ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet10c06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 101 bits (51), Expect = 9e-19 Identities = 63/67 (94%) Strand = Plus / Minus Query: 154 ttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 ||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||| Sbjct: 864 ttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgga 805 Query: 214 gaggtgg 220 ||||||| Sbjct: 804 gaggtgg 798
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 97.6 bits (49), Expect = 1e-17 Identities = 61/65 (93%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 ||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749 Query: 216 ggtgg 220 ||||| Sbjct: 748 ggtgg 744
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 97.6 bits (49), Expect = 1e-17 Identities = 61/65 (93%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| ||||||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779 Query: 216 ggtgg 220 ||||| Sbjct: 778 ggtgg 774
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 93.7 bits (47), Expect = 2e-16 Identities = 62/67 (92%) Strand = Plus / Minus Query: 154 ttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 810 ttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggc 751 Query: 214 gaggtgg 220 || |||| Sbjct: 750 gatgtgg 744
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 93.7 bits (47), Expect = 2e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || |||||||||||||||||||| || |||||||||||||||||||||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808 Query: 218 tgg 220 ||| Sbjct: 807 tgg 805
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737 Query: 216 ggtgg 220 ||||| Sbjct: 736 ggtgg 732
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725 Query: 216 ggtgg 220 ||||| Sbjct: 724 ggtgg 720
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186 Query: 216 ggtgg 220 ||||| Sbjct: 1185 ggtgg 1181
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937 Query: 216 ggtgg 220 ||||| Sbjct: 13938 ggtgg 13942
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074 Query: 216 ggtgg 220 ||||| Sbjct: 30025073 ggtgg 30025069 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268 Query: 216 ggtgg 220 ||||| Sbjct: 23604267 ggtgg 23604263
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064 Query: 216 ggtgg 220 ||||| Sbjct: 21063 ggtgg 21059
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967 Query: 216 ggtgg 220 ||||| Sbjct: 66966 ggtgg 66962
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796 Query: 216 ggtgg 220 ||||| Sbjct: 795 ggtgg 791
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795 Query: 216 ggtgg 220 ||||| Sbjct: 794 ggtgg 790
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225 Query: 216 ggtgg 220 ||||| Sbjct: 1224 ggtgg 1220
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818 Query: 216 ggtgg 220 ||||| Sbjct: 817 ggtgg 813
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818 Query: 216 ggtgg 220 ||||| Sbjct: 817 ggtgg 813
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820 Query: 216 ggtgg 220 ||||| Sbjct: 819 ggtgg 815
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325 Query: 216 ggtgg 220 ||||| Sbjct: 324 ggtgg 320
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803 Query: 216 ggtgg 220 ||||| Sbjct: 802 ggtgg 798
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 89.7 bits (45), Expect = 3e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820 Query: 216 ggtgg 220 ||||| Sbjct: 819 ggtgg 815
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 89.7 bits (45), Expect = 3e-15 Identities = 57/61 (93%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134 Query: 216 g 216 | Sbjct: 1133 g 1133
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 87.7 bits (44), Expect = 1e-14 Identities = 59/64 (92%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| |||||||||||||| || ||||| || |||||||||||||||||||||| Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411 Query: 216 ggtg 219 |||| Sbjct: 410 ggtg 407
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 87.7 bits (44), Expect = 1e-14 Identities = 59/64 (92%) Strand = Plus / Minus Query: 153 tttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcgg 212 ||||||||||||| || |||||||||||||||||||| || |||||||| |||||||||| Sbjct: 976 tttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcgg 917 Query: 213 cgag 216 |||| Sbjct: 916 cgag 913
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721 Query: 216 ggtgg 220 ||||| Sbjct: 10793720 ggtgg 10793716
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444 Query: 216 ggtgg 220 ||||| Sbjct: 17443 ggtgg 17439
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339 Query: 216 ggtgg 220 ||||| Sbjct: 130338 ggtgg 130334
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789 Query: 216 ggtgg 220 ||||| Sbjct: 788 ggtgg 784
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 216 ggtgg 220 ||||| Sbjct: 793 ggtgg 789
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796 Query: 216 ggtgg 220 ||||| Sbjct: 795 ggtgg 791
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 216 ggtgg 220 ||||| Sbjct: 793 ggtgg 789
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 216 ggtgg 220 ||||| Sbjct: 793 ggtgg 789
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 81.8 bits (41), Expect = 8e-13 Identities = 59/65 (90%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775 Query: 216 ggtgg 220 ||||| Sbjct: 774 ggtgg 770
