ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet10d09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMW... 62 1e-07
2emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein 56 8e-06
3emb|CR555306.1| Azoarcus sp. EbN1 complete genome 50 5e-04
4gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.008
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.008
6dbj|AK100217.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.008
7gb|AF337054.1| Oryza sativa repetitive proline rich protein mRNA... 46 0.008
8gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 46 0.008
9gb|AY172035.1| Silene latifolia Ac-like transposase (Thelma7) ps... 44 0.030
10gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 44 0.030
11tpg|BK003895.1| TPA: TPA_inf: Drosophila melanogaster HDC07105 (... 40 0.47
12gb|AC099006.1| Drosophila melanogaster, chromosome 2R, region 55... 40 0.47
13gb|AE003800.4| Drosophila melanogaster chromosome 2R, section 50... 40 0.47
14gb|AC004295.1|AC004295 Drosophila melanogaster DNA sequence (P1 ... 40 0.47
15ref|XM_610090.2| PREDICTED: Bos taurus similar to Formin 1 isofo... 38 1.8
16ref|NM_001011031.2| Xenopus tropicalis high-mobility group nucle... 38 1.8
17gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 38 1.8
18gb|AC162916.3| Mus musculus BAC clone RP23-395G18 from chromosom... 38 1.8
19gb|AC164553.2| Mus musculus BAC clone RP23-361L12 from chromosom... 38 1.8
20ref|XR_003273.1| PREDICTED: Mus musculus similar to Nonhistone c... 38 1.8
21gb|BC082823.1| Xenopus tropicalis high-mobility group nucleosoma... 38 1.8
22gb|AC097445.1| Drosophila melanogaster, chromosome 2R, region 43... 38 1.8
23gb|AC144773.3| Mus musculus BAC clone RP24-176P22 from 1, comple... 38 1.8
24gb|AE003842.4| Drosophila melanogaster chromosome 2R, section 8 ... 38 1.8
25emb|CR760583.2| Xenopus tropicalis finished cDNA, clone TEgg003n10 38 1.8
26emb|CR761935.2| Xenopus tropicalis finished cDNA, clone TNeu136h04 38 1.8
27gb|AC006469.1|AC006469 Drosophila melanogaster, chromosome 2R, r... 38 1.8
28ref|NM_126176.2| Arabidopsis thaliana fructose-bisphosphate aldo... 36 7.3
29ref|XM_364325.1| Magnaporthe grisea 70-15 hypothetical protein (... 36 7.3
30ref|XM_846273.1| PREDICTED: Canis familiaris similar to Nonhisto... 36 7.3
31gb|BC042705.1| Mus musculus cyclin-dependent kinase-like 5, mRNA... 36 7.3
32ref|XM_742764.1| Aspergillus fumigatus Af293 hypothetical protei... 36 7.3
33gb|AC125074.3| Mus musculus BAC clone RP23-464N18 from chromosom... 36 7.3
34gb|AC125389.33| Medicago truncatula clone mth2-12a18, complete s... 36 7.3
35gb|AC126780.18| Medicago truncatula clone mth2-10n4, complete se... 36 7.3
36emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 i... 36 7.3
37emb|X56434.1|STTONB S.typhimurium tonB gene and P14 gene, partia... 36 7.3
38gb|AE008777.1| Salmonella typhimurium LT2, section 81 of 220 of ... 36 7.3
39emb|BX255277.5| Mouse DNA sequence from clone RP23-478B14 on chr... 36 7.3
40gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich ... 36 7.3
41gb|AC159538.20| Medicago truncatula clone mth2-48f16, complete s... 36 7.3
42gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 36 7.3
43gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map... 36 7.3
44dbj|AK139220.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 36 7.3
45gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosom... 36 7.3
46dbj|AK052380.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 36 7.3
47gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23... 36 7.3
48gb|AF325014.2|AF325014 Arabidopsis thaliana At2g01140 (At2g01140... 36 7.3
49emb|BX088562.12| Zebrafish DNA sequence from clone CH211-286C4 i... 36 7.3
50gb|U72874.1|SPU72874 Strongylocentrotus purpuratus egg receptor ... 36 7.3
51gb|AF251127.1|AF251127 Salmonella typhi TonB (tonB) gene, partia... 36 7.3
52emb|BX820093.1|CNS0A9H9 Arabidopsis thaliana Full-length cDNA Co... 36 7.3
53emb|BX820040.1|CNS0A9FV Arabidopsis thaliana Full-length cDNA Co... 36 7.3
54emb|BX819648.1|CNS0A9G5 Arabidopsis thaliana Full-length cDNA Co... 36 7.3
55gb|AC068901.8|AC068901 Arabidopsis thaliana chromosome 1 BAC F1O... 36 7.3
56ref|NM_214530.1| Strongylocentrotus purpuratus egg receptor for ... 36 7.3
57gb|AY086203.1| Arabidopsis thaliana clone 22418 mRNA, complete s... 36 7.3
58gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 36 7.3
59emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chr... 36 7.3
60gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 36 7.3
61emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j1... 36 7.3
62emb|CT025857.10| Mouse DNA sequence from clone RP24-315F22 on ch... 36 7.3
63gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 36 7.3
64emb|CT571261.1| Medicago truncatula chromosome 5 clone mth2-67l4... 36 7.3
65emb|AL627269.1| Salmonella enterica serovar Typhi (Salmonella ty... 36 7.3
66gb|L04969.1|SUSSPERMRE Strongylocentrotus purpuratus sperm recep... 36 7.3
67emb|AL669939.9| Mouse DNA sequence from clone RP23-213O8 on chro... 36 7.3
68emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chrom... 36 7.3 
>emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMWG0646
          Length = 694

