ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet08e01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC031430.1| Mus musculus nucleotide binding protein 1, mRNA (cDNA clone IMAGE:3674511), containing frame-shift errors Length = 2154 Score = 40.1 bits (20), Expect = 0.37 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 ctggaagggctggacatcca 36 |||||||||||||||||||| Sbjct: 1932 ctggaagggctggacatcca 1913
>gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosome 16, complete sequence Length = 196519 Score = 40.1 bits (20), Expect = 0.37 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 ctggaagggctggacatcca 36 |||||||||||||||||||| Sbjct: 20119 ctggaagggctggacatcca 20100
>gb|BC068110.1| Mus musculus similar to RIKEN cDNA 1810036I24, mRNA (cDNA clone MGC:92960 IMAGE:5696118), complete cds Length = 3321 Score = 40.1 bits (20), Expect = 0.37 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 ctggaagggctggacatcca 36 |||||||||||||||||||| Sbjct: 945 ctggaagggctggacatcca 964
>ref|NM_001013778.1| Mus musculus similar to RIKEN cDNA 1810036I24 (LOC383103), mRNA Length = 3321 Score = 40.1 bits (20), Expect = 0.37 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 ctggaagggctggacatcca 36 |||||||||||||||||||| Sbjct: 945 ctggaagggctggacatcca 964
>gb|AC121874.2| Mus musculus BAC clone RP24-124K16 from 18, complete sequence Length = 164190 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 11 aaatgtctggaagggctgg 29 ||||||||||||||||||| Sbjct: 48711 aaatgtctggaagggctgg 48729
>gb|AC138714.4| Mus musculus chromosome 18 clone RP23-406C12, complete sequence Length = 191928 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 11 aaatgtctggaagggctgg 29 ||||||||||||||||||| Sbjct: 162846 aaatgtctggaagggctgg 162864
>gb|AC153145.4| Mus musculus BAC clone RP23-222C3 from chromosome 18, complete sequence Length = 193382 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 11 aaatgtctggaagggctgg 29 ||||||||||||||||||| Sbjct: 162839 aaatgtctggaagggctgg 162857
>gb|AE004989.1| Halobacterium sp. NRC-1 section 20 of 170 of the complete genome Length = 14108 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 16 tctggaagggctggacatc 34 ||||||||||||||||||| Sbjct: 6070 tctggaagggctggacatc 6052
>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome Length = 2572079 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 25 gctggacatccatttatt 42 |||||||||||||||||| Sbjct: 304788 gctggacatccatttatt 304805
>gb|AC134848.2| Mus musculus BAC clone RP24-196B3 from chromosome 8, complete sequence Length = 149146 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 8 tacaaatgtctggaaggg 25 |||||||||||||||||| Sbjct: 46073 tacaaatgtctggaaggg 46056
>gb|BC040390.1| Mus musculus Ras and Rab interactor 2, mRNA (cDNA clone MGC:27785 IMAGE:3156682), complete cds Length = 4664 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 4095 ggacatccatttatttgg 4112
>gb|AC158616.8| Mus musculus 10 BAC RP23-227E23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 248127 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 accccattacaaatgtct 18 |||||||||||||||||| Sbjct: 65448 accccattacaaatgtct 65431
>gb|AC159502.12| Mus musculus 10 BAC RP23-113B7 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 226276 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 accccattacaaatgtct 18 |||||||||||||||||| Sbjct: 44189 accccattacaaatgtct 44206
>ref|XM_904046.2| PREDICTED: Mus musculus Ras and Rab interactor 2, transcript variant 4 (Rin2), mRNA Length = 2784 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2229 ggacatccatttatttgg 2246
>ref|XM_904047.2| PREDICTED: Mus musculus Ras and Rab interactor 2, transcript variant 5 (Rin2), mRNA Length = 2671 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2116 ggacatccatttatttgg 2133
>ref|XM_623023.3| PREDICTED: Mus musculus Ras and Rab interactor 2, transcript variant 3 (Rin2), mRNA Length = 4247 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 3692 ggacatccatttatttgg 3709
>emb|AJ243754.2|SAL243754 Sinapis alba chloroplast rpoB operon (rpoB, rpoC1 and rpoC2 genes) Length = 11206 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 attacaaatgtctggaag 23 |||||||||||||||||| Sbjct: 5901 attacaaatgtctggaag 5884
>gb|BC005529.1| Mus musculus Ras and Rab interactor 2, mRNA (cDNA clone MGC:7647 IMAGE:3495681), complete cds Length = 3118 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2535 ggacatccatttatttgg 2552
>gb|AC153015.4| Mus musculus BAC clone RP23-200I3 from chromosome 8, complete sequence Length = 232038 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tacaaatgtctggaaggg 25 |||||||||||||||||| Sbjct: 37821 tacaaatgtctggaaggg 37838
>gb|AC103574.7| Rattus norvegicus 1 BAC CH230-205C19 (Children's Hospital Oakland Research Institute) complete sequence Length = 199047 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 27 tggacatccatttatttg 44 |||||||||||||||||| Sbjct: 7487 tggacatccatttatttg 7470
>emb|AL008731.1|HS514K20 Human DNA sequence from clone RP3-514K20 on chromosome 6p22.3-24.3 Contains a CpG island, complete sequence Length = 100368 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 gtctggaagggctggaca 32 |||||||||||||||||| Sbjct: 10851 gtctggaagggctggaca 10834