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 77.8 bits (39), Expect = 1e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 170 aagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 |||||||||||||||||||| || ||||||||||||||||| ||||||||| Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtgg 643
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 1751
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||| Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 803
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||||||||| || |||||||||||| ||||||| || |||||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 1751
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 73.8 bits (37), Expect = 2e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || ||||||||||||||||||| || Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660 Query: 216 ggtgg 220 ||||| Sbjct: 2659 ggtgg 2655
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 73.8 bits (37), Expect = 2e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||||||||||| || ||||||||||| ||||| || | Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767 Query: 216 ggtgg 220 ||||| Sbjct: 766 ggtgg 762
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 73.8 bits (37), Expect = 2e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||||||||||| || |||||| |||||||||||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcga 1473 Query: 216 ggtgg 220 |||| Sbjct: 1472 tgtgg 1468
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 69.9 bits (35), Expect = 3e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 153 tttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcgg 212 ||||||| || || ||||||||||||||| ||||||| || ||||||||||| ||||||| Sbjct: 852 tttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcgg 793 Query: 213 cgaggtg 219 | ||||| Sbjct: 792 caaggtg 786
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 752
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 93262 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 96055
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 80940 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 78147
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 110
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 771
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 145
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 1039
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 67.9 bits (34), Expect = 1e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 ||||| || ||||||||||||||| ||||||| || ||||||||||| ||||| |||||| Sbjct: 834 ttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgagg 775 Query: 218 tg 219 || Sbjct: 774 tg 773
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 65.9 bits (33), Expect = 5e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| || | Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128 Query: 216 ggtgg 220 ||||| Sbjct: 127 ggtgg 123
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 63.9 bits (32), Expect = 2e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| || | Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970 Query: 216 ggtg 219 |||| Sbjct: 969 ggtg 966
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 63.9 bits (32), Expect = 2e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| ||||||| || ||||||||||| ||||| || | Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762 Query: 216 ggtg 219 |||| Sbjct: 761 ggtg 758
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 61.9 bits (31), Expect = 8e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||| ||||| |||||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161 Score = 60.0 bits (30), Expect = 3e-06 Identities = 60/70 (85%) Strand = Plus / Plus Query: 151 tgtttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||| |||| ||||| |||||||| |||||||||||||| || |||||||| || ||||| Sbjct: 8568 tgttcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtc 8627 Query: 211 ggcgaggtgg 220 |||| |||| Sbjct: 8628 agcgatgtgg 8637
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 61.9 bits (31), Expect = 8e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||| || |||||||||||| ||||||| || |||||||| ||||||||||| ||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtg 834
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 61.9 bits (31), Expect = 8e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || ||||| ||||| || ||||| || |||||||||||||||||||||| | Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756 Query: 218 tgg 220 ||| Sbjct: 755 tgg 753
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 61.9 bits (31), Expect = 8e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || |||||||||||| ||||||| || ||||||||||| ||||| |||| | Sbjct: 1676 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatg 1617 Query: 218 tgg 220 ||| Sbjct: 1616 tgg 1614
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 61.9 bits (31), Expect = 8e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||| || |||||||||||| | ||||| || |||||||||||||||||||| ||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtg 331
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 757
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 60.0 bits (30), Expect = 3e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || |||||||||||| ||||||| || |||||||| |||||||| || ||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801 Query: 218 tg 219 || Sbjct: 800 tg 799
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 127
