ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet10g02 |
|---|---|
| Clone Library Name | barley_pub |
>emb|BX942837.5| Zebrafish DNA sequence from clone CH211-224B23 in linkage group 5, complete sequence Length = 183605 Score = 46.1 bits (23), Expect = 0.045 Identities = 29/31 (93%) Strand = Plus / Minus Query: 6 ttcaattttgaaaaatattttgatattgtta 36 ||||| ||||||||| ||||||||||||||| Sbjct: 135442 ttcaactttgaaaaacattttgatattgtta 135412
>gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete sequence Length = 166908 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 70450 ttttgaaaaatattttgatatt 70471
>gb|AC093098.2| Drosophila melanogaster clone BACR29G22, complete sequence Length = 153749 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttgat 29 |||||||||||||||||||||| Sbjct: 77209 caattttgaaaaatattttgat 77188 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 caattttgaaaaatattttgat 29 |||||||||||||||||||||| Sbjct: 72143 caattttgaaaaatattttgat 72164
>gb|AC147312.3| Pan troglodytes BAC clone RP43-50K12 from 7, complete sequence Length = 214157 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttgatatt 32 ||||||| |||||||||||||||||| Sbjct: 41172 tcaatttagaaaaatattttgatatt 41197
>gb|AC006148.3| Homo sapiens PAC clone RP5-902E20 from 7, complete sequence Length = 121110 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 7 tcaattttgaaaaatattttgatatt 32 ||||||| |||||||||||||||||| Sbjct: 51776 tcaatttagaaaaatattttgatatt 51751
>emb|AL035071.17|HS1085F17 Human DNA sequence from clone RP5-1085F17 on chromosome 20q11.1-11.23 Contains the DNMT3B gene encoding DNA Cytosine-5 Methyltransferase 3 beta, the MAPRE1 gene encoding a microtubule-associated protein, RP/EB family, member 1, part of a novel gene, ESTs, STSs, GSSs, and three CpG islands, complete sequence Length = 118899 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 13 ttgaaaaatattttgatattgt 34 |||||||||||||||||||||| Sbjct: 342 ttgaaaaatattttgatattgt 363
>gb|AY102251.1| Drosophila teissieri strain Eua5 jingwei (jgw) gene, 5' flanking region Length = 834 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 499 ttttgaaaaatattttgatatt 478
>gb|AY102246.1| Drosophila teissieri strain Chi4 jingwei (jgw) gene, 5' flanking region Length = 833 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 499 ttttgaaaaatattttgatatt 478
>gb|AY102245.1| Drosophila teissieri strain Chi2 jingwei (jgw) gene, 5' flanking region Length = 834 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 499 ttttgaaaaatattttgatatt 478
>gb|U23524.1| Caenorhabditis elegans cosmid C29F5, complete sequence Length = 21690 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttga 28 |||||||||||||||||||||| Sbjct: 19856 tcaattttgaaaaatattttga 19877
>gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 27343, complete genome Length = 1010023 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 aattttgaaaaatattttgata 30 |||||||||||||||||||||| Sbjct: 195717 aattttgaaaaatattttgata 195738
>gb|AC007885.5| Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone BACR02G15, complete sequence Length = 156955 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 20977 ttttgaaaaatattttgatatt 20956
>gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR37K05, complete sequence Length = 197597 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttga 28 |||||||||||||||||||||| Sbjct: 24688 tcaattttgaaaaatattttga 24709
>gb|AC008312.4|AC008312 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR06G09, complete sequence Length = 188459 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttga 28 |||||||||||||||||||||| Sbjct: 152165 tcaattttgaaaaatattttga 152186
>gb|AE003671.4| Drosophila melanogaster chromosome 3R, section 13 of 118 of the complete sequence Length = 315844 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttga 28 |||||||||||||||||||||| Sbjct: 131107 tcaattttgaaaaatattttga 131128
>gb|AE003826.4| Drosophila melanogaster chromosome 2R, section 24 of 73 of the complete sequence Length = 310108 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttgat 29 |||||||||||||||||||||| Sbjct: 197639 caattttgaaaaatattttgat 197618 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 caattttgaaaaatattttgat 29 |||||||||||||||||||||| Sbjct: 192573 caattttgaaaaatattttgat 192594
>gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 of 74 of the complete sequence Length = 283558 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 166682 ttttgaaaaatattttgatatt 166703
>gb|AE003466.2| Drosophila melanogaster chromosome 2R, section 73 of 73 of the complete sequence Length = 228008 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 207032 ttttgaaaaatattttgatatt 207053
