ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet114g07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 157 3e-35
2gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare str... 157 3e-35
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 157 3e-35
4dbj|AK070827.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 3e-35
5gb|AC104429.2| Oryza sativa (japonica cultivar-group) chromosome... 149 8e-33
6gb|AY109150.1| Zea mays PCO113685 mRNA sequence 52 0.001
7emb|AL732448.6| Mouse DNA sequence from clone RP23-116F12 on chr... 44 0.35
8gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, com... 42 1.4
9gb|AC010799.15| Homo sapiens chromosome 15, clone RP11-40J8, com... 42 1.4
10gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, com... 42 1.4
11gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete seq... 42 1.4
12gb|AC019322.8| Homo sapiens chromosome 15, clone RP11-382B18, co... 42 1.4
13gb|AC111169.7| Homo sapiens chromosome 15, clone RP11-20D7, comp... 42 1.4
14dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
15gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, c... 42 1.4
16gb|AC021413.16| Homo sapiens chromosome 15, clone RP11-30N16, co... 42 1.4
17dbj|AP003577.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
18emb|CT571256.7| Mouse DNA sequence from clone RP24-135B13 on chr... 42 1.4
19gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosom... 40 5.4
20gb|AC167978.4| Mus musculus BAC clone RP23-72M20 from chromosome... 40 5.4
21ref|XM_479459.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.4
22gb|AE001387.1| Plasmodium falciparum 3D7 chromosome 2 section 24... 40 5.4
23gb|AC004760.1| Homo sapiens chromosome 16, cosmid clone 316H7 (L... 40 5.4
24gb|AC165358.3| Mus musculus BAC clone RP23-122F14 from chromosom... 40 5.4
25gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, com... 40 5.4
26ref|NM_029274.1| Mus musculus WW domain binding protein 7 (Wbp7)... 40 5.4
27gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, com... 40 5.4
28gb|AC118645.13| Mus musculus chromosome 15, clone RP24-114E9, co... 40 5.4
29gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, co... 40 5.4
30gb|AC125396.4| Mus musculus BAC clone RP24-69M4 from chromosome ... 40 5.4
31gb|AC125527.3| Mus musculus BAC clone RP24-550H17 from chromosom... 40 5.4
32gb|AC122340.3| Mus musculus BAC clone RP23-354B8 from 15, comple... 40 5.4
33gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, ex... 40 5.4
34gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, e... 40 5.4
35gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, e... 40 5.4
36gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, ex... 40 5.4
37gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, ex... 40 5.4
38gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene,... 40 5.4
39gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene,... 40 5.4
40gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, ... 40 5.4
41gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, ... 40 5.4
42gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, ex... 40 5.4
43gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene... 40 5.4
44gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, ... 40 5.4
45gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, ... 40 5.4
46gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, e... 40 5.4
47gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, e... 40 5.4
48gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, comple... 40 5.4
49emb|AL354862.11| Human DNA sequence from clone RP11-83L6 on chro... 40 5.4
50emb|AL035456.26|HS1099D15 Human DNA sequence from clone RP5-1099... 40 5.4
51emb|CR937046.1|PT147K15 Pan troglodytes chromosome 11 BAC PTB-14... 40 5.4
52gb|AC104411.5| Homo sapiens 3 BAC RP11-555M1 (Roswell Park Cance... 40 5.4
53gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270... 40 5.4
54gb|AC112180.2| Homo sapiens chromosome 5 clone RP11-130F17, comp... 40 5.4
55gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, comp... 40 5.4
56gb|AC021581.10| Homo sapiens chromosome 17, clone RP11-956N15, c... 40 5.4
57gb|AC010612.8| Homo sapiens chromosome 5 clone CTB-91C24, comple... 40 5.4
58gb|AC008558.7|AC008558 Homo sapiens chromosome 5 clone CTC-531G1... 40 5.4
59dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
60gb|AC006111.4| Homo sapiens chromosome 16 clone RP11-461A8, comp... 40 5.4
61gb|AC112907.7| Homo sapiens 3 BAC RP11-573D15 (Roswell Park Canc... 40 5.4
62gb|AC019047.7| Homo sapiens BAC clone RP11-83N2 from 2, complete... 40 5.4
63gb|AC018513.5|AC018513 Homo sapiens chromosome 14 clone RP11-58H... 40 5.4
64dbj|AB182318.1| Mus musculus Mll2 mRNA for mixed lineage leukemi... 40 5.4
65dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
66gb|AC149609.5| Mus musculus BAC clone RP23-442K4 from 7, complet... 40 5.4
67gb|AC154540.2| Mus musculus BAC clone RP23-452G1 from chromosome... 40 5.4
68emb|AL603682.36| Mouse DNA sequence from clone RP23-235J5 on chr... 40 5.4
69emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chro... 40 5.4

