44 0.37
278dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.37
279dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 44 0.37
280dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.37
281dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.37
282gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 44 0.37
283gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds 44 0.37
284dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 44 0.37
285emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA... 44 0.37
286gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 44 0.37
287gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 44 0.37
288gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 44 0.37
289dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 44 0.37
290ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 42 1.5
291gb|AC116395.21| Mus musculus chromosome 14, clone RP23-106K9, co... 42 1.5
292emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel p... 42 1.5
293emb|AL139041.17| Human DNA sequence from clone RP11-408O19 on ch... 42 1.5
294emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.5
295emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.5
296emb|BX004993.16| Zebrafish DNA sequence from clone CH211-163C2 i... 42 1.5
297dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.5
298gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 42 1.5
299gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 42 1.5
300gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 42 1.5
301emb|BX323881.7| Zebrafish DNA sequence from clone CH211-274G13 i... 42 1.5
302gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 42 1.5
303dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
304dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
305dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
306dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
307gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 42 1.5
308dbj|AB024534.1| Rattus norvegicus gene for thiazide-sensitive Na... 42 1.5
309ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 40 5.8
310gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 40 5.8
311emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chr... 40 5.8
312emb|Z82265.1|CEF02H6 Caenorhabditis elegans Cosmid F02H6, comple... 40 5.8
313gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 40 5.8
314emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein 40 5.8
315emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 40 5.8
316emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 40 5.8
317emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 40 5.8
318emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 40 5.8
319tpg|BK003523.1| TPA: TPA_inf: Drosophila melanogaster HDC02994 (... 40 5.8
320gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 40 5.8
321gb|AC092643.2| Homo sapiens BAC clone RP11-393P9 from 4, complet... 40 5.8
322gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 40 5.8
323gb|AC160646.2| Gallus gallus BAC clone CH261-24P2 from chromosom... 40 5.8
324gb|AC009202.7| Drosophila melanogaster, chromosome 2L, region 36... 40 5.8
325emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 40 5.8
326emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 40 5.8
327emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 40 5.8
328gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 40 5.8
329gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 40 5.8
330dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 5.8
331emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 40 5.8
332emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 40 5.8
333gb|AC115004.14| Mus musculus chromosome 3, clone RP24-182K13, co... 40 5.8
334dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
335dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
336gb|AC011662.1|AC011662 Drosophila melanogaster, chromosome 2L, r... 40 5.8
337dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
338gb|AE003656.2| Drosophila melanogaster chromosome 2L, section 65... 40 5.8
339dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 40 5.8
340emb|AL732627.14| Mouse DNA sequence from clone RP23-183L6 on chr... 40 5.8
341gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 40 5.8
342gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 40 5.8
343gb|AC164108.2| Mus musculus BAC clone RP24-96K15 from chromosome... 40 5.8
344dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 40 5.8

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds
          Length = 1343

 Score =  825 bits (416), Expect = 0.0
 Identities = 432/436 (99%), Gaps = 1/436 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acgtacacattgcatttcaaatttcccccc-aagttacctggatgcgtacatgacatgac 59
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1214 acgtacacattgcatttcaaatttcccccccaagttacctggatgcgtacatgacatgac 1155

                                                                        
Query: 60   agtacatcatcctcatcattcataaacattacatggaagcaaacactgactgacgaagac 119
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 agtacatcatcctcatcattcataaacattacatggaagcaaacactgactgacgaagac 1095

                                                                        
Query: 120  acactcgatcggtagagaaaacaagcagcaagcgcgggcggcgagccgaggaaagcagag 179
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 1094 acactcgatcggtagagaaaacaagcagcaagcgcgggcggcgagcagaggaaagcagag 1035

                                                                        
Query: 180  gcgcgcgcaaagaccagcagaatccagggaccccaacggaggcccctctgtcctctgcca 239
             |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1034 acgcgcgcaaagaccagcagaatccagggacccgaacggaggcccctctgtcctctgcca 975

                                                                        
Query: 240  tatctacagttcatacgcctccgaccatctagcggctgccgaaggaggcagacgagccga 299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 974  tatctacagttcatacgcctccgaccatctagcggctgccgaaggaggcagacgagccga 915

                                                                        
Query: 300  acttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccga 359
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  acttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccga 855

                                                                        
Query: 360  tgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatca 419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 854  tgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatca 795

                            
Query: 420  cggcagctccgaagct 435
            ||||||||||||||||
Sbjct: 794  cggcagctccgaagct 779



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  190 bits (96), Expect = 3e-45
 Identities = 141/156 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 339
           ||||||||||||||| || | ||||| |||||||||||||||||||||||||||||||  
Sbjct: 852 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 793

                                                                       
Query: 340 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
            |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 792 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 733

                                               
Query: 400 cttctcgttgttgtagatcacggcagctccgaagct 435
           ||| |||||||||||||| || ||||| || |||||
Sbjct: 732 cttgtcgttgttgtagatgacagcagcgcccaagct 697



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  190 bits (96), Expect = 3e-45
 Identities = 141/156 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 339
           ||||||||||||||| || | ||||| |||||||||||||||||||||||||||||||  
Sbjct: 907 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 848

                                                                       
Query: 340 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
            |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 847 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 788

                                               
Query: 400 cttctcgttgttgtagatcacggcagctccgaagct 435
           ||| |||||||||||||| || ||||| || |||||
Sbjct: 787 cttgtcgttgttgtagatgacagcagcgcccaagct 752



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  151 bits (76), Expect = 2e-33
 Identities = 124/140 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 886 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 827

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| |  |||||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 826 ccgatcagcggccccacccagaagatccattggtcatcccaggccttgtctttgttgtag 767

                               
Query: 416 atcacggcagctccgaagct 435
           || || |||||||| |||||
Sbjct: 766 atgacagcagctcccaagct 747



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  143 bits (72), Expect = 5e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 280 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 339
           ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 864 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 805

                                                                       
Query: 340 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
           ||||||||||||||| |||||||  |||||||||||||| ||||||||||||| ||| ||
Sbjct: 804 ggcggcgatggcggcgccgatgaggggccccacccagaagatccagtggtcatgccatgc 745

