ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet115e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017245.1| Mycoplasma synoviae 53, complete genome 44 0.39
2emb|CT025155.9| Mouse DNA sequence from clone RP23-228F18 on chr... 44 0.39
3gb|AE013082.1| Thermoanaerobacter tengcongensis MB4, section 109... 42 1.5
4gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.1
5gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosom... 40 6.1
6gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.1
7ref|XM_676530.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 6.1
8gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, compl... 40 6.1
9gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome... 40 6.1
10gb|AC111117.15| Mus musculus chromosome 1, clone RP23-214P23, co... 40 6.1
11ref|XM_570859.1| Cryptococcus neoformans var. neoformans JEC21 N... 40 6.1
12gb|AC019117.4| Homo sapiens BAC clone RP11-507K12 from 7, comple... 40 6.1
13gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, comp... 40 6.1
14emb|Z84572.1|HS49J10 Human DNA sequence from clone RP1-49J10 on ... 40 6.1
15emb|AL138820.11| Human DNA sequence from clone RP11-380B4 on chr... 40 6.1
16gb|AC009711.10| Homo sapiens chromosome 15, clone RP11-356B18, c... 40 6.1
17gb|AC100770.2| Homo sapiens chromosome 11, clone RP11-46P12, com... 40 6.1
18gb|AC090592.5| Homo sapiens chromosome 11, clone RP11-405K6, com... 40 6.1
19ref|XM_397003.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 6.1
20gb|AC134529.6| Mus musculus BAC clone RP24-503A2 from chromosome... 40 6.1

>gb|AE017245.1| Mycoplasma synoviae 53, complete genome
          Length = 799476

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 278    ggtgatcctgttttcggtgcac 299
              ||||||||||||||||||||||
Sbjct: 154018 ggtgatcctgttttcggtgcac 153997



to top

>emb|CT025155.9| Mouse DNA sequence from clone RP23-228F18 on chromosome 16, complete
              sequence
          Length = 203093

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 419    ggttcaccacactgaaatcatc 440
              ||||||||||||||||||||||
Sbjct: 165658 ggttcaccacactgaaatcatc 165679



to top

>gb|AE013082.1| Thermoanaerobacter tengcongensis MB4, section 109 of 244 of the
             complete genome
          Length = 14022

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 168   aacagcaagtgataatggtgc 188
             |||||||||||||||||||||
Sbjct: 13692 aacagcaagtgataatggtgc 13672



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 277     cggtgatcctgttttcggtg 296
               ||||||||||||||||||||
Sbjct: 4037976 cggtgatcctgttttcggtg 4037995



to top

>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence
          Length = 181038

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 258   gcttgcttccatctctctcc 277
             ||||||||||||||||||||
Sbjct: 28969 gcttgcttccatctctctcc 28988



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 312    ggcaaagagctgggaataga 331
              ||||||||||||||||||||
Sbjct: 879025 ggcaaagagctgggaataga 879006



to top

>ref|XM_676530.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8353.2), mRNA
          Length = 429

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 258 gcttgcttccatctctctccggtg 281
           |||||| |||||||||||||||||
Sbjct: 375 gcttgcctccatctctctccggtg 352



to top

>gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, complete sequence
          Length = 250903

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 336   cctttgcctctgtttacaga 355
             ||||||||||||||||||||
Sbjct: 26254 cctttgcctctgtttacaga 26235



to top

>gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome 12, complete sequence
          Length = 176949

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    aagagctgggaatagatatg 335
              ||||||||||||||||||||
Sbjct: 100223 aagagctgggaatagatatg 100242



to top

>gb|AC111117.15| Mus musculus chromosome 1, clone RP23-214P23, complete sequence
          Length = 201442

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 85    aattgcatactacccaacatccag 108
             ||||||||| ||||||||||||||
Sbjct: 70229 aattgcatattacccaacatccag 70206



to top

>ref|XM_570859.1| Cryptococcus neoformans var. neoformans JEC21 NBP35 (CNE03090)
           partial mRNA
          Length = 1011

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 312 ggcaaagagctgggaataga 331
           ||||||||||||||||||||
Sbjct: 844 ggcaaagagctgggaataga 863



to top

>gb|AC019117.4| Homo sapiens BAC clone RP11-507K12 from 7, complete sequence
          Length = 137228

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     acaatgatgcaagttacaat 69
              ||||||||||||||||||||
Sbjct: 128217 acaatgatgcaagttacaat 128236



to top

>gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, complete sequence
          Length = 134825

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 336  cctttgcctctgtttacaga 355
            ||||||||||||||||||||
Sbjct: 8538 cctttgcctctgtttacaga 8557



to top

>emb|Z84572.1|HS49J10 Human DNA sequence from clone RP1-49J10 on chromosome 13 Contains the 3'
              end of the gene for androgen-induced prostate proliferative
              shutoff associated protein (AS3) (CG008, FLJ23236,
              KIAA0979), complete sequence
          Length = 137246

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    ctgggaatagatatgccttt 340
              ||||||||||||||||||||
Sbjct: 130547 ctgggaatagatatgccttt 130566



to top

>emb|AL138820.11| Human DNA sequence from clone RP11-380B4 on chromosome 13 Contains the 3'
              end of the KIAA0979 gene and part of a novel gene, complete
              sequence
          Length = 168487

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    ctgggaatagatatgccttt 340
              ||||||||||||||||||||
Sbjct: 130038 ctgggaatagatatgccttt 130057



to top

>gb|AC009711.10| Homo sapiens chromosome 15, clone RP11-356B18, complete sequence
          Length = 205925

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 336   cctttgcctctgtttacaga 355
             ||||||||||||||||||||
Sbjct: 10838 cctttgcctctgtttacaga 10857



to top

>gb|AC100770.2| Homo sapiens chromosome 11, clone RP11-46P12, complete sequence
          Length = 165585

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    gcaaggaaaccacaatgatg 58
             ||||||||||||||||||||
Sbjct: 99934 gcaaggaaaccacaatgatg 99953



to top

>gb|AC090592.5| Homo sapiens chromosome 11, clone RP11-405K6, complete sequence
          Length = 168469

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    gcaaggaaaccacaatgatg 58
             ||||||||||||||||||||
Sbjct: 59501 gcaaggaaaccacaatgatg 59520



to top

>ref|XM_397003.2| PREDICTED: Apis mellifera similar to ENSANGP00000005626
           (LOC413562), mRNA
          Length = 5088

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 156 gtggacctatgcaacagcaa 175
           ||||||||||||||||||||
Sbjct: 328 gtggacctatgcaacagcaa 309



to top

>gb|AC134529.6| Mus musculus BAC clone RP24-503A2 from chromosome 6, complete sequence
          Length = 166392

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 258   gcttgcttccatctctctcc 277
             ||||||||||||||||||||
Sbjct: 99675 gcttgcttccatctctctcc 99694


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,963,927
Number of Sequences: 3902068
Number of extensions: 3963927
Number of successful extensions: 67141
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67081
Number of HSP's gapped (non-prelim): 60
length of query: 450
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 428
effective length of database: 17,147,199,772
effective search space: 7339001502416
effective search space used: 7339001502416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top