ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet10f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL138926.13| Human DNA sequence from clone RP11-173E24 on ch... 42 0.27
2gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, c... 40 1.1
3gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, c... 40 1.1
4gb|AC026461.11| Homo sapiens chromosome 16 clone RP11-249C24, co... 40 1.1
5gb|AC093391.5| Homo sapiens BAC clone RP11-798L22 from 2, comple... 40 1.1
6gb|AC009155.3|AC009155 Homo sapiens chromosome 16 clone RP11-5A3... 40 1.1
7gb|AC145952.3| Pan troglodytes BAC clone RP43-18D16 from 7, comp... 38 4.2
8gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome... 38 4.2
9gb|AC083867.7| Homo sapiens chromosome 7 clone RP11-183I20, comp... 38 4.2
10emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosom... 38 4.2
11dbj|AK125867.1| Homo sapiens cDNA FLJ43879 fis, clone TESTI4008993 38 4.2
12gb|AC079033.12| Homo sapiens 12 BAC RP11-453L7 (Roswell Park Can... 38 4.2
13gb|AC114788.4| Homo sapiens BAC clone RP11-648F7 from 2, complet... 38 4.2
14gb|AC024082.6|AC024082 Human Chromosome 7 clone RP11-20M11, comp... 38 4.2
15gb|DQ020489.1| Sus scrofa clone BAC KNP_992H3, complete sequence 38 4.2
16gb|AC007056.4|AC007056 Homo sapiens clone from human chromosome ... 38 4.2
17ref|XM_321513.2| Anopheles gambiae str. PEST ENSANGP00000018135 ... 38 4.2
18gb|AF099810.1|AF099810 Homo sapiens neurexin III-alpha gene, par... 38 4.2
19emb|BX088728.23| Zebrafish DNA sequence from clone CH211-126J24,... 38 4.2
20ref|NM_001001698.1| Homo sapiens FLJ43879 protein (FLJ43879), mRNA 38 4.2

>emb|AL138926.13| Human DNA sequence from clone RP11-173E24 on chromosome 1q31.1-31.3,
              complete sequence
          Length = 169162

 Score = 42.1 bits (21), Expect = 0.27
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 4      atgttccatatgggccctcaa 24
              |||||||||||||||||||||
Sbjct: 137529 atgttccatatgggccctcaa 137549



to top

>gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, complete sequence
          Length = 220334

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 72    catacatccagagtacacacatac 95
             ||||||| ||||||||||||||||
Sbjct: 92264 catacatacagagtacacacatac 92287



to top

>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence
          Length = 192819

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     aattggaaacatttttgata 42
              ||||||||||||||||||||
Sbjct: 105895 aattggaaacatttttgata 105914



to top

>gb|AC026461.11| Homo sapiens chromosome 16 clone RP11-249C24, complete sequence
          Length = 168392

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     tggaaacatttttgatagtg 45
              ||||||||||||||||||||
Sbjct: 107244 tggaaacatttttgatagtg 107263



to top

>gb|AC093391.5| Homo sapiens BAC clone RP11-798L22 from 2, complete sequence
          Length = 121496

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     ttggaaacatttttgatagt 44
              ||||||||||||||||||||
Sbjct: 103511 ttggaaacatttttgatagt 103492



to top

>gb|AC009155.3|AC009155 Homo sapiens chromosome 16 clone RP11-5A3, complete sequence
          Length = 143860

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     tggaaacatttttgatagtg 45
              ||||||||||||||||||||
Sbjct: 117708 tggaaacatttttgatagtg 117689



to top

>gb|AC145952.3| Pan troglodytes BAC clone RP43-18D16 from 7, complete sequence
          Length = 160354

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    tcaattggaaacatttttg 39
             |||||||||||||||||||
Sbjct: 45553 tcaattggaaacatttttg 45535



to top

>gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome 1, complete sequence
          Length = 179626

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    aattggaaacatttttgat 41
             |||||||||||||||||||
Sbjct: 93263 aattggaaacatttttgat 93281



to top

>gb|AC083867.7| Homo sapiens chromosome 7 clone RP11-183I20, complete sequence
          Length = 148251

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    tcaattggaaacatttttg 39
             |||||||||||||||||||
Sbjct: 59954 tcaattggaaacatttttg 59936



to top

>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17
          Length = 147295

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    acaacatcaacgatccgat 65
             |||||||||||||||||||
Sbjct: 77330 acaacatcaacgatccgat 77348



to top

>dbj|AK125867.1| Homo sapiens cDNA FLJ43879 fis, clone TESTI4008993
          Length = 3489

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 22   caattggaaacatttttga 40
            |||||||||||||||||||
Sbjct: 1442 caattggaaacatttttga 1460



to top

>gb|AC079033.12| Homo sapiens 12 BAC RP11-453L7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 150123

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     tggaaacatttttgatagt 44
              |||||||||||||||||||
Sbjct: 130327 tggaaacatttttgatagt 130309



to top

>gb|AC114788.4| Homo sapiens BAC clone RP11-648F7 from 2, complete sequence
          Length = 116951

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 22   caattggaaacatttttga 40
            |||||||||||||||||||
Sbjct: 5948 caattggaaacatttttga 5930



to top

>gb|AC024082.6|AC024082 Human Chromosome 7 clone RP11-20M11, complete sequence
          Length = 157198

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     tcaattggaaacatttttg 39
              |||||||||||||||||||
Sbjct: 145175 tcaattggaaacatttttg 145157



to top

>gb|DQ020489.1| Sus scrofa clone BAC KNP_992H3, complete sequence
          Length = 121023

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    gggccctcaattggaaaca 33
             |||||||||||||||||||
Sbjct: 72177 gggccctcaattggaaaca 72195



to top

>gb|AC007056.4|AC007056 Homo sapiens clone from human chromosome 14q31 region containing gene
             for neurexin III, partial CDS, complete sequence
          Length = 182481

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ttttgatagtgtacaacat 53
             |||||||||||||||||||
Sbjct: 18899 ttttgatagtgtacaacat 18917



to top

>ref|XM_321513.2| Anopheles gambiae str. PEST ENSANGP00000018135 (ENSANGG00000015646),
            partial mRNA
          Length = 5643

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   acaacatcaacgatccgat 65
            |||||||||||||||||||
Sbjct: 3548 acaacatcaacgatccgat 3566



to top

>gb|AF099810.1|AF099810 Homo sapiens neurexin III-alpha gene, partial cds
          Length = 193824

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 35     ttttgatagtgtacaacat 53
              |||||||||||||||||||
Sbjct: 189489 ttttgatagtgtacaacat 189507



to top

>emb|BX088728.23| Zebrafish DNA sequence from clone CH211-126J24, complete sequence
          Length = 168184

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     caattggaaacatttttga 40
              |||||||||||||||||||
Sbjct: 105533 caattggaaacatttttga 105551



to top

>ref|NM_001001698.1| Homo sapiens FLJ43879 protein (FLJ43879), mRNA
          Length = 3489

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 22   caattggaaacatttttga 40
            |||||||||||||||||||
Sbjct: 1442 caattggaaacatttttga 1460


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 873,272
Number of Sequences: 3902068
Number of extensions: 873272
Number of successful extensions: 53748
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53719
Number of HSP's gapped (non-prelim): 29
length of query: 96
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 75
effective length of database: 17,151,101,840
effective search space: 1286332638000
effective search space used: 1286332638000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top