                                               
Query: 400 cttctcgttgttgtagatcacggcagctccgaagct 435
           ||| |  | |||||||||||| |||||||| |||||
Sbjct: 744 cttgtgctggttgtagatcaccgcagctcccaagct 709



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  135 bits (68), Expect = 1e-28
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||||||||||||| ||||||||||||||||||||   ||||||||||||||| 
Sbjct: 922 ccgagcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcg 863

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 862 ccgatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 803

                               
Query: 416 atcacggcagctccgaagct 435
           || || || ||||| |||||
Sbjct: 802 atgaccgcggctcccaagct 783



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  135 bits (68), Expect = 1e-28
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||| |||||||||||||||||| |||||||||||   |||||| |||||||| 
Sbjct: 974 ccgagcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcg 915

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| | ||||||||||||||| ||||| ||||||||||||||||| ||  ||||||||
Sbjct: 914 ccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtag 855

                               
Query: 416 atcacggcagctccgaagct 435
           || || |||||||| |||||
Sbjct: 854 atgacagcagctcccaagct 835



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  135 bits (68), Expect = 1e-28
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||||||||||||| ||||||||||||||||||||   ||||||||||||||| 
Sbjct: 350 ccgagcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcg 291

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 290 ccgatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 231

                               
Query: 416 atcacggcagctccgaagct 435
           || || || ||||| |||||
Sbjct: 230 atgaccgcggctcccaagct 211



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 325  gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
            |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 1594 gtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatcca 1535

                                            
Query: 385  gtggtcatcccaggccttctcgttgttgtaga 416
            |||||||||||| | ||| || ||||||||||
Sbjct: 1534 gtggtcatcccatggcttgtccttgttgtaga 1503



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  135 bits (68), Expect = 1e-28
 Identities = 122/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||| |||||||||||||||||| |||||||||||   |||||| |||||||| 
Sbjct: 894 ccgagcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcg 835

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| | ||||||||||||||| ||||| ||||||||||||||||| ||  ||||||||
Sbjct: 834 ccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtag 775

                               
Query: 416 atcacggcagctccgaagct 435
           || || |||||||| |||||
Sbjct: 774 atgacagcagctcccaagct 755



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 912 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 853

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| |  || ||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 852 ccgatcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtag 793

             
Query: 416 at 417
           ||
Sbjct: 792 at 791



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||||||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 940 ccgagcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 881

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           || || | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 880 ccaatcagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 821

             
Query: 416 at 417
           ||
Sbjct: 820 at 819



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||||||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 932 ccgagcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 873

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           || || | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 872 ccaatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 813

             
Query: 416 at 417
           ||
Sbjct: 812 at 811



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 912 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 853

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||| |  || ||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 852 ccgatcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtag 793

             
Query: 416 at 417
           ||
Sbjct: 792 at 791



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 326 tactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccag 385
           ||||||||||| || || || ||||| || || |||||||| || |||||||||||||| 
Sbjct: 813 tactggtggtagaatgcagcaatggcagctccaatgaatggtccgacccagaacatccaa 754

                                                             
Query: 386 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
           ||||||||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 753 tggtcatcccaggccttgtcgttgttatagatgacagcagctccgaagct 704



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                            
Query: 280      gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 339
                ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 26074856 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 26074797

                                                             
Query: 340      ggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
                ||||||||||||||| |||||||  |||||||||||||| |||||
Sbjct: 26074796 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                          
Query: 280    gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 339
              ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 109183 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 109124

                                                           
Query: 340    ggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
              ||||||||||||||| |||||||  |||||||||||||| |||||
Sbjct: 109123 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| | |||||||||||| ||||| ||||| || || |||||||| ||||| || 
Sbjct: 884 tggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatccactga 825

                                                 
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagc 426
           |||||||||||||| | ||||||||||||||| |||||
Sbjct: 824 tcatcccaggccttgttgttgttgtagatcacagcagc 787



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                
Query: 431 aagct 435
           |||||
Sbjct: 740 aagct 736



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                
Query: 431 aagct 435
           |||||
Sbjct: 740 aagct 736



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                            
Query: 296      ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
                |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 25184693 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 25184634

                                             
Query: 356      ccgatgaatggccccacccagaacatcca 384
                ||||| |  || ||||||||||| |||||
Sbjct: 25184633 ccgatcagggggcccacccagaagatcca 25184605



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 386      tggtcatcccaggccttctcgttgttgtagat 417
                ||||||||||||||||| || |||||||||||
Sbjct: 25184041 tggtcatcccaggccttgtccttgttgtagat 25184010



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                         
Query: 296   ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 355
             |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 85086 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 85027

                                          
Query: 356   ccgatgaatggccccacccagaacatcca 384
             ||||| |  || ||||||||||| |||||
Sbjct: 85026 ccgatcagggggcccacccagaagatcca 84998



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 386   tggtcatcccaggccttctcgttgttgtagat 417
             ||||||||||||||||| || |||||||||||
Sbjct: 84434 tggtcatcccaggccttgtccttgttgtagat 84403



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 412
           ||||| |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||
Sbjct: 856 gccccaatgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttg 797

                               
Query: 413 tagatcacggcagctccgaa 432
           ||||||||||||||||||||
Sbjct: 796 tagatcacggcagctccgaa 777



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 412
           ||||| |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||
Sbjct: 372 gccccaatgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttg 313

                               
Query: 413 tagatcacggcagctccgaa 432
           ||||||||||||||||||||
Sbjct: 312 tagatcacggcagctccgaa 293



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| || || || ||||| ||||| |||||||| ||||||||||| ||||| |
Sbjct: 858 actggtggtagaatgctgctatggctgccccaatgaatggtcccacccagaagatccaat 799

                                                        
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
           ||||||||||||| ||||  | |||| |||| || ||||||||||
Sbjct: 798 ggtcatcccaggctttctgttggttgaagataacagcagctccga 754



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 868 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 809

                                                   
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagc 426
           ||||||||||||||||||| ||||||||||| || |||||
Sbjct: 808 ggtcatcccaggccttctcattgttgtagataacagcagc 769