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 9   ttgggctctggcttcggttcgggtttgggcatgggtttgggct 51
           |||||||||||||||||||||||||| ||||| ||||| ||||
Sbjct: 593 ttgggctctggcttcggttcgggttttggcatcggtttaggct 551



 Score = 56.0 bits (28), Expect = 8e-06
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 5   gggtttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||||||| ||||||||||| |||||
Sbjct: 534 gggtttgggctctggctttggttcgggttttggcat 499



 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 6   ggtttgggctctggcttcggttcgggtttgggcat 40
           ||||||||||||||||| ||||||||||| |||||
Sbjct: 491 ggtttgggctctggctttggttcgggttttggcat 457



 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 5   gggtttgggctctggcttcggttcgggtttgggcatggg 43
           |||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 262 gggtttgggctctggctttggttcaggttttggcatggg 224



 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                 
Query: 5  gggtttgggctctggcttcggttcgggtttgggcatggg 43
          |||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 86 gggtttgggctctggctttggttcaggttttggcatggg 48



 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 9   ttgggctctggcttcggttcgggtttgggcatgggtttgggcttg 53
           |||||||| ||||||||||||||||| ||||| || | |||||||
Sbjct: 404 ttgggctcaggcttcggttcgggtttcggcatcggctcgggcttg 360



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 9   ttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||| ||||||||||| |||||
Sbjct: 362 ttgggctctggctttggttcgggttttggcat 331



 Score = 44.1 bits (22), Expect = 0.030
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 6   ggtttgggctctggcttcggttcgggtttgggcatggg 43
           ||||||||||| ||||| || || ||||||||||||||
Sbjct: 449 ggtttgggctcaggcttaggctcaggtttgggcatggg 412



 Score = 44.1 bits (22), Expect = 0.030
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 12  ggctctggcttcggttcgggtttgggcatgggtttgggcttg 53
           ||||||||||| ||||||||||| ||||| || | |||||||
Sbjct: 317 ggctctggctttggttcgggttttggcatcggctcgggcttg 276



 Score = 38.2 bits (19), Expect = 1.8
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 6   ggtttgggctctggcttcggttcgggtttgggcat 40
           ||||||||||| || |||||||| ||||| |||||
Sbjct: 219 ggtttgggctcaggtttcggttctggtttaggcat 185



 Score = 38.2 bits (19), Expect = 1.8
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                             
Query: 6  ggtttgggctctggcttcggttcgggtttgggcat 40
          ||||||||||| || |||||||| ||||| |||||
Sbjct: 43 ggtttgggctcaggtttcggttctggtttaggcat 9
to top
>emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein
          Length = 1487

 Score = 56.0 bits (28), Expect = 8e-06
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 5   gggtttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||||||| ||||| |||||||||||
Sbjct: 944 gggtttgggctctggctttggttctggtttgggcat 909



