>gb|AC025571.20| Homo sapiens 3 BAC RP11-515C21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 159902

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 152   actcacatgcatgcacagacac 173
             ||||||||||||||||||||||
Sbjct: 66966 actcacatgcatgcacagacac 66987

>emb|AL591544.30| Mouse DNA sequence from clone RP23-386D6 on chromosome 11, complete
             sequence
          Length = 201673

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   tcacatgcatgcacagacact 174
             |||||||||||||||||||||
Sbjct: 42516 tcacatgcatgcacagacact 42536

>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence
          Length = 177277

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 155    cacatgcatgcacagacactgaac 178
              |||||||||||||| |||||||||
Sbjct: 133853 cacatgcatgcacacacactgaac 133830

>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence
          Length = 245390

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 155   cacatgcatgcacagacactgaac 178
             |||||||||||||| |||||||||
Sbjct: 46326 cacatgcatgcacacacactgaac 46303

>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence
          Length = 166644

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 155   cacatgcatgcacagacactgaac 178
             |||||||||||||| |||||||||
Sbjct: 86180 cacatgcatgcacacacactgaac 86203

>emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chromosome 10 Contains the
             5' end of the SLIT1 gene for slit homolog 1 (Drosophila),
             a novel gene and a CpG island, complete sequence
          Length = 172510

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   tggaggagcagtactgccaa 216
             ||||||||||||||||||||
Sbjct: 39310 tggaggagcagtactgccaa 39329

>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the
              3' end of a variant of the EPM2A gene for progressive
              myoclonus type 2 epilepsy (Lafora disease) protein
              (laforin) and a BTB/POZ domain zinc finger protein
              pseudogene, complete sequence
          Length = 115835

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    tgcatgcacagacactgaac 178
              ||||||||||||||||||||
Sbjct: 106284 tgcatgcacagacactgaac 106265

>gb|AC130886.3| Homo sapiens X BAC RP11-361B16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 79337

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 94    acaaggagtaataactgaagagtgagaa 121
             ||||||||| |||||| |||||||||||
Sbjct: 55973 acaaggagtgataacttaagagtgagaa 55946

>gb|AC012368.6| Homo sapiens BAC clone RP11-547M24 from 2, complete sequence
          Length = 196206

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 155    cacatgcatgcacagacact 174
              ||||||||||||||||||||
Sbjct: 179733 cacatgcatgcacagacact 179714

>emb|BX005274.11| Zebrafish DNA sequence from clone DKEY-77B9 in linkage group 19,
             complete sequence
          Length = 165012

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 282   gttgcattaaattattggcc 301
             ||||||||||||||||||||
Sbjct: 80678 gttgcattaaattattggcc 80697


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,049,367
Number of Sequences: 3902068
Number of extensions: 2049367
Number of successful extensions: 45141
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45125
Number of HSP's gapped (non-prelim): 16
length of query: 330
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 308
effective length of database: 17,147,199,772
effective search space: 5281337529776
effective search space used: 5281337529776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)