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 864 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 805

                                                   
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagc 426
           ||||||||||||||||||| ||||||||||| || |||||
Sbjct: 804 ggtcatcccaggccttctcattgttgtagataacagcagc 765



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 418 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 359

                                                   
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagc 426
           ||||||||||||||||||| ||||||||||| || |||||
Sbjct: 358 ggtcatcccaggccttctcattgttgtagataacagcagc 319



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 820



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 928 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 869

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 868 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 822



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 929 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 870

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 869 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 823



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 872 gtactggtggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatcca 813

                                                  
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggc 423
           |||||| ||||||| ||| || ||||||||||| |||||
Sbjct: 812 gtggtcgtcccagggcttgtccttgttgtagatgacggc 774



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 820 gtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatcca 761

                                                  
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggc 423
           |||||| ||||||| ||| || ||||||||||| |||||
Sbjct: 760 gtggtcgtcccagggcttgtccttgttgtagatgacggc 722



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                       
Query: 317 ctcagcacgtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccag 376
           ||||| ||||| ||||| || || || || || |||||||| ||||| ||||| ||||||
Sbjct: 860 ctcaggacgtattggtgatataaagcagcaattgcggccccaatgaaaggcccgacccag 801

                                                                      
Query: 377 aacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
           || ||||| ||||||||||| ||||| || | |||||| ||||| |||||||| |||||
Sbjct: 800 aagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagctccaaagct 742



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 891 gtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatcca 832

                                                  
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggc 423
           |||||| ||||||| ||| || ||||||||||| |||||
Sbjct: 831 gtggtcgtcccagggcttgtccttgttgtagatgacggc 793



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 492 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 433

                                                  
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggc 423
            ||||  | ||||||||||||||||||| |||| |||||
Sbjct: 432 ttggttgtgccaggccttctcgttgttgaagatgacggc 394



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 360
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 917 cttgatggcgccggccctgaggatgtactggtggtagaaggccgcgatcgccgcgccgat 858

                                                                       
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 420
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 857 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 798

              
Query: 421 ggc 423
           |||
Sbjct: 797 ggc 795



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 820



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 520 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 461

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 460 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 414



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 820



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 928 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 869

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 868 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 822



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 929 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 870

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 869 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 823



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 916 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 857

                                                          
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccga 431
            ||||  | ||| ||||||||||||||| |||| ||||| |||||||
Sbjct: 856 atggttgtgccacgccttctcgttgttgaagatgacggccgctccga 810



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           ||||||| || || || ||||||||||| || |||||||| ||||||||||| |||||||
Sbjct: 832 actggtgataaaatgcagcgatggcggctccaatgaatggtcccacccagaatatccagt 773

                     
Query: 387 ggtcatccca 396
           ||||||||||
Sbjct: 772 ggtcatccca 763



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||||||||| || ||||| || || || ||||| || | |||||| ||||| |||
Sbjct: 812 tggtggtacaaggcagcaatggcagctccaataaatggtccaagccagaagatccattgg 753

                                                    
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           |||||||| || || || |||||||||||||| ||||||||
Sbjct: 752 tcatcccaagctttgtccttgttgtagatcacagcagctcc 712



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           |||||||| ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681

                
Query: 431 aagct 435
           |||||
Sbjct: 680 aagct 676



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||| ||||||||| |||||||| ||||| ||||||||||| || ||  |||||||| ||
Sbjct: 516 ccgaggaatggcccaacccagaaaatccaatggtcatcccaagcttttccgttgttgaag 457

                               
Query: 416 atcacggcagctccgaagct 435
           |||||||| || ||||||||
Sbjct: 456 atcacggcggcgccgaagct 437



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 944 gtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatcca 885

                                           
Query: 385 gtggtcatcccaggccttctcgttgttgtaga 416
           |||||||||||| | ||| || ||||||||||
Sbjct: 884 gtggtcatcccatggcttgtccttgttgtaga 853



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 827 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 769

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 768 tacggcagctccgaa 754



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 753 tacggcagctccgaa 739



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 753 tacggcagctccgaa 739



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 803 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 745

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 744 tacggcagctccgaa 730



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 753 tacggcagctccgaa 739



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 753 tacggcagctccgaa 739



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 504 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 446

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 445 tacggcagctccgaa 431



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 813 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 755

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 754 tacggcagctccgaa 740



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 67/75 (89%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 828 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 770

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 769 tacggcagctccgaa 755



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| || || || ||||| || || |||||||| ||||||||||| ||||| |
Sbjct: 897 actggtggtagaatgctgctatggctgcaccaatgaatggtcccacccagaagatccaat 838

                                                         
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaa 432
           | | ||||||||| ||||  | |||| ||||||| |||||||||||
Sbjct: 837 gtttatcccaggctttctgttggttgaagatcacagcagctccgaa 792



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                
Query: 431 aagct 435
           |||||
Sbjct: 726 aagct 722



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                
Query: 431 aagct 435
           |||||
Sbjct: 748 aagct 744



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||||||||| |||||||| |||||||| |||||||| ||||| |||  |||| | 
Sbjct: 840 ccgatgaatggcccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaa 781

                            
Query: 416 atcacggcagctccgaa 432
           |||||||| || |||||
Sbjct: 780 atcacggccgccccgaa 764



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagataacagcagcacca 104

                
Query: 431 aagct 435
           |||||
Sbjct: 103 aagct 99



to top

>gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquaporin mRNA, partial
           cds
          Length = 607

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| ||||| || ||||| ||||| |||||||| || ||||| || ||||| |||
Sbjct: 196 tggtggtagaaggctgcaatggctgccccaatgaatggtcctacccaaaagatccaatgg 137

                                                    
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           |||||||||| ||| || | |||| |||| || ||||||||
Sbjct: 136 tcatcccagggcttgtcttggttgaagataacagcagctcc 96



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 678

                
Query: 431 aagct 435
           |||||
Sbjct: 677 aagct 673



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                
Query: 431 aagct 435
           |||||
Sbjct: 724 aagct 720



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                
Query: 431 aagct 435
           |||||
Sbjct: 726 aagct 722



