ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet06e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chr... 50 0.002
2gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (L... 46 0.024
3gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosom... 44 0.096
4emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA 44 0.096
5ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 ... 42 0.38
6gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 42 0.38
7gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, comp... 42 0.38
8gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, c... 42 0.38
9gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome... 42 0.38
10gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosom... 42 0.38
11gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, co... 42 0.38
12gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 42 0.38
13gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, comp... 42 0.38
14gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, com... 42 0.38
15gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 42 0.38
16gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, com... 42 0.38
17gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, comp... 42 0.38
18gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Can... 42 0.38
19gb|AC168276.3| Mus musculus BAC RP24-485I12 (Roswell Park Cance... 42 0.38
20gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 42 0.38
21gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, c... 42 0.38
22gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, c... 42 0.38
23gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome 42 0.38
24gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosom... 42 0.38
25gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosom... 42 0.38
26gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosom... 42 0.38
27gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, c... 42 0.38
28gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complet... 42 0.38
29gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, com... 42 0.38
30gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, comp... 42 0.38
31gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome... 42 0.38
32gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, com... 42 0.38
33gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, comp... 42 0.38
34gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 42 0.38
35gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 42 0.38
36emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 i... 42 0.38
37gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 ... 42 0.38
38gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosom... 42 0.38
39gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosom... 42 0.38
40gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 42 0.38
41gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome... 42 0.38
42gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... 42 0.38
43gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete... 42 0.38
44gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, compl... 42 0.38
45gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, comp... 42 0.38
46gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete seq... 42 0.38
47gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete se... 42 0.38
48gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosom... 42 0.38
49emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on ch... 42 0.38
50gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, comp... 42 0.38
51gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome... 42 0.38
52emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenici... 42 0.38
53emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mito... 42 0.38
54gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 42 0.38
55gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, co... 42 0.38
56gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, com... 42 0.38
57gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete se... 42 0.38
58emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in ... 42 0.38
59gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswel... 42 0.38
60gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell ... 42 0.38
61gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, com... 42 0.38
62gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, comple... 42 0.38
63gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Ho... 42 0.38
64gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56... 42 0.38
65gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, co... 42 0.38
66gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, com... 42 0.38
67gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 0.38
68dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.38
69gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence 42 0.38
70gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-... 42 0.38
71gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, co... 42 0.38
72gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana... 42 0.38
73gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-... 42 0.38
74gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, com... 42 0.38
75gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, comple... 42 0.38
76emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on ch... 42 0.38
77gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Can... 42 0.38
78gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57... 42 0.38
79emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-8... 42 0.38
80gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 ... 42 0.38
81emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-4... 42 0.38
82gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 42 0.38
83dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 0.38
84dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 0.38
85gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, comp... 42 0.38
86gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, com... 42 0.38
87gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, co... 42 0.38
88gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome... 42 0.38
89gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 0.38
90emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chro... 42 0.38
91gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s... 42 0.38
92emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003... 42 0.38
93emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chro... 42 0.38
94gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complet... 42 0.38
95gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, compl... 42 0.38
96gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, compl... 42 0.38
97emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chr... 42 0.38
98emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chr... 42 0.38
99gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, com... 42 0.38
100emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on ch... 42 0.38
101emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chrom... 42 0.38
102gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, co... 42 0.38
103gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome ... 42 0.38
104emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 12... 42 0.38
105gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, com... 40 1.5
106gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, com... 40 1.5
107gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, comp... 40 1.5
108gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 40 1.5
109gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, comp... 40 1.5
110gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, com... 40 1.5
111gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, com... 40 1.5
112gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellit... 40 1.5
113gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, co... 40 1.5
114gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's H... 40 1.5
115gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome... 40 1.5
116gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 1.5
117gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-... 40 1.5
118gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome... 40 1.5
119gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, com... 40 1.5
120gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, comp... 40 1.5
121gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, com... 40 1.5
122gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome... 40 1.5
123gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome... 40 1.5
124gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, com... 40 1.5
125gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, co... 40 1.5
126gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, co... 40 1.5
127gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, com... 40 1.5
128emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chro... 40 1.5
129emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 ... 40 1.5
130emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi... 40 1.5
131gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosom... 40 1.5
132gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosom... 40 1.5
133gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome... 40 1.5
134gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome... 40 1.5
135gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 40 1.5
136gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, compl... 40 1.5
137emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, com... 40 1.5
138emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chr... 40 1.5
139gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, co... 40 1.5
140gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complet... 40 1.5
141gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, c... 40 1.5
142gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, com... 40 1.5
143gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, comp... 40 1.5
144emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in... 40 1.5
145emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 o... 40 1.5
146emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chr... 40 1.5
147emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on c... 40 1.5
148emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on ch... 40 1.5
149emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on ch... 40 1.5
150gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, com... 40 1.5
151gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, com... 40 1.5
152gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's ... 40 1.5
153gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell... 40 1.5
154emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 1.5
155gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:10627... 40 1.5
156gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:348... 40 1.5
157gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:366... 40 1.5
158gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:515... 40 1.5
159gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:402... 40 1.5
160gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, com... 40 1.5
161emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 i... 40 1.5
162emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chr... 40 1.5
163gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Ca... 40 1.5
164emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313... 40 1.5
165emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on c... 40 1.5
166emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on ch... 40 1.5
167emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in ... 40 1.5
168gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, co... 40 1.5
169emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chr... 40 1.5
170emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chr... 40 1.5
171gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Can... 40 1.5
172emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on ch... 40 1.5
173emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86... 40 1.5
174gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell ... 40 1.5
175gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence 40 1.5
176gb|AC140322.4| Mus musculus BAC clone RP23-413F14 from chromosom... 40 1.5
177gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, comp... 40 1.5
178gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, co... 40 1.5
179gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, compl... 40 1.5
180gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, com... 40 1.5
181gb|DP000052.1| Sus scrofa target 126 genomic scaffold 40 1.5
182gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O... 40 1.5
183gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N... 40 1.5
184gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome... 40 1.5
185gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosom... 40 1.5
186gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome... 40 1.5
187gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosom... 40 1.5
188gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B... 40 1.5
189gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex B... 40 1.5
190dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 1.5
191gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, co... 40 1.5
192gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 40 1.5
193gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A... 40 1.5
194gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome... 40 1.5
195gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome... 40 1.5
196gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complet... 40 1.5
197gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complet... 40 1.5
198gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O... 40 1.5
199gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome... 40 1.5
200gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, comp... 40 1.5
201emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chr... 40 1.5
202emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on ch... 40 1.5
203emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, ... 40 1.5
204gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, compl... 40 1.5
205gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, compl... 40 1.5
206gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome... 40 1.5
207gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complet... 40 1.5
208gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, comple... 40 1.5
209gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, compl... 40 1.5
210emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e... 40 1.5
211gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, co... 40 1.5
212gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosom... 40 1.5
213emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene 40 1.5
214gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41... 40 1.5
215emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence 40 1.5
216gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, comp... 40 1.5
217emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chr... 40 1.5
218gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome... 40 1.5
219emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chro... 40 1.5
220gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, c... 40 1.5
221emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21... 40 1.5
222emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa... 40 1.5
223gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete se... 40 1.5
224gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 40 1.5
225gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complet... 40 1.5
226gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, compl... 40 1.5
227gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complet... 40 1.5
228emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 i... 40 1.5
229emb|CT025838.2| Medicago truncatula chromosome 5 clone mth2-124f... 40 1.5
230gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, com... 40 1.5
231gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome... 40 1.5
232gb|DQ221252.1| Tetraodon nigroviridis voltage-gated sodium chann... 40 1.5
233gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome... 40 1.5
234emb|AL844900.3| Mouse DNA sequence from clone RP23-301L16 on chr... 40 1.5
235emb|AL626774.23| Mouse DNA sequence from clone RP23-198O15 on ch... 40 1.5
236gb|M23926.1|MUSIFN6A Mus musculus (clone pKK22) interferon-alpha... 40 1.5
237emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 40 1.5
238emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chro... 40 1.5
239emb|AL772170.14| Mouse DNA sequence from clone RP23-322G9 on chr... 40 1.5
240emb|AL806523.14| Mouse DNA sequence from clone RP23-423O7 on chr... 40 1.5
241dbj|AB065476.1| Homo sapiens gene for seven transmembrane helix ... 40 1.5
242gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete... 38 5.9
243gb|AC102656.28| Mus musculus chromosome 5, clone RP23-15G1, comp... 38 5.9
244gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome... 38 5.9
245gb|AC099614.9| Mus musculus chromosome 15, clone RP23-408O11, co... 38 5.9
246gb|AC139513.10| Mus musculus chromosome 15, clone RP23-151N6, co... 38 5.9
247gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, co... 38 5.9
248gb|AC154465.2| Mus musculus BAC clone RP24-146O1 from chromosome... 38 5.9
249gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, com... 38 5.9
250gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, co... 38 5.9
251gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map q... 38 5.9
252gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map q... 38 5.9
253gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map q... 38 5.9
254gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome... 38 5.9
255gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence 38 5.9
256gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 38 5.9
257gb|AC166368.3| Mus musculus BAC clone RP23-63I1 from chromosome ... 38 5.9
258gb|AC161536.7| Mus musculus chromosome 5, clone RP23-340A18, com... 38 5.9
259gb|AC125166.3| Mus musculus BAC clone RP24-435J4 from chromosome... 38 5.9