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  157 bits (79), Expect = 3e-35
 Identities = 109/119 (91%)
 Strand = Plus / Minus

                                                                           
Query: 289     accgggcgagcgcgcggcggatcacctgggcaaggaggctgggggcgctgaggtggggga 348
               |||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 5391729 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 5391670

                                                                          
Query: 349     ggtggccctccgtcggcaggggctcgatggtggtgcggccgccgaggtgggccttgagg 407
               |||| ||||| ||| | |||  ||||| |||||||||||||||||||||||||||||||
Sbjct: 5391669 ggtgaccctcggtctggaggaactcgacggtggtgcggccgccgaggtgggccttgagg 5391611



to top

>gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0009J13, from chromosome 3, complete sequence
          Length = 147205

 Score =  157 bits (79), Expect = 3e-35
 Identities = 109/119 (91%)
 Strand = Plus / Minus

                                                                         
Query: 289   accgggcgagcgcgcggcggatcacctgggcaaggaggctgggggcgctgaggtggggga 348
             |||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 97897 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 97838

                                                                        
Query: 349   ggtggccctccgtcggcaggggctcgatggtggtgcggccgccgaggtgggccttgagg 407
             |||| ||||| ||| | |||  ||||| |||||||||||||||||||||||||||||||
Sbjct: 97837 ggtgaccctcggtctggaggaactcgacggtggtgcggccgccgaggtgggccttgagg 97779



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  157 bits (79), Expect = 3e-35
 Identities = 109/119 (91%)
 Strand = Plus / Minus

                                                                           
Query: 289     accgggcgagcgcgcggcggatcacctgggcaaggaggctgggggcgctgaggtggggga 348
               |||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 5390944 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 5390885

                                                                          
Query: 349     ggtggccctccgtcggcaggggctcgatggtggtgcggccgccgaggtgggccttgagg 407
               |||| ||||| ||| | |||  ||||| |||||||||||||||||||||||||||||||
Sbjct: 5390884 ggtgaccctcggtctggaggaactcgacggtggtgcggccgccgaggtgggccttgagg 5390826



to top

>dbj|AK070827.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023064N24, full
            insert sequence
          Length = 1487

 Score =  157 bits (79), Expect = 3e-35
 Identities = 109/119 (91%)
 Strand = Plus / Minus

                                                                        
Query: 289  accgggcgagcgcgcggcggatcacctgggcaaggaggctgggggcgctgaggtggggga 348
            |||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 1154 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 1095

                                                                       
Query: 349  ggtggccctccgtcggcaggggctcgatggtggtgcggccgccgaggtgggccttgagg 407
            |||| ||||| ||| | |||  ||||| |||||||||||||||||||||||||||||||
Sbjct: 1094 ggtgaccctcggtctggaggaactcgacggtggtgcggccgccgaggtgggccttgagg 1036



to top

>gb|AC104429.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0006P09,
              complete sequence
          Length = 153950

 Score =  149 bits (75), Expect = 8e-33
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                          
Query: 289    accgggcgagcgcgcggcggatcacctgggcaaggaggctgggggcgctgaggtggggga 348
              |||||||||| |||||||||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 121620 accgggcgagagcgcggcggagcacctgagctaggaggctgggggcgctgaggtggggga 121561

                                                                         
Query: 349    ggtggccctccgtcggcaggggctcgatggtggtgcggccgccgaggtgggccttgagg 407
              |||| ||||| ||| | |||  ||||| |||||||||||||||||||||||||||||||
Sbjct: 121560 ggtgaccctcggtctggaggaactcgacggtggtgcggccgccgaggtgggccttgagg 121502



to top

>gb|AY109150.1| Zea mays PCO113685 mRNA sequence
          Length = 645

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 371 ctcgatggtggtgcggccgccgaggtgggccttgagg 407
           ||||| || |||||| |||||||||||||||||||||
Sbjct: 640 ctcgacggcggtgcgnccgccgaggtgggccttgagg 604



to top

>emb|AL732448.6| Mouse DNA sequence from clone RP23-116F12 on chromosome 2, complete
              sequence
          Length = 214210

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 20     aagaaaagatggagatgaaaac 41
              ||||||||||||||||||||||
Sbjct: 168783 aagaaaagatggagatgaaaac 168762



to top

>gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, complete sequence
          Length = 174540