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 706

                
Query: 431 aagct 435
           |||||
Sbjct: 705 aagct 701



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 718

                
Query: 431 aagct 435
           |||||
Sbjct: 717 aagct 713



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 716

                
Query: 431 aagct 435
           |||||
Sbjct: 715 aagct 711



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 715

                
Query: 431 aagct 435
           |||||
Sbjct: 714 aagct 710



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 710

                
Query: 431 aagct 435
           |||||
Sbjct: 709 aagct 705



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                
Query: 431 aagct 435
           |||||
Sbjct: 726 aagct 722



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                
Query: 431 aagct 435
           |||||
Sbjct: 748 aagct 744



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 417

                
Query: 431 aagct 435
           |||||
Sbjct: 416 aagct 412



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                
Query: 431 aagct 435
           |||||
Sbjct: 724 aagct 720



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatccca 396
           ||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 804 ccgatgaatggtcccacccagaaaatccagtggtcatccca 764



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| ||||| || || || || || ||||| || || |||||||| ||||| |||
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                    
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           |||||||| ||||| || ||||||||||| || ||||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctcc 774



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 758 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 699

                   
Query: 416 atcacggc 423
           || |||||
Sbjct: 698 atgacggc 691



to top

>ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC463330), mRNA
          Length = 1185

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 354  ccccgatgaatggccccacccagaacatccagtggt 389
            ||||||||||||||||||||||||| ||||||||||
Sbjct: 1033 ccccgatgaatggccccacccagaaaatccagtggt 998



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           |||||||||||  || ||||| || || |||||||| ||||| |||||||| ||||| ||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                               
Query: 388 gtcatcccaggccttctcgttgttgtagatcacggc 423
            |||  ||||||||| | ||||||||||| ||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggc 806



to top

>ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 2764

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 334

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 95  ccccgatgaatggccccacccagaaaatccagtggt 60



to top

>gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 472

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 95  ccccgatgaatggccccacccagaaaatccagtggt 60



to top

>gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mRNA (cDNA clone
           MGC:26324 IMAGE:4799283), complete cds
          Length = 2764

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from clone DKFZp469G0320)
          Length = 2784

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 382 ccagtggtcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           ||||||||| ||||||||||| || |||||||||||||| ||||||||
Sbjct: 495 ccagtggtcgtcccaggccttgtcattgttgtagatcactgcagctcc 448



to top

>emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 2469

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 704 ccccgatgaatggccccacccagaaaatccagtggt 669



to top

>gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds
          Length = 810

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 646 ccccgatgaatggccccacccagaaaatccagtggt 611



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 350 gcggccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttg 409
           |||||||| |||||||| ||||||||||| ||||||||||| ||||| || |  || |||
Sbjct: 831 gcggccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttg 772

                   
Query: 410 ttgtagat 417
           ||||||||
Sbjct: 771 ttgtagat 764



to top

>gb|U41518.1|HSU41518 Human channel-like integral membrane protein (AQP-1) mRNA, clone
           AQP-1-2344, partial cds
          Length = 2344

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 309 ccccgatgaatggccccacccagaaaatccagtggt 274



to top

>gb|S73482.1| uterine water channel=28 kda erythrocyte integral membrane protein
           homolog [human, uterus, mRNA, 1340 nt]
          Length = 1340

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 696 ccccgatgaatggccccacccagaaaatccagtggt 661



to top

>gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds
          Length = 459

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 362 ccccgatgaatggccccacccagaaaatccagtggt 327



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 744 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 685

                   
Query: 416 atcacggc 423
           || |||||
Sbjct: 684 atgacggc 677



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 857 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 798

                   
Query: 416 atcacggc 423
           || |||||
Sbjct: 797 atgacggc 790



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           |||||||||||  || ||||| || || |||||||| ||||| |||||||| ||||| ||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                               
Query: 388 gtcatcccaggccttctcgttgttgtagatcacggc 423
            |||  ||||||||| | ||||||||||| ||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggc 806



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 851 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 792

                   
Query: 416 atcacggc 423
           || |||||
Sbjct: 791 atgacggc 784



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 845 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 786

                   
Query: 416 atcacggc 423
           || |||||
Sbjct: 785 atgacggc 778



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| || ||||| ||||| || || |  ||||| || |||||||| ||||| |||
Sbjct: 788 tggtggtagaatgcggcaatggcagcaccaacaaatggtccaacccagaagatccactgg 729

                                                       
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctccgaa 432
           |||||||| ||||| || |||||||| || || |||||||||||
Sbjct: 728 tcatcccatgccttgtccttgttgtaaattacagcagctccgaa 685



to top

>gb|U41517.1|HSU41517 Human channel-like integral membrane protein (AQP-1) mRNA, clone
           AQP-1-1656, complete cds
          Length = 1657

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 691 ccccgatgaatggccccacccagaaaatccagtggt 656



to top

>gb|M77829.1|HUMCHIP28A Human channel-like integral membrane protein (CHIP28) mRNA,
           complete cds
          Length = 1340

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 696 ccccgatgaatggccccacccagaaaatccagtggt 661



to top

>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A)
            transcript variant AT3G53420.1 mRNA, complete cds
          Length = 1347

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                        
Query: 359  atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
            |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 1029 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 971

                           
Query: 418  cacggcagctccgaa 432
             ||||||||||||||
Sbjct: 970  tacggcagctccgaa 956



to top

>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant
           AT3G53420.2 mRNA, complete cds
          Length = 1278

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 979 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 921

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 920 tacggcagctccgaa 906



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||||||||| ||||  || |||||||||||
Sbjct: 827 atgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgttgtagat 769



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
           ||||||||| || || || || || ||||| || ||||| || || |||||||| |||||
Sbjct: 935 gtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatcca 876

                                                              
Query: 385 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
            ||||||||||| ||||| || |||   |||||||| ||||||||||||||
Sbjct: 875 ttggtcatcccatgccttatccttgccatagatcacagcagctccgaagct 825



to top

>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a
          Length = 1112

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 809 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 751