260gb|AC107230.8| Mus musculus chromosome 18, clone RP23-238L23, co... 38 5.9
261gb|AC109269.17| Mus musculus chromosome 1, clone RP23-325F17, co... 38 5.9
262gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, comp... 38 5.9
263gb|AC132358.3| Mus musculus BAC clone RP24-133O24 from chromosom... 38 5.9
264gb|AC140782.4| Mus musculus BAC clone RP24-417N13 from chromosom... 38 5.9
265emb|AJ865197.1| Cocos nucifera microsatellite DNA, clone CnCir 96 38 5.9
266gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, comp... 38 5.9
267ref|XM_387353.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 38 5.9
268emb|BX897749.7| Zebrafish DNA sequence from clone DKEY-26L20 in ... 38 5.9
269gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosom... 38 5.9
270gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosom... 38 5.9
271emb|Z68121.1|CET24D3 Caenorhabditis elegans Cosmid T24D3, comple... 38 5.9
272emb|Z50873.1|CEF17E5 Caenorhabditis elegans Cosmid F17E5, comple... 38 5.9
273gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, co... 38 5.9
274gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, comple... 38 5.9
275gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, com... 38 5.9
276gb|AC109179.7| Mus musculus chromosome 18, clone RP23-382N7, com... 38 5.9
277gb|AC155315.6| Mus musculus BAC clone RP23-212F18 from chromosom... 38 5.9
278gb|AC158113.7| Mus musculus chromosome 7, clone RP23-227N6, comp... 38 5.9
279gb|AC146185.2| Pan troglodytes BAC clone RP43-35O6 from 7, compl... 38 5.9
280gb|AC122167.8| Medicago truncatula clone mth1-10d10, complete se... 38 5.9
281gb|AC144591.10| Medicago truncatula clone mth2-5f17, complete se... 38 5.9
282gb|AC146651.10| Medicago truncatula clone mth2-113d3, complete s... 38 5.9
283emb|AL391665.28| Human DNA sequence from clone RP11-519K18 on ch... 38 5.9
284emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chro... 38 5.9
285emb|AL357354.10| Human DNA sequence from clone RP11-465C5 on chr... 38 5.9
286emb|AL137849.13| Human DNA sequence from clone RP11-507D14 on ch... 38 5.9
287emb|AL080284.20|HSJ177I10 Human DNA sequence from clone RP1-177I... 38 5.9
288emb|AL604065.7| Mouse DNA sequence from clone RP23-20M18 on chro... 38 5.9
289emb|AL031154.1|SPBC1685 S.pombe chromosome II cosmid c1685 38 5.9
290gb|AC154393.8| Mus musculus chromosome 1, clone RP23-64O1, compl... 38 5.9
291emb|AL731844.18| Mouse DNA sequence from clone RP23-153K9 on chr... 38 5.9
292dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 38 5.9
293gb|AC159612.1| Zea mays chromosome 5S clone ZMMBBb0511I12 map bi... 38 5.9
294gb|AC008099.5| Drosophila melanogaster, chromosome 2L, region 25... 38 5.9
295gb|AC149206.2| Medicago truncatula chromosome 2 BAC clone mte1-4... 38 5.9
296gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome... 38 5.9
297gb|AC153361.5| Mus musculus BAC clone RP23-291L20 from chromosom... 38 5.9
298gb|AC159629.2| Mus musculus BAC clone RP24-178C15 from chromosom... 38 5.9
299gb|AC159229.2| Mus musculus BAC clone RP24-351I2 from chromosome... 38 5.9
300gb|AC152449.4| Mus musculus BAC clone RP24-560O24 from chromosom... 38 5.9
301gb|AC008349.2|AC008349 Drosophila melanogaster, chromosome 2R, r... 38 5.9
302dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.9
303gb|AC158650.7| Mus musculus 6 BAC RP23-280O4 (Roswell Park Cance... 38 5.9
304gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, co... 38 5.9
305gb|AC097377.3| Homo sapiens BAC clone RP11-83F13 from 2, complet... 38 5.9
306gb|AC009024.6|AC009024 Homo sapiens chromosome 16 clone RP11-112... 38 5.9
307emb|BX294191.4| Zebrafish DNA sequence from clone DKEY-24K20 in ... 38 5.9
308dbj|AP004018.3| Oryza sativa (japonica cultivar-group) genomic D... 38 5.9
309emb|AL935306.6| Zebrafish DNA sequence from clone DKEY-65O9, com... 38 5.9
310gb|AC150277.2| Mus musculus BAC clone RP23-97E12 from 18, comple... 38 5.9
311gb|AC154438.2| Mus musculus BAC clone RP23-178P20 from 16, compl... 38 5.9
312gb|AC149278.3| Mus musculus BAC clone RP24-101G17 from 7, comple... 38 5.9
313emb|BX511203.3| Rattus norvegicus chromosome 1 clone RN-79C10, c... 38 5.9
314gb|AC134787.6| Mus musculus chromosome 1, clone RP24-477E13, com... 38 5.9
315gb|AE003575.5| Drosophila melanogaster chromosome 2L, section 16... 38 5.9
316gb|AE003496.4| Drosophila melanogaster chromosome X, section 48 ... 38 5.9
317gb|AE003457.4| Drosophila melanogaster chromosome 2R, section 65... 38 5.9
318dbj|AP003530.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 5.9
319emb|CT572991.10| Mouse DNA sequence from clone RP24-434I23 on ch... 38 5.9
320dbj|AP002810.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 38 5.9
321emb|CR388379.15| Zebrafish DNA sequence from clone CH211-129O15,... 38 5.9
322emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on ch... 38 5.9
323gb|AC174647.2| Mus musculus BAC clone RP23-25C24 from chromosome... 38 5.9
324gb|AC152934.2| Xenopus tropicalis clone ISB1-84B23, complete seq... 38 5.9
325emb|AL954345.11| Mouse DNA sequence from clone RP23-79N6 on chro... 38 5.9
326gb|AC133170.2| Mus musculus BAC clone RP24-267K11 from 3, comple... 38 5.9
327gb|AC126049.3| Mus musculus BAC clone RP23-224I16 from 1, comple... 38 5.9
328gb|AC138459.3| Mus musculus BAC clone RP23-335K20 from 10, compl... 38 5.9
329gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, compl... 38 5.9
330gb|AC136316.13| Mus musculus chromosome 1, clone RP24-331K22, co... 38 5.9
331emb|CT025592.14| Mouse DNA sequence from clone RP23-431J17 on ch... 38 5.9
332gb|AC161433.5| Mus musculus chromosome 8, clone RP23-50F12, comp... 38 5.9
333gb|AC171241.2| Mus musculus BAC clone RP23-94E5 from chromosome ... 38 5.9
334gb|AC169084.3| Mus musculus BAC clone RP24-427O13 from chromosom... 38 5.9
335emb|AL672239.8| Mouse DNA sequence from clone RP23-144D15 on chr... 38 5.9
336emb|AL831752.7| Mouse DNA sequence from clone RP23-414J22 on chr... 38 5.9
337emb|AL691419.10| Mouse DNA sequence from clone RP23-95I4 on chro... 38 5.9
338emb|AL807400.9| Mouse DNA sequence from clone RP23-196A4 on chro... 38 5.9
339emb|AL606908.10| Mouse DNA sequence from clone RP23-273D6 on chr... 38 5.9
340gb|AC120785.13| Mus musculus chromosome 8, clone RP23-336P3, com... 38 5.9