 Score = 56.0 bits (28), Expect = 8e-06
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 9   ttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||||||||||||||| |||||
Sbjct: 625 ttgggctctggcttcggttcgggttttggcat 594



 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 5   gggtttgggctctggcttcggttcgggtttgggcatgggtttgggcttg 53
           |||||||||||||||||| ||||| ||||| ||||| || | |||||||
Sbjct: 671 gggtttgggctctggctttggttctggtttaggcatcggctcgggcttg 623



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 9   ttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||| ||||||||||| |||||
Sbjct: 730 ttgggctctggcttaggttcgggtttcggcat 699



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 9   ttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||||| ||||| |||||||||||
Sbjct: 520 ttgggctctggctttggttccggtttgggcat 489



 Score = 42.1 bits (21), Expect = 0.12
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 9    ttgggctctggcttcggttcgggtttgggcatgggtttgggcttg 53
            |||||||||||||||||||| || || ||||| || | |||||||
Sbjct: 1078 ttgggctctggcttcggttctggcttcggcattggctcgggcttg 1034



 Score = 42.1 bits (21), Expect = 0.12
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 5   gggtttgggctctggcttcggttcgggtttgggcatgggtttgggcttg 53
           |||||||||||| ||||| ||||| ||||| ||||| || | |||||||
Sbjct: 566 gggtttgggctcgggctttggttcaggttttggcataggctcgggcttg 518



 Score = 40.1 bits (20), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 5   gggtttgggctctggcttcggttc 28
           |||||||||||||||||| |||||
Sbjct: 986 gggtttgggctctggctttggttc 963



 Score = 40.1 bits (20), Expect = 0.47
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 5   gggtttgggctctggcttcggttcgggtttgggcat 40
           |||||||||||| ||||| || || |||||||||||
Sbjct: 902 gggtttgggctcaggcttaggctcaggtttgggcat 867



 Score = 38.2 bits (19), Expect = 1.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 12   ggctctggcttcggttcgggtttgggc 38
            ||||||||||| || ||||||||||||
Sbjct: 1003 ggctctggcttgggctcgggtttgggc 977
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 6       ggtttgggctctggcttcggttcgggtttgggc 38
               |||||||| || |||||||||||||||||||||
Sbjct: 1578326 ggtttgggttcgggcttcggttcgggtttgggc 1578294
to top
>gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_C10,
             complete sequence
          Length = 138209

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 12    ggctctggcttcggttcgggtttgggc 38
             |||||||||||||| ||||||||||||
Sbjct: 58570 ggctctggcttcggctcgggtttgggc 58596



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 6     ggtttgggctctggcttcggtt 27
             ||||||||||||||||| ||||
Sbjct: 83674 ggtttgggctctggctttggtt 83695



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 6     ggtttgggctctggcttcggttcggg 31
             ||||| ||||||||||| ||||||||
Sbjct: 58120 ggtttaggctctggctttggttcggg 58145
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 12      ggctctggcttcggttcgggtttgggc 38
               |||||||||||||| ||||||||||||
Sbjct: 7622175 ggctctggcttcggctcgggtttgggc 7622201



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                     
Query: 6       ggtttgggctctggcttcggtt 27
               ||||||||||||||||| ||||
Sbjct: 7647279 ggtttgggctctggctttggtt 7647300



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                         
Query: 6       ggtttgggctctggcttcggttcggg 31
               ||||| ||||||||||| ||||||||
Sbjct: 7621725 ggtttaggctctggctttggttcggg 7621750
to top
>dbj|AK100217.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023045I16, full
           insert sequence
          Length = 1510

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 12  ggctctggcttcggttcgggtttgggc 38
           |||||||||||||| ||||||||||||
Sbjct: 609 ggctctggcttcggctcgggtttgggc 583



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 6    ggtttgggctctggcttcggttcggg 31
            ||||| ||||||||||| ||||||||
Sbjct: 1059 ggtttaggctctggctttggttcggg 1034
to top
>gb|AF337054.1| Oryza sativa repetitive proline rich protein mRNA, complete cds
          Length = 1493

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 12  ggctctggcttcggttcgggtttgggc 38
           |||||||||||||| ||||||||||||
Sbjct: 578 ggctctggcttcggctcgggtttgggc 552