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 750 tacggcagctccgaa 736



to top

>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (At3g53420) mRNA, complete cds
          Length = 1122

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 821 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 763

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 762 tacggcagctccgaa 748



to top

>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1112

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 829 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 771

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 770 tacggcagctccgaa 756



to top

>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 864

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 770 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 712

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 711 tacggcagctccgaa 697



to top

>dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane intrinsic protein 2a,
           partial cds, clone: RAFL22-59-G07
          Length = 420

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 111 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 53

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 52  tacggcagctccgaa 38



to top

>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (F4P12.12) mRNA, complete cds
          Length = 956

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 770 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 712

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 711 tacggcagctccgaa 697



to top

>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1129

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 829 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 771

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 770 tacggcagctccgaa 756



to top

>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 812 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 754

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 753 tacggcagctccgaa 739



to top

>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1035

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 809 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 751

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 750 tacggcagctccgaa 736



to top

>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 817 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 759

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 758 tacggcagctccgaa 744



to top

>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZB11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
           |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 813 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 755

                          
Query: 418 cacggcagctccgaa 432
            ||||||||||||||
Sbjct: 754 tacggcagctccgaa 740



to top

>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence
          Length = 1352

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 66/75 (88%), Gaps = 2/75 (2%)
 Strand = Plus / Minus

                                                                        
Query: 359  atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 417
            |||||||| || ||||| || ||||||||||||||||| ||| | ||| |||||||||||
Sbjct: 1031 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 973

                           
Query: 418  cacggcagctccgaa 432
             ||||||||||||||
Sbjct: 972  tacggcagctccgaa 958



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 386 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaa 432
           ||||||||||| |||||||| ||||||||||| || |||||||||||
Sbjct: 431 tggtcatcccatgccttctccttgttgtagattacagcagctccgaa 385



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 764 atgaatggtcccacccagaatatccagtggtcatccca 727



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 779 atgaatggtcccacccagaatatccagtggtcatccca 742



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 386    tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
              ||||||||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 164524 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagct 164475



to top

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 386   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
             ||||||||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 34602 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagct 34553



to top

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 386   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
             ||||||||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 65557 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagct 65508



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 814 atgaatggtcccacccagaatatccagtggtcatccca 777



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 412
           ||||| ||||| || || |||||||| |||||||||||||||||||| | ||  ||||||
Sbjct: 896 gccccaatgaacggtccaacccagaatatccagtggtcatcccaggcatgcttcttgttg 837

                         
Query: 413 tagatcacggcagc 426
           ||||| | ||||||
Sbjct: 836 tagatgatggcagc 823



to top

>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24
          Length = 77999

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 386   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
             ||||| ||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 19103 tggtcgtcccaggccttttcgttgttgtaaataacggcagctccaaagct 19152



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| || ||||||||||| ||||||||||| ||||| |||| ||  |||||||||
Sbjct: 889 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 830

             
Query: 416 at 417
           ||
Sbjct: 829 at 828



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 783 atggcagctccga 771



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 412
           ||||| ||||| || || |||||||| |||||||| |||||||| ||||| || ||||||
Sbjct: 817 gccccaatgaacggtccaacccagaatatccagtgatcatcccatgccttgtctttgttg 758

                
Query: 413 tagat 417
           |||||
Sbjct: 757 tagat 753



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatccca 396
           |||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 122 ccgatgaatggcccaacccagaaaatccaatggtcatccca 82



to top

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||| ||| ||||| || |||  |||||| 
Sbjct: 850 atgaatggtccaacccagaaaatccattggtcattccatgccttgtccttgccgtagatg 791

                            
Query: 419 acggcagctccgaagct 435
           || ||||||||||||||
Sbjct: 790 acagcagctccgaagct 774



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||||||||| |||||||| |||||||| || ||||| ||||| |||  |||| | 
Sbjct: 806 ccgatgaatggcccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaa 747

                            
Query: 416 atcacggcagctccgaa 432
           |||||||| || |||||
Sbjct: 746 atcacggccgccccgaa 730



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggc 399
           |||||||| || |||||||| ||||||||||||||||||||
Sbjct: 782 atgaatggtccaacccagaagatccagtggtcatcccaggc 742



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 794 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 735

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 734 atggcagctccga 722



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 783 atggcagctccga 771



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 99  atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 40

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 39  atggcagctccga 27



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           ||||||||||| || ||||  || || |||||||| || ||||||||||| ||||| || 
Sbjct: 500 tggtggtacaaagctgcgagagctgcaccgatgaagggtcccacccagaatatccaatgt 441

                                        
Query: 389 tcatcccaggccttctcgttgttgtagat 417
           ||||||||||| |  || |||||||||||
Sbjct: 440 tcatcccaggcttgatccttgttgtagat 412



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           ||||||||||| || ||||  || || |||||||| || ||||||||||| ||||| || 
Sbjct: 830 tggtggtacaaagctgcgagagctgcaccgatgaagggtcccacccagaatatccaatgt 771

                                        
Query: 389 tcatcccaggccttctcgttgttgtagat 417
           ||||||||||| |  || |||||||||||
Sbjct: 770 tcatcccaggcttgatccttgttgtagat 742



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 167 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 108

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 107 atggcagctccga 95



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 426 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 367

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 366 atggcagctccga 354



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 772 atggcagctccga 760



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 807 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 748

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 747 atggcagctccga 735



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 362 aatggccccacccagaacatccagtggtcatcccaggcctt 402
           ||||||||||||||||| ||||| ||||||||||| |||||
Sbjct: 795 aatggccccacccagaagatccaatggtcatcccaagcctt 755



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           |||||||| ||||| || |||||||| || || || ||||||||||| ||||| ||||||
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                
Query: 431 aagct 435
           |||||
Sbjct: 686 aagct 682



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 418
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 841 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 782

                        
Query: 419 acggcagctccga 431
           | |||||||||||
Sbjct: 781 atggcagctccga 769



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| ||||| || ||||| || || || ||||| || ||||| || ||||| |||
Sbjct: 890 tggtggtagaaggctgcaatggctgctccaataaatggtccaacccaaaagatccaatgg 831