>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete
            sequence
          Length = 43009

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 66   gcaagcacatgcacatgcacatgca 90
            |||||||||||||||||||||||||
Sbjct: 8647 gcaagcacatgcacatgcacatgca 8623



to top

>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter
            region and partial cds
          Length = 5236

 Score = 46.1 bits (23), Expect = 0.024
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 70   gcacatgcacatgcacatgcagt 92
            |||||||||||||||||||||||
Sbjct: 3181 gcacatgcacatgcacatgcagt 3203



to top

>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete sequence
          Length = 187121

 Score = 44.1 bits (22), Expect = 0.096
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 67     caagcacatgcacatgcacatg 88
              ||||||||||||||||||||||
Sbjct: 101713 caagcacatgcacatgcacatg 101734



to top

>emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA
          Length = 952

 Score = 44.1 bits (22), Expect = 0.096
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 70  gcacatgcacatgcacatgcag 91
           ||||||||||||||||||||||
Sbjct: 451 gcacatgcacatgcacatgcag 472



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  cacatgcacatgcacatgca 90
           ||||||||||||||||||||
Sbjct: 446 cacatgcacatgcacatgca 465



to top

>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds
          Length = 1308

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 1101 gcacatgcacatgcacatgca 1121



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   gcacatgcacatgcacatgc 89
            ||||||||||||||||||||
Sbjct: 1107 gcacatgcacatgcacatgc 1126



to top

>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence
          Length = 186266

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 168582 gcacatgcacatgcacatgca 168602



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 168576 gcacatgcacatgcacatgca 168596



to top

>gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, complete sequence
          Length = 171048

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 65280 gcacatgcacatgcacatgca 65300



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 65274 gcacatgcacatgcacatgca 65294



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 65268 gcacatgcacatgcacatgca 65288



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 65262 gcacatgcacatgcacatgca 65282



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 65256 gcacatgcacatgcacatgca 65276



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 65252 acatgcacatgcacatgca 65270



to top

>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence
          Length = 171409

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 118959 gcacatgcacatgcacatgca 118979



to top

>gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome 12, complete sequence
          Length = 176261

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109047 gcacatgcacatgcacatgca 109027



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109041 gcacatgcacatgcacatgca 109021



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109035 gcacatgcacatgcacatgca 109015



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109029 gcacatgcacatgcacatgca 109009



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109023 gcacatgcacatgcacatgca 109003



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 109017 gcacatgcacatgcacatgca 108997



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 109052 cacatgcacatgcacatgca 109033



to top

>gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosome 12, complete
             sequence
          Length = 158341

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12885 gcacatgcacatgcacatgca 12865



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12879 gcacatgcacatgcacatgca 12859



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12873 gcacatgcacatgcacatgca 12853



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12867 gcacatgcacatgcacatgca 12847



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12861 gcacatgcacatgcacatgca 12841



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 12855 gcacatgcacatgcacatgca 12835



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 12890 cacatgcacatgcacatgca 12871



to top

>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence
          Length = 224193

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 96469 gcacatgcacatgcacatgca 96449



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 3539276 gcacatgcacatgcacatgca 3539256



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 3539270 gcacatgcacatgcacatgca 3539250



to top

>gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, complete sequence
          Length = 175586

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    cacatgcacatgcacatgcag 91
             |||||||||||||||||||||
Sbjct: 54154 cacatgcacatgcacatgcag 54174



to top

>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence
          Length = 203230

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 71     cacatgcacatgcacatgcag 91
              |||||||||||||||||||||
Sbjct: 181556 cacatgcacatgcacatgcag 181536



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 859544 gcacatgcacatgcacatgca 859564



to top

>gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, complete sequence
          Length = 203566

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 158681 gcacatgcacatgcacatgca 158701