>gb|AE003846.5| Drosophila melanogaster chromosome 4, section 5 of 5 of the complete sequence Length = 356494 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 325756 ttttgaaaaatattttgatatt 325777
>gb|CP000208.1| Drosophila melanogaster genomic scaffold 211000022280732 Length = 94131 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatatt 32 |||||||||||||||||||||| Sbjct: 27174 ttttgaaaaatattttgatatt 27195
>gb|AC132466.4| Mus musculus BAC clone RP23-68N22 from 16, complete sequence Length = 144237 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 2 aaacttcaattttgaaaaatat 23 |||||||||||||||||||||| Sbjct: 1153 aaacttcaattttgaaaaatat 1174
>gb|AC007587.12| Drosophila melanogaster clone BACR02D22, complete sequence Length = 185915 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatat 31 ||||||||||||||||||||| Sbjct: 154469 ttttgaaaaatattttgatat 154489
>gb|AC150556.1| Drosophila melanogaster clone BACR07H20, complete sequence Length = 183020 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatat 31 ||||||||||||||||||||| Sbjct: 112184 ttttgaaaaatattttgatat 112164
>gb|AC104286.11| Drosophila melanogaster X BAC RP98-13J2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 176393 Score = 42.1 bits (21), Expect = 0.70 Identities = 24/25 (96%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatattgtt 35 ||||||||||| ||||||||||||| Sbjct: 55589 ttttgaaaaatgttttgatattgtt 55565
>gb|AC118931.8| Mus musculus chromosome 19, clone RP24-118A21, complete sequence Length = 233367 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttga 28 ||||||||||||||||||||| Sbjct: 89749 caattttgaaaaatattttga 89729
>emb|AL353623.16| Human DNA sequence from clone RP11-376H15 on chromosome 13 Contains the 5' end of a novel gene and a CpG island, complete sequence Length = 128538 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatattttg 27 ||||||||||||||||||||| Sbjct: 102074 tcaattttgaaaaatattttg 102094
>emb|AL137015.9| Human DNA sequence from clone RP13-272N16 on chromosome Xq21.2-21.33 Contains a CpG island, complete sequence Length = 99527 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 acttcaattttgaaaaatatt 24 ||||||||||||||||||||| Sbjct: 54434 acttcaattttgaaaaatatt 54414
>emb|AL050231.2|DMBR37P7 Drosophila melanogaster BAC clone BACR37P7 Length = 102619 Score = 42.1 bits (21), Expect = 0.70 Identities = 24/25 (96%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatattgtt 35 ||||||||||| ||||||||||||| Sbjct: 50341 ttttgaaaaatgttttgatattgtt 50317
>gb|AC091944.2| Homo sapiens chromosome 5 clone RP11-348M17, complete sequence Length = 194624 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatat 31 ||||||||||||||||||||| Sbjct: 126408 ttttgaaaaatattttgatat 126428
>gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194790 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tttgaaaaatattttgatatt 32 ||||||||||||||||||||| Sbjct: 124944 tttgaaaaatattttgatatt 124924
>gb|AC013247.8| Drosophila melanogaster, chromosome 2R, region 41D-41E, BAC clone BACR06P07, complete sequence Length = 187793 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgatat 31 ||||||||||||||||||||| Sbjct: 55328 ttttgaaaaatattttgatat 55348
>gb|AC010144.4|AC010144 Homo sapiens BAC clone RP11-309M4 from Y, complete sequence Length = 166347 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 acttcaattttgaaaaatatt 24 ||||||||||||||||||||| Sbjct: 40572 acttcaattttgaaaaatatt 40552
>emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in linkage group 4, complete sequence Length = 210697 Score = 42.1 bits (21), Expect = 0.70 Identities = 24/25 (96%) Strand = Plus / Minus Query: 132 tactttttaagctgcagatgttaca 156 |||||||||||||| |||||||||| Sbjct: 43628 tactttttaagctgaagatgttaca 43604
>emb|AL954657.14| Zebrafish DNA sequence from clone CH211-223E21 in linkage group 4, complete sequence Length = 200352 Score = 42.1 bits (21), Expect = 0.70 Identities = 24/25 (96%) Strand = Plus / Minus Query: 132 tactttttaagctgcagatgttaca 156 |||||||||||||| |||||||||| Sbjct: 83100 tactttttaagctgaagatgttaca 83076
>gb|AE003787.5| Drosophila melanogaster chromosome 2R, section 2 of 73 of the complete sequence Length = 294609 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatat 31 ||||||||||||||||||||| Sbjct: 165631 ttttgaaaaatattttgatat 165611
>gb|AE003591.4| Drosophila melanogaster chromosome 3L, section 72 of 83 of the complete sequence Length = 301136 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tttgaaaaatattttgatatt 32 ||||||||||||||||||||| Sbjct: 174236 tttgaaaaatattttgatatt 174216