                                                    
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           ||||||||||||||||  | |||||| || || ||||||||
Sbjct: 830 tcatcccaggccttctgttggttgtacatgacagcagctcc 790



to top

>gb|AY856055.1| Notomys alexis aquaporin 1 mRNA, partial cds
          Length = 654

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| |||||||||||||||||||| ||||||||||
Sbjct: 541 ccccaatgaatggccccacccagaaaatccagtggt 506



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 851 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 792

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 791 gcagctcc 784



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 846 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 787

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 786 gcagctcc 779



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 764 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 705

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 704 gcagctcc 697



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 848 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 789

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 788 gcagctcc 781



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 825 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 766

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 765 gcagctcc 758



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 835 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 776

                   
Query: 422 gcagctcc 429
           ||||||||
Sbjct: 775 gcagctcc 768



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 420
           |||||| || ||||| || ||||| ||||||||||||| ||| || | ||||||||| ||
Sbjct: 853 gaatggtccaacccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794

                          
Query: 421 ggcagctccgaagct 435
            |||||||| |||||
Sbjct: 793 agcagctccaaagct 779



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence
          Length = 1084

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggcct 401
           |||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 831 atgaatggtccaacccagaaaatccagtggtcatcccatgcct 789



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggcct 401
           |||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 875 atgaatggtccaacccagaagatccagtggtcatcccatgcct 833



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
           ||||| ||||| || || |||||||| ||||||||||||||||||||
Sbjct: 892 gccccaatgaacggtccaacccagaatatccagtggtcatcccaggc 846



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||||| ||| ||||  || |||||||||||
Sbjct: 837 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagat 779



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| |||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||||| ||| ||||  || |||||||||||
Sbjct: 827 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagat 769



to top

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| || |||||||| |||||||||||||||||
Sbjct: 103 atgaatggtccaacccagaagatccagtggtcatccca 66



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           |||||||| |||||||| ||||| || ||||||||||| || || |||||| |||| || 
Sbjct: 835 aatggcccaacccagaaaatccaatgatcatcccaggctttttcattgttgaagatgaca 776

                         
Query: 422 gcagctccgaagct 435
           ||||| || |||||
Sbjct: 775 gcagcgccaaagct 762



to top

>gb|AC148995.2| Medicago truncatula chromosome 7 BAC clone mth2-49l23, complete
             sequence
          Length = 128239

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 386   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
             ||||||||||| || ||||| |||||||| ||||| |||||||| |||||
Sbjct: 91309 tggtcatcccatgctttctcattgttgtaaatcacagcagctccaaagct 91260



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| | |||||||  |  ||| |||||||| || ||||||||||| |||||||
Sbjct: 851 actggtggtagacggcggcggcgaaggctccgatgaagggacccacccagaaaatccagt 792

                     
Query: 387 ggtcatccca 396
           | ||||||||
Sbjct: 791 gttcatccca 782



to top

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 359 atgaatggccccacccagaacatccagtggtcatccca 396
           |||||||| || |||||||| |||||||||||||||||
Sbjct: 789 atgaatggtccaacccagaatatccagtggtcatccca 752



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccag 397
           ||||||||||| ||||||||||| |||||||| || ||||||
Sbjct: 837 ccgatgaatggtcccacccagaagatccagtgatcgtcccag 796



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           |||||||| || || |||||||| ||||||||||| ||||| |||| ||  |||||||||
Sbjct: 874 ccgatgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 815

             
Query: 416 at 417
           ||
Sbjct: 814 at 813



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 353  gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 412
            ||||| ||||| || || |||||||| | |||||||||||||||||| | ||  ||||||
Sbjct: 1033 gccccaatgaacggtccaacccagaaaacccagtggtcatcccaggcatgctgcttgttg 974

                          
Query: 413  tagatcacggcagc 426
            ||||| | ||||||
Sbjct: 973  tagatgatggcagc 960



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 798 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 739

                                        
Query: 388 gtcatcccaggccttctcgttgttgtaga 416
            |||  ||| |||||   |||||||||||
Sbjct: 738 atcactccatgccttgctgttgttgtaga 710



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 356 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 297

                                        
Query: 388 gtcatcccaggccttctcgttgttgtaga 416
            |||  ||| |||||   |||||||||||
Sbjct: 296 atcactccatgccttgctgttgttgtaga 268



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 354 ccccgatgaatggccccacccagaacatccagtggtc 390
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 695 ccccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|AC146187.2| Pan troglodytes BAC clone RP43-25A10 from 7, complete sequence
          Length = 156796

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 354   ccccgatgaatggccccacccagaa 378
             |||||||||||||||||||||||||
Sbjct: 53287 ccccgatgaatggccccacccagaa 53311



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 354 ccccgatgaatggccccacccagaacatccagtggtc 390
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 695 ccccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggc 399
           ||||| || |||||||| || ||||||||||||||||||||
Sbjct: 452 atgaaaggtcccacccaaaagatccagtggtcatcccaggc 412



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                       
Query: 327 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 386
           |||||||||| ||||| || ||||  || || ||||| || ||| ||||||| ||||| |
Sbjct: 526 actggtggtagaaggccgcaatgggtgctccaatgaacggtcccccccagaaaatccact 467

                                                            
Query: 387 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 435
           | |||||||| | ||| |  |||||||||||||| || ||||| |||||
Sbjct: 466 gatcatcccatgtcttttttttgttgtagatcacagcggctcccaagct 418



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 328      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
                |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 15324447 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 15324391



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 328      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
                |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 15316478



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                            
Query: 325      gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
                |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 15355800 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 15355741



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 398      gccttctcgttgttgtagatcacggcagctccga 431
                ||||||||||||||| |||| ||||| |||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccga 15355570



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 328      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
                |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 15306442



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| | ||| || ||||| || || ||||| || |||||||| || |||||||||
Sbjct: 837 tggtggtaaatggcagctatggcagcaccaatgaaaggtcccacccaaaagatccagtgg 778

                        
Query: 389 tcatcccaggcct 401
           |||||||| ||||
Sbjct: 777 tcatcccatgcct 765



to top

>gb|AC092408.3| Papio anubis clone RP41-446H8, complete sequence
          Length = 184036