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 792
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||||||||||| || |||||||| || |||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggc 771
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 703
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 16158
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 60.0 bits (30), Expect = 3e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 974
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 60.0 bits (30), Expect = 3e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || |||||||||||| ||||||| || |||||||| |||||||| || ||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810 Query: 218 tg 219 || Sbjct: 809 tg 808
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| ||||||| || ||||||||||| |||||||| Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 79033 Query: 216 ggtgg 220 |||| Sbjct: 79034 cgtgg 79038
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 58.0 bits (29), Expect = 1e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||||||||||||||| || ||||||||||| Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 582
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21808783 Query: 216 ggtgg 220 |||| Sbjct: 21808782 cgtgg 21808778
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 58.0 bits (29), Expect = 1e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||||||||||||||| || ||||||||||| Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21801812 Query: 216 ggtgg 220 |||| Sbjct: 21801811 cgtgg 21801807
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 58.0 bits (29), Expect = 1e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 ||||||||||||||||| || ||||||||||| |||||||| Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| || |||||||||||| ||||||| || ||||||||||| ||||| || | Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789 Query: 216 ggtgg 220 ||||| Sbjct: 788 ggtgg 784
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 58.0 bits (29), Expect = 1e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||||||||||||||| || ||||||||||| Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 782 Query: 216 ggtgg 220 |||| Sbjct: 781 cgtgg 777
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 357 Query: 216 ggtgg 220 |||| Sbjct: 356 cgtgg 352
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| || |||||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 771 Query: 216 ggtgg 220 |||| Sbjct: 770 cgtgg 766
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||||||||| ||||| ||||||||| | ||||| || |||||| |||||||||||||| Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcga 778 Query: 216 ggtgg 220 |||| Sbjct: 777 cgtgg 773
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 58.0 bits (29), Expect = 1e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||||||||| ||||||| || ||||||||||| ||||| || | Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931 Query: 216 ggtgg 220 ||||| Sbjct: 930 ggtgg 926
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 56.0 bits (28), Expect = 5e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 168 caaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||||| |||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 802 caaagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtg 751
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 56.0 bits (28), Expect = 5e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgag 216 ||||| |||||||| |||||||||||||| || ||||| ||||| ||||| ||||| Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgag 944
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||| ||||| |||||||||||||| || ||||| || ||||||||||| ||||| Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtc 797
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||| ||||| |||||||||||||| ||||||| || ||||||||||| ||||| Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||| ||||| || |||||||| ||||||||||| || ||||||||||| ||||| Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 54.0 bits (27), Expect = 2e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||||||| ||||||| || |||||||| ||||||||||| ||||| Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtg 827
>gb|AY104614.1| Zea mays PCO084486 mRNA sequence Length = 1214 Score = 54.0 bits (27), Expect = 2e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 194 ttgttgttgacggggtcggcgaggtgg 220 ||||||||||||||||||||||||||| Sbjct: 953 ttgttgttgacggggtcggcgaggtgg 927
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 52.0 bits (26), Expect = 7e-04 Identities = 44/50 (88%) Strand = Plus / Minus Query: 170 aagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||||||||| || ||||| || |||||||||||||| ||||| ||||| Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtg 609
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 52.0 bits (26), Expect = 7e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || ||||||||||| ||||||| || |||||| | ||||||||||| ||| Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825 Query: 218 tg 219 || Sbjct: 824 tg 823
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 52.0 bits (26), Expect = 7e-04 Identities = 51/58 (87%), Gaps = 1/58 (1%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| |||||||||||||| |||||||| || ||||||||||| || ||||| Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggc 783