>gb|AE003417.4| Drosophila melanogaster chromosome X, section 1 of 74 of the complete sequence Length = 387740 Score = 42.1 bits (21), Expect = 0.70 Identities = 24/25 (96%) Strand = Plus / Minus Query: 11 ttttgaaaaatattttgatattgtt 35 ||||||||||| ||||||||||||| Sbjct: 147900 ttttgaaaaatgttttgatattgtt 147876
>gb|AC171104.1| Drosophila melanogaster clone CH221-06A19, complete sequence Length = 125302 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 9 aattttgaaaaatattttgatatt 32 ||||||||||||| |||||||||| Sbjct: 59754 aattttgaaaaatgttttgatatt 59731
>gb|AC145383.3| Oryza sativa chromosome 3 BAC OSJNBa0038E17 genomic sequence, complete sequence Length = 141691 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ttgaaaaatattttgatatt 32 |||||||||||||||||||| Sbjct: 5178 ttgaaaaatattttgatatt 5197
>gb|AC147427.2| Oryza sativa chromosome 3 B1394A07 genomic sequence, complete sequence Length = 175704 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 ttgaaaaatattttgatatt 32 |||||||||||||||||||| Sbjct: 6868 ttgaaaaatattttgatatt 6849
>gb|AC145991.2| Pan troglodytes BAC clone RP43-170F9 from 7, complete sequence Length = 173879 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 3 aacttcaattttgaaaaatatttt 26 ||||||| |||||||||||||||| Sbjct: 115967 aacttcatttttgaaaaatatttt 115990
>gb|AC087214.4| Papio anubis clone RP41-150K7, complete sequence Length = 141415 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 ttttaagctgcagatgttac 155 |||||||||||||||||||| Sbjct: 84949 ttttaagctgcagatgttac 84968
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ttgaaaaatattttgatatt 32 |||||||||||||||||||| Sbjct: 24628992 ttgaaaaatattttgatatt 24629011
>gb|AC114826.6| Mus musculus BAC clone RP24-156O12 from chromosome 5, complete sequence Length = 179886 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 attttgaaaaatattttgat 29 |||||||||||||||||||| Sbjct: 51251 attttgaaaaatattttgat 51232
>gb|AC117216.3| Mus musculus BAC clone RP23-310O5 from 2, complete sequence Length = 184628 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgata 30 |||||||||||||||||||| Sbjct: 87455 ttttgaaaaatattttgata 87474
>gb|AC079996.5| Homo sapiens BAC clone RP11-713C12 from 7, complete sequence Length = 116690 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 3 aacttcaattttgaaaaatatttt 26 ||||||| |||||||||||||||| Sbjct: 64193 aacttcatttttgaaaaatatttt 64216
>gb|AF022967.1| Caenorhabditis elegans cosmid C13A2, complete sequence Length = 35348 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttg 27 |||||||||||||||||||| Sbjct: 21146 caattttgaaaaatattttg 21127
>emb|AL512271.10| Human DNA sequence from clone RP11-74K19 on chromosome 1 Contains a novel gene, complete sequence Length = 132920 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 aattttgaaaaatattttga 28 |||||||||||||||||||| Sbjct: 130807 aattttgaaaaatattttga 130826
>emb|AL359539.11| Human DNA sequence from clone RP11-719E16 on chromosome 6 Contains the 5' end of the COL19A1 gene for collagen XIX alpha 1 and a CpG island, complete sequence Length = 115224 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 tcaattttgaaaaatatttt 26 |||||||||||||||||||| Sbjct: 29241 tcaattttgaaaaatatttt 29260
>gb|AC130389.3| Drosophila melanogaster 3 BAC CH221-6A19 (Children's Hospital Oakland Research Institute Drosophila melanogaster sheared DNA BAC Library) complete sequence Length = 108834 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 9 aattttgaaaaatattttgatatt 32 ||||||||||||| |||||||||| Sbjct: 43285 aattttgaaaaatgttttgatatt 43262
>gb|AC079733.1| Arabidopsis thaliana chromosome 1 BAC T8L23 genomic sequence, complete sequence Length = 90448 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 2 aaacttcaattttgaaaaatattt 25 |||||| ||||||||||||||||| Sbjct: 60644 aaactttaattttgaaaaatattt 60667
>emb|AL157776.15| Human DNA sequence from clone RP11-68J15 on chromosome 6 Contains part of the NUP153 gene for nucleoporin 153kD, complete sequence Length = 70043 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 aattttgaaaaatattttga 28 |||||||||||||||||||| Sbjct: 36228 aattttgaaaaatattttga 36209
>gb|AC009879.8| Homo sapiens, clone RP11-346I3, complete sequence Length = 191352 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 aattttgaaaaatattttga 28 |||||||||||||||||||| Sbjct: 163225 aattttgaaaaatattttga 163244
>gb|AC105293.2| Drosophila melanogaster 3L BAC RP98-45O17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 190353 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 9 aattttgaaaaatattttgatatt 32 ||||||||||||| |||||||||| Sbjct: 29571 aattttgaaaaatgttttgatatt 29548
