>emb|Z50109.1|CEC09H10 Caenorhabditis elegans Cosmid C09H10, complete sequence
          Length = 40453

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 320   tatgatgagctcacgaggacg 340
             |||||||||||||||||||||
Sbjct: 39872 tatgatgagctcacgaggacg 39892

>gb|AY456694.1| Solanum tuberosum putative ethylene receptor (ERS) gene, complete cds
          Length = 8203

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  ataagagtaactgaaaccaa 136
            ||||||||||||||||||||
Sbjct: 6822 ataagagtaactgaaaccaa 6803

>emb|AL355003.10| Human DNA sequence from clone RP11-753M10 on chromosome 13, complete
             sequence
          Length = 133309

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   cttattagctcatgaatgaa 202
             ||||||||||||||||||||
Sbjct: 40529 cttattagctcatgaatgaa 40510

>gb|AC093906.3| Homo sapiens BAC clone RP11-742B18 from 4, complete sequence
          Length = 189286

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   aacttttcaaactctagcct 235
             ||||||||||||||||||||
Sbjct: 32488 aacttttcaaactctagcct 32469

>gb|AC069164.11|AC069164 Homo sapiens chromosome 13 clone RP11-338F18, complete sequence
          Length = 169903

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   cttattagctcatgaatgaa 202
             ||||||||||||||||||||
Sbjct: 79096 cttattagctcatgaatgaa 79077

>gb|AC022910.9| Homo sapiens chromosome 8, clone RP11-710C11, complete sequence
          Length = 181944

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   tcaaacttttcaaactctag 232
             ||||||||||||||||||||
Sbjct: 50665 tcaaacttttcaaactctag 50684


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,698,709
Number of Sequences: 3902068
Number of extensions: 2698709
Number of successful extensions: 47663
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47655
Number of HSP's gapped (non-prelim): 8
length of query: 362
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 340
effective length of database: 17,147,199,772
effective search space: 5830047922480
effective search space used: 5830047922480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)