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 52.0 bits (26), Expect = 7e-04 Identities = 50/58 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||| ||||| || |||||||||||| ||||||| || ||||||| ||| |||||||| Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggc 781
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 52.0 bits (26), Expect = 7e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || ||||||||||| ||||||| || |||||| | ||||||||||| ||| Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903 Query: 218 tg 219 || Sbjct: 1902 tg 1901
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 52.0 bits (26), Expect = 7e-04 Identities = 44/50 (88%) Strand = Plus / Minus Query: 170 aagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||||||||| ||||||| || |||||||| ||||||||||| ||||| Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtg 224
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || ||||||||||| |||||||| || ||||||||||| Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 819
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 471
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 50.1 bits (25), Expect = 0.003 Identities = 46/53 (86%) Strand = Plus / Minus Query: 167 acaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtg 219 ||||| || ||||| ||||||||||| |||||||| |||||||| || ||||| Sbjct: 909 acaaaatttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtg 857
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 1051
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 50.1 bits (25), Expect = 0.003 Identities = 55/65 (84%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| ||||||||||||||| ||| ||| || |||||||| || ||||| || | Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810 Query: 216 ggtgg 220 ||||| Sbjct: 809 ggtgg 805
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 153 tttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 ||||||| ||||| |||||||||||||| ||||||| || |||||||| Sbjct: 825 tttactttccggggacaaagttggtggcataggcccatgcattgttgtt 777
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 50.1 bits (25), Expect = 0.003 Identities = 46/53 (86%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 |||||||| ||||||||||| | | |||||| ||||||||||| |||||||| Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggc 942
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 769
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 793
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 793
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 795
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 800
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 833
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 22434806
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 95873
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 769
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 793
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 793
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 798
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 794
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 48.1 bits (24), Expect = 0.011 Identities = 42/48 (87%) Strand = Plus / Minus Query: 173 ttggtggcgaaggcccacgctttgttgttgacggggtcggcgaggtgg 220 ||||||||| || |||| || |||||| ||||||||||||||||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtgg 800
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 48.1 bits (24), Expect = 0.011 Identities = 39/44 (88%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 ||||| |||||||| ||||| |||||||| || ||||||||||| Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgac 748
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 46.1 bits (23), Expect = 0.045 Identities = 51/59 (86%), Gaps = 1/59 (1%) Strand = Plus / Plus Query: 156 acttgccgggcacaaagttggtggcgaaggccc-acgctttgttgttgacggggtcggc 213 |||| ||||| ||||||||||| |||||||||| | || ||||||||||| || ||||| Sbjct: 53 actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 46.1 bits (23), Expect = 0.045 Identities = 53/63 (84%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || ||||| |||||| | ||||| || |||||| |||||||||||||| | Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765 Query: 218 tgg 220 ||| Sbjct: 764 tgg 762
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 46.1 bits (23), Expect = 0.045 Identities = 53/63 (84%) Strand = Plus / Minus Query: 158 ttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcgagg 217 |||||||| || ||||| |||||| | ||||| || |||||| |||||||||||||| | Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413 Query: 218 tgg 220 ||| Sbjct: 412 tgg 410
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 46.1 bits (23), Expect = 0.045 Identities = 53/63 (84%) Strand = Plus / Minus Query: 153 tttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcgg 212 |||| |||||||| || |||||||||||| | ||||| || |||||| ||||||||| | Sbjct: 579 tttagttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcag 520 Query: 213 cga 215 ||| Sbjct: 519 cga 517
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 46.1 bits (23), Expect = 0.045 Identities = 47/55 (85%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||||||||| ||||||| || ||||||||||| || |||||||| || ||||| Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 44.1 bits (22), Expect = 0.18 Identities = 40/46 (86%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgtt 201 |||| ||||| |||||||||||||| ||||||| || |||||||| Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtt 535
