ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet112c01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, ... 46 0.11
2emb|AL022223.3|ATM3E9 Arabidopsis thaliana DNA chromosome 4, P1 ... 46 0.11
3emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on ch... 44 0.43
4gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 6.7
5gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 6.7
6gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 6.7
7gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 6.7
8gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 6.7
9gb|AC103355.9| Mus musculus chromosome 14, clone RP24-482C10, co... 40 6.7
10gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome... 40 6.7
11gb|CP000001.1| Bacillus cereus E33L, complete genome 40 6.7
12emb|BX088648.9| Mouse DNA sequence from clone RP23-156M16 on chr... 40 6.7
13dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 40 6.7
14gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 40 6.7
15gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.7
16gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 6.7
17gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome ... 40 6.7
18emb|AL833798.8| Mouse DNA sequence from clone RP23-130L21 on chr... 40 6.7

>emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 65
          Length = 198320

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 303   atcactagccagtagccaccagc 325
             |||||||||||||||||||||||
Sbjct: 51486 atcactagccagtagccaccagc 51464



to top

>emb|AL022223.3|ATM3E9 Arabidopsis thaliana DNA chromosome 4, P1 clone M3E9 (ESSA project)
          Length = 80677

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 303   atcactagccagtagccaccagc 325
             |||||||||||||||||||||||
Sbjct: 54922 atcactagccagtagccaccagc 54944



to top

>emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on chromosome 11 Contains the
              3' end of gene FLJ13305, a novel gene, a novel gene
              (1700061J23Rik) and a CpG island, complete sequence
          Length = 195614

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 76     tagtgacaactcaaaggaaatc 97
              ||||||||||||||||||||||
Sbjct: 123552 tagtgacaactcaaaggaaatc 123531



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 465     ccgtcccgcggcgggccgaagcgc 488
               ||||||||||||| ||||||||||
Sbjct: 2366202 ccgtcccgcggcgtgccgaagcgc 2366225



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     aaccaccaagcattgctgct 126
               ||||||||||||||||||||
Sbjct: 3732318 aaccaccaagcattgctgct 3732337



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     aaccaccaagcattgctgct 126
               ||||||||||||||||||||
Sbjct: 3710251 aaccaccaagcattgctgct 3710270



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     aaccaccaagcattgctgct 126
               ||||||||||||||||||||
Sbjct: 3710819 aaccaccaagcattgctgct 3710838



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 282     tcctcgcgacgaagcaaaga 301
               ||||||||||||||||||||
Sbjct: 2591555 tcctcgcgacgaagcaaaga 2591536



to top

>gb|AC103355.9| Mus musculus chromosome 14, clone RP24-482C10, complete sequence
          Length = 192348

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 69   gtacagttagtgacaactcaaagg 92
            ||||||| ||||||||||||||||
Sbjct: 9066 gtacagtgagtgacaactcaaagg 9043



to top

>gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome 6, complete sequence
          Length = 188132

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 343   ccactgcaccaggtttccat 362
             ||||||||||||||||||||
Sbjct: 23222 ccactgcaccaggtttccat 23241



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     aaccaccaagcattgctgct 126
               ||||||||||||||||||||
Sbjct: 3790560 aaccaccaagcattgctgct 3790579



to top

>emb|BX088648.9| Mouse DNA sequence from clone RP23-156M16 on chromosome 11, complete
              sequence
          Length = 199838

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 343    ccactgcaccaggtttccat 362
              ||||||||||||||||||||
Sbjct: 139751 ccactgcaccaggtttccat 139770



to top

>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     tcatcttgggtaaccaagca 246
               ||||||||||||||||||||
Sbjct: 4598679 tcatcttgggtaaccaagca 4598698



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
              sequence
          Length = 108847

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 128    cctagggaagacaaatgaag 147
              ||||||||||||||||||||
Sbjct: 101402 cctagggaagacaaatgaag 101383



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    ctgcagccccaaaagaacca 216
              ||||||||||||||||||||
Sbjct: 717677 ctgcagccccaaaagaacca 717658



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     aaccaccaagcattgctgct 126
               ||||||||||||||||||||
Sbjct: 3710124 aaccaccaagcattgctgct 3710143



to top

>gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome 14, complete sequence
          Length = 252394

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 69     gtacagttagtgacaactcaaagg 92
              ||||||| ||||||||||||||||
Sbjct: 155929 gtacagtgagtgacaactcaaagg 155906



to top

>emb|AL833798.8| Mouse DNA sequence from clone RP23-130L21 on chromosome 4, complete
             sequence
          Length = 214799

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    aaaggaaatcggatggcaga 107
             ||||||||||||||||||||
Sbjct: 89684 aaaggaaatcggatggcaga 89703


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,000,995
Number of Sequences: 3902068
Number of extensions: 4000995
Number of successful extensions: 64143
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63987
Number of HSP's gapped (non-prelim): 156
length of query: 493
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 471
effective length of database: 17,147,199,772
effective search space: 8076331092612
effective search space used: 8076331092612
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top