ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet06f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC099055.2| Homo sapiens chromosome 3 clone RP11-527L9, compl... 42 0.39
2gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, com... 40 1.5
3gb|AC109807.9| Mus musculus chromosome 1, clone RP23-433B11, com... 40 1.5
4gb|AC101758.6| Mus musculus chromosome 1, clone RP24-75F14, comp... 40 1.5
5gb|AC154318.3| Mus musculus BAC clone RP23-316D19 from chromosom... 40 1.5
6gb|AC087115.10| Mus Musculus Strain C57Bl6/J Chromosome 8 RP23-9... 40 1.5
7gb|AC161493.6| Mus musculus chromosome 1, clone RP24-77I21, comp... 40 1.5
8gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete... 40 1.5
9gb|AC154783.2| Mus musculus BAC clone RP24-466C8 from 12, comple... 40 1.5
10ref|XM_520727.1| PREDICTED: Pan troglodytes similar to hypotheti... 38 6.1
11gb|AC119878.7| Mus musculus chromosome 3, clone RP24-329A3, comp... 38 6.1
12gb|AC136491.4| Oryza sativa (japonica cultivar-group) chromosome... 38 6.1
13emb|CT025613.9| Mouse DNA sequence from clone RP23-208M16 on chr... 38 6.1
14emb|CT009748.6| Mouse DNA sequence from clone RP23-120N6 on chro... 38 6.1
15emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chro... 38 6.1
16emb|CR749639.1| Homo sapiens mRNA; cDNA DKFZp686P1174 (from clon... 38 6.1
17dbj|AK125323.1| Homo sapiens cDNA FLJ43333 fis, clone NT2RI3006376 38 6.1
18dbj|AK095598.1| Homo sapiens cDNA FLJ38279 fis, clone FCBBF3005444 38 6.1
19gb|AC103873.2| Homo sapiens chromosome 11, clone RP11-768H8, com... 38 6.1
20emb|BX248517.10| Zebrafish DNA sequence from clone DKEY-30O16 in... 38 6.1
21dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.1
22gb|AC079839.5| Homo sapiens BAC clone RP11-1152J17 from 2, compl... 38 6.1
23ref|NM_144973.2| Homo sapiens hypothetical protein MGC24039 (MGC... 38 6.1
24gb|AC068792.31| Homo sapiens 12 BAC RP11-771K4 (Roswell Park Can... 38 6.1
25gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, comple... 38 6.1
26emb|BX537924.1|HSM806038 Homo sapiens mRNA; cDNA DKFZp686I06147 ... 38 6.1
27gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 38 6.1
28dbj|AB209341.1| Homo sapiens mRNA for Hypothetical protein FLJ43... 38 6.1

>gb|AC099055.2| Homo sapiens chromosome 3 clone RP11-527L9, complete sequence
          Length = 155962

 Score = 42.1 bits (21), Expect = 0.39
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 80    ctttccctaaaatacactcac 100
             |||||||||||||||||||||
Sbjct: 17313 ctttccctaaaatacactcac 17333



to top

>gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, complete sequence
          Length = 168316

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     tatgggcagggctttgaaaa 79
              ||||||||||||||||||||
Sbjct: 143584 tatgggcagggctttgaaaa 143603



to top

>gb|AC109807.9| Mus musculus chromosome 1, clone RP23-433B11, complete sequence
          Length = 227679

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 96   ctcacagttgatcactgctt 115
            ||||||||||||||||||||
Sbjct: 4139 ctcacagttgatcactgctt 4158



to top

>gb|AC101758.6| Mus musculus chromosome 1, clone RP24-75F14, complete sequence
          Length = 268826

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 96    ctcacagttgatcactgctt 115
             ||||||||||||||||||||
Sbjct: 85590 ctcacagttgatcactgctt 85609



to top

>gb|AC154318.3| Mus musculus BAC clone RP23-316D19 from chromosome 12, complete
             sequence
          Length = 176391

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    ctttccctaaaatacactca 99
             ||||||||||||||||||||
Sbjct: 72847 ctttccctaaaatacactca 72866



to top

>gb|AC087115.10| Mus Musculus Strain C57Bl6/J Chromosome 8 RP23-93A22, complete sequence
          Length = 181849

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     tatgggcagggctttgaaaa 79
              ||||||||||||||||||||
Sbjct: 171802 tatgggcagggctttgaaaa 171783



to top

>gb|AC161493.6| Mus musculus chromosome 1, clone RP24-77I21, complete sequence
          Length = 226794

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 96     ctcacagttgatcactgctt 115
              ||||||||||||||||||||
Sbjct: 161643 ctcacagttgatcactgctt 161662



to top

>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    gaaaactttccctaaaatac 94
             ||||||||||||||||||||
Sbjct: 89061 gaaaactttccctaaaatac 89042



to top

>gb|AC154783.2| Mus musculus BAC clone RP24-466C8 from 12, complete sequence
          Length = 167125

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    ctttccctaaaatacactca 99
             ||||||||||||||||||||
Sbjct: 37260 ctttccctaaaatacactca 37241



to top

>ref|XM_520727.1| PREDICTED: Pan troglodytes similar to hypothetical protein MGC24039
            (LOC465275), mRNA
          Length = 1365