>emb|AJ400848.1|SOL400848 Spinacia oleracea complete chloroplast genome Length = 150725 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 attacaaatgtctggaag 23 |||||||||||||||||| Sbjct: 20393 attacaaatgtctggaag 20410
>gb|AC073437.50| Mus musculus strain 129/Sv chromosome 2 clone ct7-531j6, complete sequence Length = 176056 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 56386 ggacatccatttatttgg 56403
>dbj|AK152025.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830045I08 product:Ras and Rab interactor 2, full insert sequence Length = 3090 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2548 ggacatccatttatttgg 2565
>dbj|AK152893.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830089I21 product:Ras and Rab interactor 2, full insert sequence Length = 4458 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 3911 ggacatccatttatttgg 3928
>dbj|AK150680.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830013K04 product:Ras and Rab interactor 2, full insert sequence Length = 4457 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 3910 ggacatccatttatttgg 3927
>dbj|AK151332.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830028C17 product:Ras and Rab interactor 2, full insert sequence Length = 4414 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 3867 ggacatccatttatttgg 3884
>dbj|AK154421.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630030I04 product:Ras and Rab interactor 2, full insert sequence Length = 3053 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2520 ggacatccatttatttgg 2537
>dbj|AK171064.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630222A07 product:Ras and Rab interactor 2, full insert sequence Length = 3042 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2488 ggacatccatttatttgg 2505
>dbj|AK163047.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430098L20 product:Ras and Rab interactor 2, full insert sequence Length = 3195 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 3088 ggacatccatttatttgg 3105
>dbj|AK014548.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library, clone:4632403N06 product:RAS INHIBITOR (FRAGMENT) homolog [Homo sapiens], full insert sequence Length = 2681 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2574 ggacatccatttatttgg 2591
>dbj|AK040763.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length enriched library, clone:A530023H11 product:Ras inhibitor (clone JC265) (fragment) homolog [Homo sapiens], full insert sequence Length = 2794 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 2575 ggacatccatttatttgg 2592
>gb|DQ231548.1| Brassica rapa subsp. pekinensis chloroplast sequence Length = 153482 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 attacaaatgtctggaag 23 |||||||||||||||||| Sbjct: 20689 attacaaatgtctggaag 20706
>gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold Length = 1787293 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 22 agggctggacatccattt 39 |||||||||||||||||| Sbjct: 1364362 agggctggacatccattt 1364345
>gb|AC022655.8| Homo sapiens, clone RP11-28O3, complete sequence Length = 142630 Score = 36.2 bits (18), Expect = 5.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 3 cccattacaaatgtctggaagg 24 ||||||| |||||||||||||| Sbjct: 45245 cccattagaaatgtctggaagg 45224
>gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, complete sequence Length = 205069 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 caaatgtctggaagggct 27 |||||||||||||||||| Sbjct: 72183 caaatgtctggaagggct 72166
>gb|AC022898.11| Homo sapiens chromosome 15, clone RP11-554D20, complete sequence Length = 200380 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 152591 ggacatccatttatttgg 152608
>ref|NM_028724.2| Mus musculus Ras and Rab interactor 2 (Rin2), mRNA Length = 4664 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 4095 ggacatccatttatttgg 4112
>gb|AC154211.1| Mus musculus BAC clone RP24-113P8 from 17, complete sequence Length = 146732 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 93630 ggacatccatttatttgg 93613
>emb|AL844195.12| Mouse DNA sequence from clone RP23-144K11 on chromosome X, complete sequence Length = 180916 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 23 gggctggacatccattta 40 |||||||||||||||||| Sbjct: 17025 gggctggacatccattta 17042
>dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, complete sequence, strain:Columbia Length = 154478 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 attacaaatgtctggaag 23 |||||||||||||||||| Sbjct: 21062 attacaaatgtctggaag 21079
>emb|AL672100.7| Mouse DNA sequence from clone RP23-125A1 on chromosome 2, complete sequence Length = 196421 Score = 36.2 bits (18), Expect = 5.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 28 ggacatccatttatttgg 45 |||||||||||||||||| Sbjct: 129054 ggacatccatttatttgg 129071 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 504,756 Number of Sequences: 3902068 Number of extensions: 504756 Number of successful extensions: 123552 Number of sequences better than 10.0: 42 Number of HSP's better than 10.0 without gapping: 42 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 123460 Number of HSP's gapped (non-prelim): 92 length of query: 46 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 26 effective length of database: 17,155,003,908 effective search space: 446030101608 effective search space used: 446030101608 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)