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 354    ccccgatgaatggccccacccagaa 378
              |||||||||||||||||||||||||
Sbjct: 176368 ccccgatgaatggccccacccagaa 176344



to top

>gb|AC091620.3| Papio anubis clone RP41-400H11, complete sequence
          Length = 119638

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 354  ccccgatgaatggccccacccagaa 378
            |||||||||||||||||||||||||
Sbjct: 3524 ccccgatgaatggccccacccagaa 3500



to top

>gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-1 mRNA, partial cds
          Length = 477

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 354 ccccgatgaatggccccacccagaacatccagtggtc 390
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 343 ccccgatgaacggcccgacccagaaaatccagtggtc 307



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 328   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
             |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 31446 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 31390



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 328   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
             |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 23477



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 325   gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
             |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 62799 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 62740



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 398   gccttctcgttgttgtagatcacggcagctccga 431
             ||||||||||||||| |||| ||||| |||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccga 62569



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 328   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
             |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 13441



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328    ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
              |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 110460 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 110404



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328    ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
              |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 102491



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 328   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 384
             |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 92455



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           |||||||| ||||| |||||||||||  | || || ||||||||||| || |||||||| 
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgacagcagctcca 760

                
Query: 431 aagct 435
           |||||
Sbjct: 759 aagct 755



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcatcccag 397
           ||||| |||||||| ||||||||||| ||||| || |||||||||
Sbjct: 886 gccccaatgaatggacccacccagaaaatccaatgatcatcccag 842



to top

>gb|AC005155.1|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p14-p15, complete sequence
          Length = 127282

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 354   ccccgatgaatggccccacccagaa 378
             |||||||||||||||||||||||||
Sbjct: 10081 ccccgatgaatggccccacccagaa 10057



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 355 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 296

                                        
Query: 388 gtcatcccaggccttctcgttgttgtaga 416
            |||  ||| |||||   |||||||||||
Sbjct: 295 atcactccatgccttgctgttgttgtaga 267



to top

>gb|AY953319.1| Homo sapiens aquaporin 1 (channel-forming integral protein, 28kDa)
             (AQP1) gene, complete cds
          Length = 17649

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 354   ccccgatgaatggccccacccagaa 378
             |||||||||||||||||||||||||
Sbjct: 13587 ccccgatgaatggccccacccagaa 13563



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 430
           ||||| || ||||| || ||||||||||||||    ||||||||||| || |||||||||
Sbjct: 813 acccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagctccg 754

                
Query: 431 aagct 435
           |||||
Sbjct: 753 aagct 749



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 356 ccgatgaatggccccacccagaacatccagtggtcat 392
           |||||||||||||| |||||||| ||||| |||||||
Sbjct: 882 ccgatgaatggcccaacccagaatatccaatggtcat 846



to top

>gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete cds
          Length = 1029

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 421
           ||||| || |||||||| |||||||||||||||||| |  |||  ||||||||||| || 
Sbjct: 873 aatggtccgacccagaatatccagtggtcatcccagactctcttcttgttgtagataaca 814

                
Query: 422 gcagc 426
           |||||
Sbjct: 813 gcagc 809



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 329 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 388
           |||||||| ||||| || ||||| || || ||||| || || | |||||| ||||| |||
Sbjct: 856 tggtggtagaaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattgg 797

                                                    
Query: 389 tcatcccaggccttctcgttgttgtagatcacggcagctcc 429
           |||||||| || || || ||||| ||||| || ||||||||
Sbjct: 796 tcatcccaagctttgtccttgttatagatgacagcagctcc 756



to top

>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2),
           complete cds
          Length = 1126

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 362 aatggccccacccagaacatccagtggtcatcccagg 398
           ||||| |||||||| || |||||||||||||||||||
Sbjct: 813 aatggtcccacccaaaatatccagtggtcatcccagg 777



to top

>dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, partial cds
          Length = 273

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 354 ccccgatgaatggccccacccagaacatccagtggtc 390
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 235 ccccgatgaacggcccgacccagaaaatccagtggtc 199



to top

>dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, complete cds
          Length = 945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 354 ccccgatgaatggccccacccagaacatccagtggtc 390
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 695 ccccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
           |||||||| || || |||||||| |||||||||||| |||||||
Sbjct: 369 ccgatgaaggggccgacccagaagatccagtggtcagcccaggc 326



to top

>ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA
          Length = 2627

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 717 ccccaatgaacggccccacccagaaaatccagtggt 682



to top

>gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:5663 IMAGE:3491276),
           complete cds
          Length = 2614

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 703 ccccaatgaacggccccacccagaaaatccagtggt 668



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 359 atgaatggccccacccagaacatccagtggtc 390
           |||||||| ||||||||||| |||||||||||
Sbjct: 836 atgaatggtcccacccagaagatccagtggtc 805



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
           |||||||| || || |||||||| |||||||||||| |||||||
Sbjct: 800 ccgatgaaggggccgacccagaagatccagtggtcagcccaggc 757



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggc 399
           |||||||| || || |||||||| |||||||||||| |||||||
Sbjct: 857 ccgatgaaggggccgacccagaagatccagtggtcagcccaggc 814



to top

>gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic protein (mip1) mRNA,
           partial cds
          Length = 495

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 382 ccagtggtcatcccaggccttctcgttgttgtagatcacggcag 425
           |||||||||||||||||| || ||||||||| | ||||| ||||
Sbjct: 495 ccagtggtcatcccaggctttttcgttgttgaaaatcacagcag 452



to top

>dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highly similar to
           AQUAPORIN-CHIP
          Length = 2626

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 717 ccccaatgaacggccccacccagaaaatccagtggt 682



to top

>dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930043L24 product:aquaporin 1, full
           insert sequence
          Length = 2629

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete
           cds
          Length = 1123

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 353 gccccgatgaatggccccacccagaacatccagtggtcat 392
           ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 848 gccccaatgaatggtccaacccagaatatccagtggtcat 809



to top

>dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830204G14 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930113F12 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830211K06 product:aquaporin 1, full
           insert sequence
          Length = 2629

