>ref|XM_517647.1| PREDICTED: Pan troglodytes similar to KIAA0878 protein (LOC461743),
            mRNA
          Length = 3374

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 214  taaaactaaggctttcactct 234
            |||||||||||||||||||||
Sbjct: 2680 taaaactaaggctttcactct 2700

>ref|NM_014899.2| Homo sapiens Rho-related BTB domain containing 3 (RHOBTB3), mRNA
          Length = 4122

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 214  taaaactaaggctttcactct 234
            |||||||||||||||||||||
Sbjct: 2374 taaaactaaggctttcactct 2394

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 125    gccgcatggcgagaacaccta 145
              |||||||||||||||||||||
Sbjct: 458722 gccgcatggcgagaacaccta 458742

>emb|AL080315.18|HSDJ6P5 Human DNA sequence from clone RP1-6P5 on chromosome 6 Contains a
              eukaryotic translation elongation factor 1 delta (guanine
              nucleotide exchange protein) (EEF1D) pseudogene and a
              ribosomal protein L21 (RPL21) pseudogene, complete sequence
          Length = 158980

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     atattacatcaatcactttca 69
              |||||||||||||||||||||
Sbjct: 136757 atattacatcaatcactttca 136737

>gb|AC110747.3| Homo sapiens, clone RP11-103L16, complete sequence
          Length = 140919

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 42    ttctgcaatattacatcaatc 62
             |||||||||||||||||||||
Sbjct: 78463 ttctgcaatattacatcaatc 78483

>gb|AC008821.6| Homo sapiens chromosome 5 clone CTD-2129G21, complete sequence
          Length = 184111

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    taaaactaaggctttcactct 234
              |||||||||||||||||||||
Sbjct: 146669 taaaactaaggctttcactct 146649

>gb|AC008511.6|AC008511 Homo sapiens chromosome 5 clone CTC-454D3, complete sequence
          Length = 160770

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 214    taaaactaaggctttcactct 234
              |||||||||||||||||||||
Sbjct: 146269 taaaactaaggctttcactct 146289

>dbj|AB020685.1| Homo sapiens mRNA for KIAA0878 protein, partial cds
          Length = 4099

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 214  taaaactaaggctttcactct 234
            |||||||||||||||||||||
Sbjct: 2367 taaaactaaggctttcactct 2387

>dbj|AK057894.1| Homo sapiens cDNA FLJ25165 fis, clone CBR08421
          Length = 2196

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 214  taaaactaaggctttcactct 234
            |||||||||||||||||||||
Sbjct: 2082 taaaactaaggctttcactct 2102

>gb|AC006928.15|AC006928 Homo sapiens chromosome 4 clone C0440E08, complete sequence
          Length = 169468

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    tgcaatattacatcaatcactttca 69
             |||||||||||||||||||| ||||
Sbjct: 45794 tgcaatattacatcaatcacattca 45770

>gb|BC041337.2| Homo sapiens Rho-related BTB domain containing 3, mRNA (cDNA clone
            MGC:41820 IMAGE:5285051), complete cds
          Length = 4122

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 214  taaaactaaggctttcactct 234
            |||||||||||||||||||||
Sbjct: 2374 taaaactaaggctttcactct 2394

>gb|AY492259.1| Corynebacterium imitans strain CIP 105130 RpoB (rpoB) gene, partial
           cds
          Length = 3333

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 190 gcctgatgacgctgaccgaa 209
           ||||||||||||||||||||
Sbjct: 925 gcctgatgacgctgaccgaa 944

>emb|BX629355.3|CNS09SBR Tetraodon nigroviridis
          Length = 128373

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 27    aagaacaacacatgtttctgcaat 50
             ||||||||||||||||||| ||||
Sbjct: 28196 aagaacaacacatgtttctacaat 28173

>gb|AC084734.4| Homo sapiens chromosome 8, clone RP11-317J10, complete sequence
          Length = 181044

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    aaactaaggctttcactctc 235
              ||||||||||||||||||||
Sbjct: 129877 aaactaaggctttcactctc 129896

>gb|AC008862.5| Homo sapiens chromosome 5 clone CTD-2187G18, complete sequence
          Length = 92650

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 216   aaactaaggctttcactctc 235
             ||||||||||||||||||||
Sbjct: 29941 aaactaaggctttcactctc 29960

>gb|AC025800.10| Homo sapiens chromosome 8, clone RP11-600N23, complete sequence
          Length = 185359

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 216  aaactaaggctttcactctc 235
            ||||||||||||||||||||
Sbjct: 1084 aaactaaggctttcactctc 1103

>gb|AC019315.9| Homo sapiens chromosome , clone RP11-153A6, complete sequence
          Length = 152057

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     agcacaccaatatgtcttga 91
              ||||||||||||||||||||
Sbjct: 143293 agcacaccaatatgtcttga 143312

>emb|AL808014.8| Mouse DNA sequence from clone RP23-142A6 on chromosome X, complete
              sequence
          Length = 138307

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     ttacatcaatcactttcata 71
              ||||||||||||||||||||
Sbjct: 131270 ttacatcaatcactttcata 131289


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,730,796
Number of Sequences: 3902068
Number of extensions: 2730796
Number of successful extensions: 51810
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51780
Number of HSP's gapped (non-prelim): 30
length of query: 332
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 310
effective length of database: 17,147,199,772
effective search space: 5315631929320
effective search space used: 5315631929320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)