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 17804 tttcttccctctctctttttt 17784



to top

>gb|AC010799.15| Homo sapiens chromosome 15, clone RP11-40J8, complete sequence
          Length = 179508

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 69154 tttcttccctctctctttttt 69174



to top

>gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, complete sequence
          Length = 192661

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 86560 tttcttccctctctctttttt 86540



to top

>gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete sequence
          Length = 150256

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 17813 tttcttccctctctctttttt 17833



to top

>gb|AC019322.8| Homo sapiens chromosome 15, clone RP11-382B18, complete sequence
          Length = 175205

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 20122 tttcttccctctctctttttt 20142



to top

>gb|AC111169.7| Homo sapiens chromosome 15, clone RP11-20D7, complete sequence
          Length = 129543

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 33085 tttcttccctctctctttttt 33105



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 1        aaacttttcttctaacgaaaagaaaagat 29
                |||||||||||||||| |||| |||||||
Sbjct: 16697321 aaacttttcttctaactaaaataaaagat 16697349



to top

>gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, complete sequence
          Length = 165208

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 247    tttcttccctctctctttttt 267
              |||||||||||||||||||||
Sbjct: 147646 tttcttccctctctctttttt 147626



to top

>gb|AC021413.16| Homo sapiens chromosome 15, clone RP11-30N16, complete sequence
          Length = 199198

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 247   tttcttccctctctctttttt 267
             |||||||||||||||||||||
Sbjct: 74572 tttcttccctctctctttttt 74552



to top

>dbj|AP003577.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0664F03
          Length = 184242

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 1     aaacttttcttctaacgaaaagaaaagat 29
             |||||||||||||||| |||| |||||||
Sbjct: 48808 aaacttttcttctaactaaaataaaagat 48836



to top

>emb|CT571256.7| Mouse DNA sequence from clone RP24-135B13 on chromosome 13, complete
              sequence
          Length = 183340

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 148    taaaaatacagaaaagaaata 168
              |||||||||||||||||||||
Sbjct: 170520 taaaaatacagaaaagaaata 170540



to top

>gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosome 7, complete sequence
          Length = 238950

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    aaagaaaagatggagatgaa 38
             ||||||||||||||||||||
Sbjct: 33847 aaagaaaagatggagatgaa 33866



to top

>gb|AC167978.4| Mus musculus BAC clone RP23-72M20 from chromosome 7, complete sequence
          Length = 214959

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     aaagaaaagatggagatgaa 38
              ||||||||||||||||||||
Sbjct: 168555 aaagaaaagatggagatgaa 168574



to top

>ref|XM_479459.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 322 ggaggctgggggcgctgaggtggg 345
           ||||||||||||||||| ||||||
Sbjct: 131 ggaggctgggggcgctggggtggg 154



to top

>gb|AE001387.1| Plasmodium falciparum 3D7 chromosome 2 section 24 of 73 of the
           complete sequence
          Length = 15540

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 150 aaaatacagaaaagaaatac 169
           ||||||||||||||||||||
Sbjct: 540 aaaatacagaaaagaaatac 521



to top

>gb|AC004760.1| Homo sapiens chromosome 16, cosmid clone 316H7 (LANL), complete
             sequence
          Length = 44496

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   gcgctgaggtgggggaggtggccc 356
             |||| |||||||||||||||||||
Sbjct: 19763 gcgcggaggtgggggaggtggccc 19740



to top

>gb|AC165358.3| Mus musculus BAC clone RP23-122F14 from chromosome 1, complete sequence
          Length = 223166

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 252   tccctctctcttttttagtgtattttct 279
             ||||||| | ||||||||||||||||||
Sbjct: 15149 tccctcttttttttttagtgtattttct 15122



to top

>gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, complete sequence
          Length = 238598

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    attttcttcccagtcttttg 126
              ||||||||||||||||||||
Sbjct: 182688 attttcttcccagtcttttg 182707



to top

>ref|NM_029274.1| Mus musculus WW domain binding protein 7 (Wbp7), mRNA
          Length = 8444

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 19   aaagaaaagatggagatgaa 38
            ||||||||||||||||||||
Sbjct: 1022 aaagaaaagatggagatgaa 1041



to top

>gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, complete sequence
          Length = 201995

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tttcttccctctctcttttt 266
             ||||||||||||||||||||
Sbjct: 76620 tttcttccctctctcttttt 76601



to top

>gb|AC118645.13| Mus musculus chromosome 15, clone RP24-114E9, complete sequence
          Length = 172076