 Score = 36.2 bits (18), Expect = 7.3
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 6    ggtttgggctctggcttcggttcggg 31
            ||||| ||||||||||| ||||||||
Sbjct: 1028 ggtttaggctctggctttggttcggg 1003
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                              
Query: 4       tgggtttgggctctggcttcggttcgggttt 34
               ||||||||||||| ||||| |||||||||||
Sbjct: 2710031 tgggtttgggctcaggcttgggttcgggttt 2710061
to top
>gb|AY172035.1| Silene latifolia Ac-like transposase (Thelma7) pseudogene, complete
           sequence
          Length = 5174

 Score = 44.1 bits (22), Expect = 0.030
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 28  cgggtttgggcatgggtttggg 49
           ||||||||||||||||||||||
Sbjct: 326 cgggtttgggcatgggtttggg 347
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 44.1 bits (22), Expect = 0.030
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 9       ttgggctctggcttcggttcgggtttgggc 38
               |||||||| ||||| |||||||||||||||
Sbjct: 1281887 ttgggctcgggcttgggttcgggtttgggc 1281858
to top
>tpg|BK003895.1| TPA: TPA_inf: Drosophila melanogaster HDC07105 (HDC07105) gene,
            complete cds
          Length = 4594

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   ggtttgggcatgggtttgggcttg 53
            |||||||| |||||||||||||||
Sbjct: 2384 ggtttgggtatgggtttgggcttg 2407
to top
>gb|AC099006.1| Drosophila melanogaster, chromosome 2R, region 55B-55B, BAC clone
             BACR15G20, complete sequence
          Length = 136164

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    ggtttgggcatgggtttgggcttg 53
             |||||||| |||||||||||||||
Sbjct: 59402 ggtttgggtatgggtttgggcttg 59379
to top
>gb|AE003800.4| Drosophila melanogaster chromosome 2R, section 50 of 73 of the complete
              sequence
          Length = 255380

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 30     ggtttgggcatgggtttgggcttg 53
              |||||||| |||||||||||||||
Sbjct: 169523 ggtttgggtatgggtttgggcttg 169546
to top
>gb|AC004295.1|AC004295 Drosophila melanogaster DNA sequence (P1 DS08374 (D180)), complete
             sequence
          Length = 84551

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 30    ggtttgggcatgggtttgggcttg 53
             |||||||| |||||||||||||||
Sbjct: 17232 ggtttgggtatgggtttgggcttg 17255
to top
>ref|XM_610090.2| PREDICTED: Bos taurus similar to Formin 1 isoform IV (Limb deformity
            protein) (LOC531592), mRNA
          Length = 3048

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 15   tctggcttcggttcgggtttggg 37
            |||||||||||||||| ||||||
Sbjct: 1601 tctggcttcggttcggctttggg 1579
to top
>ref|NM_001011031.2| Xenopus tropicalis high-mobility group nucleosomal binding domain 2
           (hmgn2), mRNA
          Length = 979

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 4   tgggtttgggctctggcttcggt 26
           |||||||||||||||| ||||||
Sbjct: 154 tgggtttgggctctggtttcggt 132
to top
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 19      gcttcggttcgggtttgggcatg 41
               ||||||| |||||||||||||||
Sbjct: 3388531 gcttcggatcgggtttgggcatg 3388553
to top
>gb|AC162916.3| Mus musculus BAC clone RP23-395G18 from chromosome 1, complete sequence
          Length = 224904

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     tgggtttgggctctggctt 22
             |||||||||||||||||||
Sbjct: 36373 tgggtttgggctctggctt 36355
to top
>gb|AC164553.2| Mus musculus BAC clone RP23-361L12 from chromosome 14, complete sequence
          Length = 217754

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 15     tctggcttcggttcgggtttggg 37
              |||||||| ||||||||||||||
Sbjct: 153220 tctggcttgggttcgggtttggg 153242
to top
>ref|XR_003273.1| PREDICTED: Mus musculus similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC635628), mRNA
          Length = 768

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 4   tgggtttgggctctggctt 22
           |||||||||||||||||||
Sbjct: 213 tgggtttgggctctggctt 195
to top
>gb|BC082823.1| Xenopus tropicalis high-mobility group nucleosomal binding domain
           2, mRNA (cDNA clone MGC:79734 IMAGE:6982581), complete
           cds
          Length = 917