>emb|AL732379.5|CNS08C92 Oryza sativa chromosome 3, . BAC OSJNBa0025B02 of library OSJNBa from chromosome 3 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 136470 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ttgaaaaatattttgatatt 32 |||||||||||||||||||| Sbjct: 61038 ttgaaaaatattttgatatt 61057
>gb|AC096505.4| Homo sapiens Xp BAC RP11-10G18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 33389 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 aagagtagcacgaaatggaa 107 |||||||||||||||||||| Sbjct: 16546 aagagtagcacgaaatggaa 16565
>gb|AC123660.8| Mus musculus chromosome 3, clone RP23-196E24, complete sequence Length = 211632 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 3 aacttcaattttgaaaaatatttt 26 ||||||||||||||||||| |||| Sbjct: 24860 aacttcaattttgaaaaatttttt 24837
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 3 aacttcaattttgaaaaatatttt 26 ||||| |||||||||||||||||| Sbjct: 18932795 aacttaaattttgaaaaatatttt 18932818
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ttgaaaaatattttgatatt 32 |||||||||||||||||||| Sbjct: 24546461 ttgaaaaatattttgatatt 24546480
>gb|AC112666.9| Mus musculus chromosome 3, clone RP24-119D5, complete sequence Length = 193302 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 3 aacttcaattttgaaaaatatttt 26 ||||||||||||||||||| |||| Sbjct: 87030 aacttcaattttgaaaaatttttt 87007
>gb|AC010663.6| Drosophila melanogaster 3L BAC RP98-17M18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 193914 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttgatat 31 |||||||||||||| ||||||||| Sbjct: 40221 caattttgaaaaatgttttgatat 40198
>dbj|AP004137.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1297_D02 Length = 104470 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 3 aacttcaattttgaaaaatatttt 26 ||||| |||||||||||||||||| Sbjct: 99548 aacttaaattttgaaaaatatttt 99571
>dbj|AP003947.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1198_B10 Length = 119768 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 3 aacttcaattttgaaaaatatttt 26 ||||| |||||||||||||||||| Sbjct: 17715 aacttaaattttgaaaaatatttt 17738
>gb|AC005720.6|AC005720 Drosophila melanogaster, chromosome 3L, region 79F1-80A2, BAC clone BACR48E05, complete sequence Length = 190390 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 8 caattttgaaaaatattttgatat 31 |||||||||||||| ||||||||| Sbjct: 26124 caattttgaaaaatgttttgatat 26147
>gb|AE003599.2| Drosophila melanogaster chromosome 3L, section 80 of 83 of the complete sequence Length = 250029 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 caattttgaaaaatattttgatat 31 |||||||||||||| ||||||||| Sbjct: 210170 caattttgaaaaatgttttgatat 210147
>gb|AE003467.4| Drosophila melanogaster chromosome 3L, section 1 of 83 of the complete sequence Length = 303512 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 9 aattttgaaaaatattttgatatt 32 ||||||||||||| |||||||||| Sbjct: 43285 aattttgaaaaatgttttgatatt 43262
>gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malayi, complete genome Length = 1080084 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tgaaaaatattttgatattg 33 |||||||||||||||||||| Sbjct: 842137 tgaaaaatattttgatattg 842118
>gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster, complete genome Length = 1267782 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tgaaaaatattttgatattg 33 |||||||||||||||||||| Sbjct: 29095 tgaaaaatattttgatattg 29114
>gb|AC163437.16| Mus musculus chromosome 5, clone RP23-119I18, complete sequence Length = 190996 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 attttgaaaaatattttgat 29 |||||||||||||||||||| Sbjct: 55636 attttgaaaaatattttgat 55655
>emb|AL772407.4| Mouse DNA sequence from clone RP23-112N9 on chromosome 2, complete sequence Length = 202231 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ttttgaaaaatattttgata 30 |||||||||||||||||||| Sbjct: 154369 ttttgaaaaatattttgata 154388
>emb|AL663095.14| Mouse DNA sequence from clone RP23-211M16 on chromosome X, complete sequence Length = 217249 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttcaattttgaaaaatattt 25 |||||||||||||||||||| Sbjct: 73686 ttcaattttgaaaaatattt 73705 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,674,240 Number of Sequences: 3902068 Number of extensions: 2674240 Number of successful extensions: 223443 Number of sequences better than 10.0: 71 Number of HSP's better than 10.0 without gapping: 71 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 222807 Number of HSP's gapped (non-prelim): 636 length of query: 217 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 195 effective length of database: 17,147,199,772 effective search space: 3343703955540 effective search space used: 3343703955540 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