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 17    gaaaagaaaagatggagatgaaaa 40
             |||||| |||||||||||||||||
Sbjct: 25459 gaaaagtaaagatggagatgaaaa 25482



to top

>gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, complete sequence
          Length = 170056

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    tttcttccctctctcttttt 266
              ||||||||||||||||||||
Sbjct: 106131 tttcttccctctctcttttt 106150



to top

>gb|AC125396.4| Mus musculus BAC clone RP24-69M4 from chromosome 16, complete sequence
          Length = 179186

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 263   tttttagtgtattttctactgcta 286
             ||||||||||||||| ||||||||
Sbjct: 27529 tttttagtgtattttttactgcta 27552



to top

>gb|AC125527.3| Mus musculus BAC clone RP24-550H17 from chromosome 1, complete sequence
          Length = 153191

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 252    tccctctctcttttttagtgtattttct 279
              ||||||| | ||||||||||||||||||
Sbjct: 143454 tccctcttttttttttagtgtattttct 143427



to top

>gb|AC122340.3| Mus musculus BAC clone RP23-354B8 from 15, complete sequence
          Length = 183991

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 17    gaaaagaaaagatggagatgaaaa 40
             |||||| |||||||||||||||||
Sbjct: 60737 gaaaagtaaagatggagatgaaaa 60714



to top

>gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28397

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23410 ggctgggggggaggaggtgagggaggtggccctccg 23445



to top

>gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28190

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23238 ggctgggggggaggaggtgagggaggtggccctccg 23273



to top

>gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28177

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23241 ggctgggggggaggaggtgagggaggtggccctccg 23276



to top

>gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28188

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23269 ggctgggggggaggaggtgagggaggtggccctccg 23304



to top

>gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28209

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23290 ggctgggggggaggaggtgagggaggtggccctccg 23325



to top

>gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23538 ggctgggggggaggaggtgagggaggtggccctccg 23573



to top

>gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23538 ggctgggggggaggaggtgagggaggtggccctccg 23573



to top

>gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28267

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23321 ggctgggggggaggaggtgagggaggtggccctccg 23356



to top

>gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28684

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23564 ggctgggggggaggaggtgagggaggtggccctccg 23599



to top

>gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28376

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23390 ggctgggggggaggaggtgagggaggtggccctccg 23425



to top

>gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28661

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23541 ggctgggggggaggaggtgagggaggtggccctccg 23576



to top

>gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28659

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23539 ggctgggggggaggaggtgagggaggtggccctccg 23574



to top

>gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28649

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23528 ggctgggggggaggaggtgagggaggtggccctccg 23563



to top

>gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28219

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23266 ggctgggggggaggaggtgagggaggtggccctccg 23301



to top

>gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28593

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 325   ggctgggggcgctgaggtgggggaggtggccctccg 360
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23474 ggctgggggggaggaggtgagggaggtggccctccg 23509



to top

>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence
          Length = 140861

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   tcttccctctctctttttta 268
             ||||||||||||||||||||
Sbjct: 29259 tcttccctctctctttttta 29278



to top

>emb|AL354862.11| Human DNA sequence from clone RP11-83L6 on chromosome 9 Contains an
             olfactory receptor pseudsogene, the SYK gene for spleen
             tyrosine kinase and a CpG island, complete sequence
          Length = 153954

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   tgggggcgctgaggtggggg 347
             ||||||||||||||||||||
Sbjct: 60897 tgggggcgctgaggtggggg 60916



to top

>emb|AL035456.26|HS1099D15 Human DNA sequence from clone RP5-1099D15 on chromosome 20 Contains
            the 3' end of a novel gene, the JAG1 gene encoding Jagged
            1 (involved in Alagille syndrome), a pseudogene aimilar
            to DNAJ protein, a CpG island, ESTs, STSs and GSSs,
            complete sequence
          Length = 125952

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 13   taacgaaaagaaaagatgga 32
            ||||||||||||||||||||
Sbjct: 2366 taacgaaaagaaaagatgga 2347



to top

>emb|CR937046.1|PT147K15 Pan troglodytes chromosome 11 BAC PTB-147K15, complete sequence
          Length = 197298

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   tttcttccctctctcttttt 266
             ||||||||||||||||||||
Sbjct: 12554 tttcttccctctctcttttt 12573



to top

>gb|AC104411.5| Homo sapiens 3 BAC RP11-555M1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 70499

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 336   ctgaggtgggggaggtggcc 355
             ||||||||||||||||||||
Sbjct: 61765 ctgaggtgggggaggtggcc 61784



to top

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 335   gctgaggtgggggaggtggc 354
             ||||||||||||||||||||
Sbjct: 90114 gctgaggtgggggaggtggc 90095



to top

>gb|AC112180.2| Homo sapiens chromosome 5 clone RP11-130F17, complete sequence
          Length = 166720