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 4   tgggtttgggctctggcttcggt 26
           |||||||||||||||| ||||||
Sbjct: 168 tgggtttgggctctggtttcggt 146
to top
>gb|AC097445.1| Drosophila melanogaster, chromosome 2R, region 43A-43B, BAC clone
              BACR12F04, complete sequence
          Length = 197994

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 31     gtttgggcatgggtttgggcttg 53
              |||||||| ||||||||||||||
Sbjct: 103860 gtttgggcctgggtttgggcttg 103882
to top
>gb|AC144773.3| Mus musculus BAC clone RP24-176P22 from 1, complete sequence
          Length = 167510

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     tgggtttgggctctggctt 22
             |||||||||||||||||||
Sbjct: 24186 tgggtttgggctctggctt 24204
to top
>gb|AE003842.4| Drosophila melanogaster chromosome 2R, section 8 of 73 of the complete
              sequence
          Length = 231065

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 31     gtttgggcatgggtttgggcttg 53
              |||||||| ||||||||||||||
Sbjct: 126216 gtttgggcctgggtttgggcttg 126194
to top
>emb|CR760583.2| Xenopus tropicalis finished cDNA, clone TEgg003n10
          Length = 956

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 4   tgggtttgggctctggcttcggt 26
           |||||||||||||||| ||||||
Sbjct: 129 tgggtttgggctctggtttcggt 107
to top
>emb|CR761935.2| Xenopus tropicalis finished cDNA, clone TNeu136h04
          Length = 979

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 4   tgggtttgggctctggcttcggt 26
           |||||||||||||||| ||||||
Sbjct: 154 tgggtttgggctctggtttcggt 132
to top
>gb|AC006469.1|AC006469 Drosophila melanogaster, chromosome 2R, region 43A1-43A2, P1 clones
             DS02730 and DS07472, complete sequence
          Length = 89938

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 31    gtttgggcatgggtttgggcttg 53
             |||||||| ||||||||||||||
Sbjct: 72126 gtttgggcctgggtttgggcttg 72104
to top
>ref|NM_126176.2| Arabidopsis thaliana fructose-bisphosphate aldolase AT2G01140 mRNA,
            complete cds
          Length = 1515

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1115 catgggtttgggctctgg 1098
to top
>ref|XM_364325.1| Magnaporthe grisea 70-15 hypothetical protein (MG09170.4) partial
            mRNA
          Length = 3303

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 9    ttgggctctggcttcggttcgg 30
            |||||||||||||| |||||||
Sbjct: 1163 ttgggctctggcttaggttcgg 1142
to top
>ref|XM_846273.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC609072), mRNA
          Length = 1511

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 4   tgggtttgggctctggcttcgg 25
           |||| |||||||||||||||||
Sbjct: 541 tgggcttgggctctggcttcgg 520
to top
>gb|BC042705.1| Mus musculus cyclin-dependent kinase-like 5, mRNA (cDNA clone
           IMAGE:4013904), containing frame-shift errors
          Length = 1596

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 8   tttgggctctggcttcgg 25
           ||||||||||||||||||
Sbjct: 754 tttgggctctggcttcgg 737
to top
>ref|XM_742764.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g02200)
           partial mRNA
          Length = 1614

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 27  tcgggtttgggcatgggtttgg 48
           |||||||||||| |||||||||
Sbjct: 219 tcgggtttgggcttgggtttgg 198
to top
>gb|AC125074.3| Mus musculus BAC clone RP23-464N18 from chromosome 14, complete
             sequence
          Length = 181200

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    gggtttgggcatgggttt 46
             ||||||||||||||||||
Sbjct: 36208 gggtttgggcatgggttt 36191
to top
>gb|AC125389.33| Medicago truncatula clone mth2-12a18, complete sequence
          Length = 143015

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 28    cgggtttgggcatgggtttggg 49
             |||||||||| |||||||||||
Sbjct: 59056 cgggtttgggtatgggtttggg 59077
to top
>gb|AC126780.18| Medicago truncatula clone mth2-10n4, complete sequence
          Length = 139213

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    gggtttgggcatgggttt 46
             ||||||||||||||||||
Sbjct: 22420 gggtttgggcatgggttt 22403
to top
>emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 in linkage group 24,
            complete sequence
          Length = 143425

