| Clone Name | rbaet10f10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC127272.4| Mus musculus BAC clone RP24-63G5 from chromosome 18, complete sequence Length = 182591 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tctagcaaattcaggctcaca 24 ||||||||||||||||||||| Sbjct: 121615 tctagcaaattcaggctcaca 121595
>gb|AC109217.7| Mus musculus chromosome 18, clone RP23-406P18, complete sequence Length = 196301 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 tctagcaaattcaggctcaca 24 ||||||||||||||||||||| Sbjct: 58673 tctagcaaattcaggctcaca 58653
>gb|AC066590.5| Homo sapiens chromosome 3 clone RP11-324K11 map 3p, complete sequence Length = 185895 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 aacagtgatgttctttgtga 44 |||||||||||||||||||| Sbjct: 3621 aacagtgatgttctttgtga 3602
>emb|AL078645.31|HSG115G20 Human DNA sequence from clone GS1-115G20 on chromosome 1 Contains part of the C1orf21 gene for chromosome 1 open reading frame 21, a novel pseudogene and a novel transcript, complete sequence Length = 206089 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 cacaaacagtgatgttcttt 40 |||||||||||||||||||| Sbjct: 104212 cacaaacagtgatgttcttt 104193
>emb|AL833174.1|HSM804485 Homo sapiens genomic DNA; cDNA DKFZp667A115 (from clone DKFZp667A115) Length = 5251 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 cacaaacagtgatgttcttt 40 |||||||||||||||||||| Sbjct: 892 cacaaacagtgatgttcttt 873
>gb|AC118584.18| Papio anubis clone rp41-78d16, complete sequence Length = 189610 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 taaacccattatctaatttt 105 |||||||||||||||||||| Sbjct: 121613 taaacccattatctaatttt 121632
>gb|AC117273.41| Papio anubis clone rp41-167h10, complete sequence Length = 184931 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 86 taaacccattatctaatttt 105 |||||||||||||||||||| Sbjct: 28679 taaacccattatctaatttt 28660
>gb|AC087857.3| Homo sapiens chromosome 3 clone RP11-149E15 map 3p, complete sequence Length = 173606 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 aacagtgatgttctttgtga 44 |||||||||||||||||||| Sbjct: 71775 aacagtgatgttctttgtga 71756 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,673,433 Number of Sequences: 3902068 Number of extensions: 1673433 Number of successful extensions: 116104 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 116090 Number of HSP's gapped (non-prelim): 14 length of query: 211 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 189 effective length of database: 17,147,199,772 effective search space: 3240820756908 effective search space used: 3240820756908 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)