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830031A05
           product:aquaporin 1, full insert sequence
          Length = 2628

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830001F09 product:aquaporin 1, full
           insert sequence
          Length = 1736

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130084O08 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
           library, clone:D930045N08 product:aquaporin 1, full
           insert sequence
          Length = 2633

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 718 ccccaatgaacggccccacccagaaaatccagtggt 683



to top

>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1093

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 361 gaatggccccacccagaacatccagtggtcatccca 396
           |||||| |||||||| || |||||||||||||||||
Sbjct: 778 gaatggtcccacccaaaatatccagtggtcatccca 743



to top

>gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, complete cds
          Length = 2627

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ccccgatgaatggccccacccagaacatccagtggt 389
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 717 ccccaatgaacggccccacccagaaaatccagtggt 682



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 917 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 859



to top

>ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channel AT2G16850
           (PIP2;8/PIP3B) mRNA, complete cds
          Length = 1160

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 420
           |||||| || ||||| || ||||| ||||| ||||| || ||||| ||||||||||| ||
Sbjct: 807 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 748

                          
Query: 421 ggcagctccgaagct 435
            ||||| || |||||
Sbjct: 747 agcagcaccaaagct 733



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| ||||||||||||| ||| || | ||||| |||||||||
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagat 808



to top

>gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds
          Length = 816

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| | |||||||||
Sbjct: 662 ccgatgaacggccccacccagaaaacccagtggtc 628



to top

>emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral membrane protein 28
          Length = 2623

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaatggtcccacccagaaaatccagtggt 683



to top

>emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1
          Length = 1240

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggc 399
           |||||| ||||||||||| |||||||| || ||||||||
Sbjct: 869 gaatggacccacccagaaaatccagtgatcgtcccaggc 831



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 328 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 387
           ||||||||| | |||||| |  ||||| |||||||| || || |||||||| ||||||||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

              
Query: 388 gtc 390
           |||
Sbjct: 838 gtc 836



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 823 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 765



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| ||||||||||||| ||| || | ||||| |||||||||
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagat 748



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| ||||||||||||| ||| || | ||||| |||||||||
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagat 559



to top

>emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral protein 28k (CHIP28k)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 653 atgaatggtcccacccagaaaatccagtggt 623



to top

>emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA
          Length = 1092

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 664 atgaatggtcccacccagaaaatccagtggt 634



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 804 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 746



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 371 acccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| ||||||||||  ||||||||||| || | |||||||||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagat 725



to top

>emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.1 gene)
          Length = 1295

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttct 404
           |||||||| |||||||| ||||| || ||||||||||| ||||
Sbjct: 789 aatggcccaacccagaaaatccaatgatcatcccaggctttct 747



to top

>emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquoporin-like water channel
           protein (mip1 gene)
          Length = 662

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 359 atgaatggccccacccagaacatccagtggtcatcccag 397
           ||||||||||| |||||||| ||||| || |||||||||
Sbjct: 291 atgaatggcccaacccagaaaatccattgatcatcccag 253



to top

>ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA
          Length = 2623

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaatggtcccacccagaaaatccagtggt 683



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 845 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 787



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 362 aatggccccacccagaacatccagtggtcatccca 396
           ||||| ||||||||||| |||||||| ||||||||
Sbjct: 854 aatggtcccacccagaagatccagtgatcatccca 820



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 791 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 733



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 415
           ||||||||||| || |||||||| | ||| ||||||||||| || || || |||||| ||
Sbjct: 830 ccgatgaatggtccaacccagaagacccaatggtcatcccaagcgttgtccttgttgaag 771

                      
Query: 416 atcacggcagc 426
           || | ||||||
Sbjct: 770 atgatggcagc 760



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 835 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 777



to top

>gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds
          Length = 837

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 420
           |||||| || ||||| || ||||| ||||| ||||| || ||||| ||||||||||| ||
Sbjct: 741 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 682

                          
Query: 421 ggcagctccgaagct 435
            ||||| || |||||
Sbjct: 681 agcagcaccaaagct 667



to top

>ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 356 ccgatgaatggccccacccagaacatccagtggtc 390
           |||||||| |||||||||||||| | |||||||||
Sbjct: 662 ccgatgaacggccccacccagaaaacccagtggtc 628



to top

>gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete sequence
          Length = 1152

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 420
           |||||| || ||||| || ||||| ||||| ||||| || ||||| ||||||||||| ||
Sbjct: 803 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 744

                          
Query: 421 ggcagctccgaagct 435
            ||||| || |||||
Sbjct: 743 agcagcaccaaagct 729



to top

>gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, complete cds
          Length = 1083

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggcct 401
           |||||||| || |||||||| ||||| ||||||||||| ||||
Sbjct: 866 atgaatggtccaacccagaagatccaatggtcatcccatgcct 824



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 359 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 417
           |||||||| || |||||||| ||||||||||| ||||| || |  || |||||||||||
Sbjct: 791 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 733



to top

>gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone MGC:93653
           IMAGE:7190406), complete cds
          Length = 2637

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 695 atgaatggtcccacccagaaaatccagtggt 665



to top

>gb|U60148.1|BVU60148 Beta vulgaris plasma membrane major intrinsic protein 2 mRNA,
           complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 362 aatggccccacccagaacatccagtggtcatcccaggccttct 404
           ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 780 aatggtccaacccagaatatccaatggtcatcccacgccttct 738



to top

>gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) mRNA, complete cds
          Length = 1403

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 359 atgaatggccccacccagaacatccagtggt 389
           |||||||| ||||||||||| ||||||||||
Sbjct: 704 atgaatggtcccacccagaaaatccagtggt 674


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,384,905
Number of Sequences: 3902068
Number of extensions: 3384905
Number of successful extensions: 76282
Number of sequences better than 10.0: 344
Number of HSP's better than 10.0 without gapping: 342
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 75572
Number of HSP's gapped (non-prelim): 680
length of query: 435
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 413
effective length of database: 17,147,199,772
effective search space: 7081793505836
effective search space used: 7081793505836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top