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 4    tgggtttgggctctggct 21
            ||||||||||||||||||
Sbjct: 1940 tgggtttgggctctggct 1923
to top
>emb|X56434.1|STTONB S.typhimurium tonB gene and P14 gene, partial cds
          Length = 950

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 12  ggctctggcttcggttcgggtt 33
           |||||||||| |||||||||||
Sbjct: 356 ggctctggctccggttcgggtt 335
to top
>gb|AE008777.1| Salmonella typhimurium LT2, section 81 of 220 of the complete genome
          Length = 20653

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 12   ggctctggcttcggttcgggtt 33
            |||||||||| |||||||||||
Sbjct: 6472 ggctctggctccggttcgggtt 6493
to top
>emb|BX255277.5| Mouse DNA sequence from clone RP23-478B14 on chromosome 11, complete
              sequence
          Length = 169765

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     gggctctggcttcggttc 28
              ||||||||||||||||||
Sbjct: 162344 gggctctggcttcggttc 162361
to top
>gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich protein mRNA,
           partial sequence
          Length = 1173

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                     
Query: 6   ggtttgggctctggcttcggttcggg 31
           ||||||||||| ||||| ||||||||
Sbjct: 948 ggtttgggctcaggcttgggttcggg 923
to top
>gb|AC159538.20| Medicago truncatula clone mth2-48f16, complete sequence
          Length = 123581

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 29   gggtttgggcatgggttt 46
            ||||||||||||||||||
Sbjct: 7311 gggtttgggcatgggttt 7328
to top
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 1       gcatgggtttgggctctg 18
               ||||||||||||||||||
Sbjct: 3068136 gcatgggtttgggctctg 3068119
to top
>gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map rga, complete
            sequence
          Length = 94029

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 4807 catgggtttgggctctgg 4824
to top
>dbj|AK139220.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:A730073J23
            product:cyclin-dependent kinase-like 5, full insert
            sequence
          Length = 3219

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 8    tttgggctctggcttcgg 25
            ||||||||||||||||||
Sbjct: 1752 tttgggctctggcttcgg 1735
to top
>gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosome 14, complete sequence
          Length = 176992

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      gggtttgggctctggctt 22
              ||||||||||||||||||
Sbjct: 157922 gggtttgggctctggctt 157939
to top
>dbj|AK052380.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:D330045P03
            product:SERINE/THREONINE-PROTEIN KINASE 9 (EC 2.7.1.37)
            homolog [Homo sapiens], full insert sequence
          Length = 2604

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 8    tttgggctctggcttcgg 25
            ||||||||||||||||||
Sbjct: 1777 tttgggctctggcttcgg 1760
to top
>gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23221 proline-rich
           protein mRNA, complete cds
          Length = 1251

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 6   ggtttgggctctggcttcggtt 27
           ||||||||||||||||| ||||
Sbjct: 497 ggtttgggctctggctttggtt 476
to top
>gb|AF325014.2|AF325014 Arabidopsis thaliana At2g01140 (At2g01140/F10A8.2) mRNA, complete cds
          Length = 1470

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1069 catgggtttgggctctgg 1052
to top
>emb|BX088562.12| Zebrafish DNA sequence from clone CH211-286C4 in linkage group 25,
             complete sequence
          Length = 138646

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     tgggtttgggctctggct 21
             ||||||||||||||||||
Sbjct: 12563 tgggtttgggctctggct 12546
to top
>gb|U72874.1|SPU72874 Strongylocentrotus purpuratus egg receptor for sperm mRNA, complete
            cds
          Length = 3753

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 32   tttgggcatgggtttgggcttg 53
            ||||||| ||||||||||||||
Sbjct: 2665 tttgggcttgggtttgggcttg 2644
to top
>gb|AF251127.1|AF251127 Salmonella typhi TonB (tonB) gene, partial cds
          Length = 712

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 12  ggctctggcttcggttcgggtt 33
           |||||||||| |||||||||||
Sbjct: 226 ggctctggctccggttcgggtt 205
to top
>emb|BX820093.1|CNS0A9H9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS72ZH02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1377

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1046 catgggtttgggctctgg 1029
to top
>emb|BX820040.1|CNS0A9FV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS67ZB05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1391