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 158687 gcacatgcacatgcacatgc 158706



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 158677 acatgcacatgcacatgca 158695



to top

>gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, complete sequence
          Length = 229959

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 29909 gcacatgcacatgcacatgca 29929



to top

>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 188458

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    cacatgcacatgcacatgcag 91
             |||||||||||||||||||||
Sbjct: 45613 cacatgcacatgcacatgcag 45633



to top

>gb|AC168276.3| Mus musculus  BAC RP24-485I12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 186675

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 71     cacatgcacatgcacatgcag 91
              |||||||||||||||||||||
Sbjct: 159516 cacatgcacatgcacatgcag 159536



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 183297 gcacatgcacatgcacatgca 183317



to top

>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 90180 gcacatgcacatgcacatgca 90160



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 90185 cacatgcacatgcacatgca 90166



to top

>gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, complete sequence
          Length = 166650

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 129383 gcacatgcacatgcacatgca 129363



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 129377 gcacatgcacatgcacatgca 129357



to top

>gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome
          Length = 17364

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16787 gcacatgcacatgcacatgca 16807



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16781 gcacatgcacatgcacatgca 16801



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16775 gcacatgcacatgcacatgca 16795



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16769 gcacatgcacatgcacatgca 16789



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16763 gcacatgcacatgcacatgca 16783



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16757 gcacatgcacatgcacatgca 16777



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16649 gcacatgcacatgcacatgca 16669



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16643 gcacatgcacatgcacatgca 16663



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16637 gcacatgcacatgcacatgca 16657



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16631 gcacatgcacatgcacatgca 16651



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16625 gcacatgcacatgcacatgca 16645



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16619 gcacatgcacatgcacatgca 16639



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16613 gcacatgcacatgcacatgca 16633



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16607 gcacatgcacatgcacatgca 16627



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16601 gcacatgcacatgcacatgca 16621



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16595 gcacatgcacatgcacatgca 16615



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16589 gcacatgcacatgcacatgca 16609



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16583 gcacatgcacatgcacatgca 16603



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16577 gcacatgcacatgcacatgca 16597



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16571 gcacatgcacatgcacatgca 16591



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16565 gcacatgcacatgcacatgca 16585



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16559 gcacatgcacatgcacatgca 16579



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16553 gcacatgcacatgcacatgca 16573



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 16752 cacatgcacatgcacatgca 16771



to top

>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence
          Length = 183218

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 68833 gcacatgcacatgcacatgca 68853



to top

>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete
             sequence
          Length = 182371

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 11344 gcacatgcacatgcacatgca 11324



to top

>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence
          Length = 170870

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 42080 gcacatgcacatgcacatgca 42060



to top

>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence
          Length = 214580

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59875 gcacatgcacatgcacatgca 59855



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59869 gcacatgcacatgcacatgca 59849



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59863 gcacatgcacatgcacatgca 59843



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59857 gcacatgcacatgcacatgca 59837



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59851 gcacatgcacatgcacatgca 59831



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59845 gcacatgcacatgcacatgca 59825



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 59880 cacatgcacatgcacatgca 59861



to top

>gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complete sequence
          Length = 240260

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 226264 gcacatgcacatgcacatgca 226244



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 226269 cacatgcacatgcacatgca 226250



to top

>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence
          Length = 191700

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 155892 gcacatgcacatgcacatgca 155912



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 155887 cacatgcacatgcacatgca 155906



to top

>gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, complete sequence
          Length = 228046

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 88701 gcacatgcacatgcacatgca 88721



to top

>gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome 8, complete sequence
          Length = 200605

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 179708 gcacatgcacatgcacatgca 179728



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 179704 acatgcacatgcacatgca 179722



to top

>gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, complete sequence
          Length = 172617

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59989 gcacatgcacatgcacatgca 59969



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59983 gcacatgcacatgcacatgca 59963



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59977 gcacatgcacatgcacatgca 59957



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59971 gcacatgcacatgcacatgca 59951



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59965 gcacatgcacatgcacatgca 59945



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59959 gcacatgcacatgcacatgca 59939



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 59953 gcacatgcacatgcacatgca 59933