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 44.1 bits (22), Expect = 0.18 Identities = 52/62 (83%) Strand = Plus / Minus Query: 149 agtgtttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacgggg 208 |||||||| || ||||| |||||||||||||| | | ||| || ||||||||||| ||| Sbjct: 1524 agtgtttattttccgggaacaaagttggtggcatatgaccatgcattgttgttgactggg 1465 Query: 209 tc 210 || Sbjct: 1464 tc 1463
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 44.1 bits (22), Expect = 0.18 Identities = 52/62 (83%) Strand = Plus / Minus Query: 149 agtgtttacttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacgggg 208 |||||||| || ||||| |||||||||||||| | | ||| || ||||||||||| ||| Sbjct: 1825 agtgtttattttccgggaacaaagttggtggcatatgaccatgcattgttgttgactggg 1766 Query: 209 tc 210 || Sbjct: 1765 tc 1764
>emb|AL138926.13| Human DNA sequence from clone RP11-173E24 on chromosome 1q31.1-31.3, complete sequence Length = 169162 Score = 42.1 bits (21), Expect = 0.71 Identities = 21/21 (100%) Strand = Plus / Plus Query: 39 atgttccatatgggccctcaa 59 ||||||||||||||||||||| Sbjct: 137529 atgttccatatgggccctcaa 137549
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 42.1 bits (21), Expect = 0.71 Identities = 54/65 (83%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||| ||||| | ||||| || ||||||||||| ||||| || | Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcagcaa 789 Query: 216 ggtgg 220 ||||| Sbjct: 788 ggtgg 784
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 42.1 bits (21), Expect = 0.71 Identities = 45/53 (84%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 ||||| || |||||||||||| ||||||| || |||||| ||||||||||| Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggc 2965
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 42.1 bits (21), Expect = 0.71 Identities = 42/49 (85%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgac 204 |||| ||||| || ||||||||||| ||||||| || ||||||||||| Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992
>gb|AY653733.1| Acanthamoeba polyphaga mimivirus, complete genome Length = 1181404 Score = 42.1 bits (21), Expect = 0.71 Identities = 24/25 (96%) Strand = Plus / Minus Query: 81 tacaacatcaacgatccgatattag 105 ||||||||||| ||||||||||||| Sbjct: 68412 tacaacatcaaggatccgatattag 68388
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 42.1 bits (21), Expect = 0.71 Identities = 54/65 (83%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||||||||| ||| ||| || |||||||| || ||||| || | Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792 Query: 216 ggtgg 220 ||||| Sbjct: 791 ggtgg 787
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 42.1 bits (21), Expect = 0.71 Identities = 45/53 (84%) Strand = Plus / Minus Query: 161 ccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggc 213 ||||| || |||||||||||| ||||||| || |||||| ||||||||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggc 787
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 42.1 bits (21), Expect = 0.71 Identities = 48/57 (84%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcgg 212 |||||||||| || |||||||||||| | | ||| || |||||| ||||||||||| Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcgg 766
>gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, complete sequence Length = 220334 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 107 catacatccagagtacacacatac 130 ||||||| |||||||||||||||| Sbjct: 92264 catacatacagagtacacacatac 92287
>gb|DP000032.1| Felis catus target 116 genomic scaffold Length = 376810 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 aaaccatgcatttctcatat 29 |||||||||||||||||||| Sbjct: 108334 aaaccatgcatttctcatat 108353
>emb|AL824704.27| Mouse DNA sequence from clone RP23-286H14 on chromosome 4, complete sequence Length = 205555 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 acacacatactcatgaaaac 140 |||||||||||||||||||| Sbjct: 73413 acacacatactcatgaaaac 73432
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 40.1 bits (20), Expect = 2.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 151 tgtttacttgccgggcacaaagttggtggcgaaggcccacgctttgtt 198 |||| |||| ||||| ||||||||||||||| | ||||| || ||||| Sbjct: 967 tgttcactttccgggaacaaagttggtggcgtaagcccaggcattgtt 920
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 gttgttgacggggtcggcga 215 |||||||||||||||||||| Sbjct: 357104 gttgttgacggggtcggcga 357085
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 40.1 bits (20), Expect = 2.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 167 acaaagttggtggcgaaggcccacgctttgttgttgacggggtc 210 |||||||||||||| ||||||| || |||||||| || ||||| Sbjct: 65572 acaaagttggtggcataggcccaggcattgttgttaactgggtc 65615
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 40.1 bits (20), Expect = 2.8 Identities = 53/64 (82%) Strand = Plus / Minus Query: 156 acttgccgggcacaaagttggtggcgaaggcccacgctttgttgttgacggggtcggcga 215 |||| ||||| |||||||| ||||| | ||||| || ||||||||||| ||||| || | Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagcaa 1491 Query: 216 ggtg 219 |||| Sbjct: 1490 ggtg 1487 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,227,765 Number of Sequences: 3902068 Number of extensions: 2227765 Number of successful extensions: 146550 Number of sequences better than 10.0: 188 Number of HSP's better than 10.0 without gapping: 188 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 145959 Number of HSP's gapped (non-prelim): 591 length of query: 220 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 198 effective length of database: 17,147,199,772 effective search space: 3395145554856 effective search space used: 3395145554856 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