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1049 catgggtttgggctctgg 1032
to top
>emb|BX819648.1|CNS0A9G5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS11ZB01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1421

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1043 catgggtttgggctctgg 1026
to top
>gb|AC068901.8|AC068901 Arabidopsis thaliana chromosome 1 BAC F1O3 genomic sequence, complete
             sequence
          Length = 74265

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 32    tttgggcatgggtttgggcttg 53
             ||||||| ||||||||||||||
Sbjct: 66807 tttgggcttgggtttgggcttg 66786
to top
>ref|NM_214530.1| Strongylocentrotus purpuratus egg receptor for sperm (hsp110), mRNA
          Length = 3753

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 32   tttgggcatgggtttgggcttg 53
            ||||||| ||||||||||||||
Sbjct: 2665 tttgggcttgggtttgggcttg 2644
to top
>gb|AY086203.1| Arabidopsis thaliana clone 22418 mRNA, complete sequence
          Length = 1469

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 2    catgggtttgggctctgg 19
            ||||||||||||||||||
Sbjct: 1069 catgggtttgggctctgg 1052
to top
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 12      ggctctggcttcggttcgggtt 33
               |||||||||| |||||||||||
Sbjct: 1210584 ggctctggctccggttcgggtt 1210563
to top
>emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chromosome 2, complete
            sequence
          Length = 124244

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 4    tgggtttgggctctggcttcggttcgggtttgggcatgggtttggg 49
            ||||||||||||  || || |||| |||||||||  ||||||||||
Sbjct: 4913 tgggtttgggcttgggtttgggtttgggtttgggtttgggtttggg 4958
to top
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                     
Query: 12      ggctctggcttcggttcgggtt 33
               |||||||||| |||||||||||
Sbjct: 1707233 ggctctggctccggttcgggtt 1707254
to top
>emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j18, COMPLETE SEQUENCE
          Length = 142338

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 28    cgggtttgggcatgggtttggg 49
             |||||||||| |||||||||||
Sbjct: 83483 cgggtttgggtatgggtttggg 83462
to top
>emb|CT025857.10| Mouse DNA sequence from clone RP24-315F22 on chromosome 14, complete
            sequence
          Length = 107710

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 5    gggtttgggctctggctt 22
            ||||||||||||||||||
Sbjct: 9137 gggtttgggctctggctt 9154
to top
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                     
Query: 12      ggctctggcttcggttcgggtt 33
               |||||||||| |||||||||||
Sbjct: 1844884 ggctctggctccggttcgggtt 1844905
to top
>emb|CT571261.1| Medicago truncatula chromosome 5 clone mth2-67l4, COMPLETE SEQUENCE
          Length = 136545

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 28    cgggtttgggcatgggtttggg 49
             |||||||||| |||||||||||
Sbjct: 72857 cgggtttgggtatgggtttggg 72836
to top
>emb|AL627269.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 5/20
          Length = 254050

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 12     ggctctggcttcggttcgggtt 33
              |||||||||| |||||||||||
Sbjct: 220950 ggctctggctccggttcgggtt 220929
to top
>gb|L04969.1|SUSSPERMRE Strongylocentrotus purpuratus sperm receptor mRNA, complete cds
          Length = 3531

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 32   tttgggcatgggtttgggcttg 53
            ||||||| ||||||||||||||
Sbjct: 2665 tttgggcttgggtttgggcttg 2644
to top
>emb|AL669939.9| Mouse DNA sequence from clone RP23-213O8 on chromosome X, complete
              sequence
          Length = 178116

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 8      tttgggctctggcttcgg 25
              ||||||||||||||||||
Sbjct: 108274 tttgggctctggcttcgg 108291
to top
>emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chromosome 4, complete
             sequence
          Length = 110623

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 34    tgggcatgggtttgggct 51
             ||||||||||||||||||
Sbjct: 91816 tgggcatgggtttgggct 91799


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 291,231
Number of Sequences: 3902068
Number of extensions: 291231
Number of successful extensions: 76919
Number of sequences better than 10.0: 68
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76465
Number of HSP's gapped (non-prelim): 454
length of query: 53
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 33
effective length of database: 17,155,003,908
effective search space: 566115128964
effective search space used: 566115128964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top