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aagctgagcaatgcaataa 47
            |||||||||||||||||||
Sbjct: 1144 aagctgagcaatgcaataa 1162



to top

>gb|AC119878.7| Mus musculus chromosome 3, clone RP24-329A3, complete sequence
          Length = 132644

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    gaaaactttccctaaaata 93
             |||||||||||||||||||
Sbjct: 74299 gaaaactttccctaaaata 74317



to top

>gb|AC136491.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0062E06,
              complete sequence
          Length = 158842

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 81     tttccctaaaatacactca 99
              |||||||||||||||||||
Sbjct: 118631 tttccctaaaatacactca 118613



to top

>emb|CT025613.9| Mouse DNA sequence from clone RP23-208M16 on chromosome 13, complete
             sequence
          Length = 166222

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    gggcagggctttgaaaact 81
             |||||||||||||||||||
Sbjct: 20032 gggcagggctttgaaaact 20050



to top

>emb|CT009748.6| Mouse DNA sequence from clone RP23-120N6 on chromosome 9, complete
              sequence
          Length = 235839

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     ctttgaaaactttccctaa 89
              |||||||||||||||||||
Sbjct: 194268 ctttgaaaactttccctaa 194250



to top

>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part
             of the PLXNA2 gene for plexin A2, complete sequence
          Length = 164057

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 82    ttccctaaaatacactcac 100
             |||||||||||||||||||
Sbjct: 99154 ttccctaaaatacactcac 99172



to top

>emb|CR749639.1| Homo sapiens mRNA; cDNA DKFZp686P1174 (from clone DKFZp686P1174)
          Length = 4093

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 29  aagctgagcaatgcaataa 47
           |||||||||||||||||||
Sbjct: 267 aagctgagcaatgcaataa 285



to top

>dbj|AK125323.1| Homo sapiens cDNA FLJ43333 fis, clone NT2RI3006376
          Length = 4291

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aagctgagcaatgcaataa 47
            |||||||||||||||||||
Sbjct: 3095 aagctgagcaatgcaataa 3113



to top

>dbj|AK095598.1| Homo sapiens cDNA FLJ38279 fis, clone FCBBF3005444
          Length = 4718

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aagctgagcaatgcaataa 47
            |||||||||||||||||||
Sbjct: 1836 aagctgagcaatgcaataa 1854



to top

>gb|AC103873.2| Homo sapiens chromosome 11, clone RP11-768H8, complete sequence
          Length = 184860

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 86    ctaaaatacactcacagtt 104
             |||||||||||||||||||
Sbjct: 81177 ctaaaatacactcacagtt 81195



to top

>emb|BX248517.10| Zebrafish DNA sequence from clone DKEY-30O16 in linkage group 16,
              complete sequence
          Length = 201353

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 103    ttgatcactgctttacaac 121
              |||||||||||||||||||
Sbjct: 134490 ttgatcactgctttacaac 134508



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 81       tttccctaaaatacactca 99
                |||||||||||||||||||
Sbjct: 17828980 tttccctaaaatacactca 17828962



to top

>gb|AC079839.5| Homo sapiens BAC clone RP11-1152J17 from 2, complete sequence
          Length = 70310

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    cactcacagttgatcactg 112
             |||||||||||||||||||
Sbjct: 18057 cactcacagttgatcactg 18075



to top

>ref|NM_144973.2| Homo sapiens hypothetical protein MGC24039 (MGC24039), mRNA
          Length = 6722

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aagctgagcaatgcaataa 47
            |||||||||||||||||||
Sbjct: 2917 aagctgagcaatgcaataa 2935



to top

>gb|AC068792.31| Homo sapiens 12 BAC RP11-771K4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 106277

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aagctgagcaatgcaataa 47
             |||||||||||||||||||
Sbjct: 49010 aagctgagcaatgcaataa 49028



to top

>gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, complete sequence
          Length = 188359

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 94     cactcacagttgatcactg 112
              |||||||||||||||||||
Sbjct: 121116 cactcacagttgatcactg 121134



to top

>emb|BX537924.1|HSM806038 Homo sapiens mRNA; cDNA DKFZp686I06147 (from clone DKFZp686I06147)
          Length = 4450

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 29  aagctgagcaatgcaataa 47
           |||||||||||||||||||
Sbjct: 798 aagctgagcaatgcaataa 816



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 81       tttccctaaaatacactca 99
                |||||||||||||||||||
Sbjct: 17923296 tttccctaaaatacactca 17923278



to top

>dbj|AB209341.1| Homo sapiens mRNA for Hypothetical protein FLJ43333 variant protein
          Length = 5461

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aagctgagcaatgcaataa 47
            |||||||||||||||||||
Sbjct: 1655 aagctgagcaatgcaataa 1673


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,098,665
Number of Sequences: 3902068
Number of extensions: 1098665
Number of successful extensions: 78590
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78461
Number of HSP's gapped (non-prelim): 129
length of query: 130
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 109
effective length of database: 17,151,101,840
effective search space: 1869470100560
effective search space used: 1869470100560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top