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   ttttttagtgtattttctac 281
             ||||||||||||||||||||
Sbjct: 36633 ttttttagtgtattttctac 36652



to top

>gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, complete sequence
          Length = 203831

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 262   ttttttagtgtattttctac 281
             ||||||||||||||||||||
Sbjct: 52769 ttttttagtgtattttctac 52750



to top

>gb|AC021581.10| Homo sapiens chromosome 17, clone RP11-956N15, complete sequence
          Length = 181607

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   tgggggcgctgaggtggggg 347
             ||||||||||||||||||||
Sbjct: 87526 tgggggcgctgaggtggggg 87507



to top

>gb|AC010612.8| Homo sapiens chromosome 5 clone CTB-91C24, complete sequence
          Length = 139873

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   tgggggcgctgaggtggggg 347
             ||||||||||||||||||||
Sbjct: 50173 tgggggcgctgaggtggggg 50154



to top

>gb|AC008558.7|AC008558 Homo sapiens chromosome 5 clone CTC-531G16, complete sequence
          Length = 210532

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    tgccattttcttcccagtct 122
              ||||||||||||||||||||
Sbjct: 117297 tgccattttcttcccagtct 117316



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 322      ggaggctgggggcgctgaggtggg 345
                ||||||||||||||||| ||||||
Sbjct: 28314495 ggaggctgggggcgctggggtggg 28314518



to top

>gb|AC006111.4| Homo sapiens chromosome 16 clone RP11-461A8, complete sequence
          Length = 190814

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 333    gcgctgaggtgggggaggtggccc 356
              |||| |||||||||||||||||||
Sbjct: 175495 gcgcggaggtgggggaggtggccc 175518



to top

>gb|AC112907.7| Homo sapiens 3 BAC RP11-573D15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 132875

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   gtaaaaatacagaaaagaaa 166
             ||||||||||||||||||||
Sbjct: 28394 gtaaaaatacagaaaagaaa 28413



to top

>gb|AC019047.7| Homo sapiens BAC clone RP11-83N2 from 2, complete sequence
          Length = 165007

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   cttttttagtgtattttcta 280
             ||||||||||||||||||||
Sbjct: 41639 cttttttagtgtattttcta 41620



to top

>gb|AC018513.5|AC018513 Homo sapiens chromosome 14 clone RP11-58H3 map 14q31, complete sequence
          Length = 190773

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 254    cctctctcttttttagtgtatttt 277
              |||||||||||||| |||||||||
Sbjct: 162769 cctctctctttttttgtgtatttt 162746



to top

>dbj|AB182318.1| Mus musculus Mll2 mRNA for mixed lineage leukemia 2, complete cds
          Length = 8444

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 19   aaagaaaagatggagatgaa 38
            ||||||||||||||||||||
Sbjct: 1022 aaagaaaagatggagatgaa 1041



to top

>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0470D12
          Length = 157248

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 322   ggaggctgggggcgctgaggtggg 345
             ||||||||||||||||| ||||||
Sbjct: 40058 ggaggctgggggcgctggggtggg 40081



to top

>gb|AC149609.5| Mus musculus BAC clone RP23-442K4 from 7, complete sequence
          Length = 196912

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     aaagaaaagatggagatgaa 38
              ||||||||||||||||||||
Sbjct: 111118 aaagaaaagatggagatgaa 111099



to top

>gb|AC154540.2| Mus musculus BAC clone RP23-452G1 from chromosome 16, complete sequence
          Length = 171663

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 263    tttttagtgtattttctactgcta 286
              ||||||||||||||| ||||||||
Sbjct: 168743 tttttagtgtattttttactgcta 168766



to top

>emb|AL603682.36| Mouse DNA sequence from clone RP23-235J5 on chromosome 11, complete
             sequence
          Length = 211680

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 335   gctgaggtgggggaggtggc 354
             ||||||||||||||||||||
Sbjct: 15365 gctgaggtgggggaggtggc 15384



to top

>emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chromosome X, complete
              sequence
          Length = 249536

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 331    gggcgctgaggtgggggagg 350
              ||||||||||||||||||||
Sbjct: 171274 gggcgctgaggtgggggagg 171255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,175,200
Number of Sequences: 3902068
Number of extensions: 5175200
Number of successful extensions: 129982
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 129677
Number of HSP's gapped (non-prelim): 305
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top