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 59994 cacatgcacatgcacatgca 59975



to top

>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence
          Length = 171263

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 4155 gcacatgcacatgcacatgca 4135



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 4149 gcacatgcacatgcacatgca 4129



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 149713 gcacatgcacatgcacatgca 149733



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 149707 gcacatgcacatgcacatgca 149727



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 149702 cacatgcacatgcacatgca 149721



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137950 gcacatgcacatgcacatgca 137930



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137944 gcacatgcacatgcacatgca 137924



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137938 gcacatgcacatgcacatgca 137918



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137932 gcacatgcacatgcacatgca 137912



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137926 gcacatgcacatgcacatgca 137906



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137920 gcacatgcacatgcacatgca 137900



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137914 gcacatgcacatgcacatgca 137894



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137908 gcacatgcacatgcacatgca 137888



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137902 gcacatgcacatgcacatgca 137882



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137896 gcacatgcacatgcacatgca 137876



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137890 gcacatgcacatgcacatgca 137870



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 137884 gcacatgcacatgcacatgca 137864



to top

>emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 in linkage group 18,
              complete sequence
          Length = 151872

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 140340 gcacatgcacatgcacatgca 140320



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 140334 gcacatgcacatgcacatgca 140314



to top

>gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 map q33, complete
             sequence
          Length = 118946

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 91027 gcacatgcacatgcacatgca 91007



to top

>gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosome 9, complete sequence
          Length = 192991

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 96817 gcacatgcacatgcacatgca 96837



to top

>gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosome 8, complete sequence
          Length = 205875

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113309 gcacatgcacatgcacatgca 113329



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113303 gcacatgcacatgcacatgca 113323



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113297 gcacatgcacatgcacatgca 113317



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113291 gcacatgcacatgcacatgca 113311



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113285 gcacatgcacatgcacatgca 113305



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113279 gcacatgcacatgcacatgca 113299



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 113273 gcacatgcacatgcacatgca 113293



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 113268 cacatgcacatgcacatgca 113287



to top

>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete
             sequence
          Length = 181828

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16975 gcacatgcacatgcacatgca 16955



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 16980 cacatgcacatgcacatgca 16961



to top

>gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome 3, complete sequence
          Length = 209378

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 164877 gcacatgcacatgcacatgca 164897



to top

>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
          Length = 203855

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 107689 gcacatgcacatgcacatgca 107669



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 107683 gcacatgcacatgcacatgca 107663



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 107693 acatgcacatgcacatgca 107675



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 70     gcacatgcacatgcacatg 88
              |||||||||||||||||||
Sbjct: 107677 gcacatgcacatgcacatg 107659



to top

>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence
          Length = 171124

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 157732 gcacatgcacatgcacatgca 157752



to top

>gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, complete sequence
          Length = 141866

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 116030 gcacatgcacatgcacatgca 116010



to top

>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence
          Length = 171006

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 40198 gcacatgcacatgcacatgca 40178



to top

>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence
          Length = 121648

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 68485 gcacatgcacatgcacatgca 68465



to top

>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence
          Length = 114519

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51403 gcacatgcacatgcacatgca 51423



to top

>gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosome 3, complete sequence
          Length = 228648

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 23710 gcacatgcacatgcacatgca 23730



to top

>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a
              novel pseudogene, the MRPL50 gene for mitochondrial
              ribosomal protein L50, the ZNF189 gene for zinc finger
              protein 189, the ALDOB gene for aldolase B,
              fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1
              alpha subcomplex (NDUFA4) pseudogene, three novel genes,
              the 5' end of the RNF20 gene for ring finger protein 20 and
              three CpG islands, complete sequence
          Length = 164115

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 138236 gcacatgcacatgcacatgca 138216



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 138241 cacatgcacatgcacatgca 138222



to top

>gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, complete sequence
          Length = 176916

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145466 gcacatgcacatgcacatgca 145486



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145460 gcacatgcacatgcacatgca 145480



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145454 gcacatgcacatgcacatgca 145474



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145448 gcacatgcacatgcacatgca 145468



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145442 gcacatgcacatgcacatgca 145462



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145436 gcacatgcacatgcacatgca 145456



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 145430 gcacatgcacatgcacatgca 145450



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 145425 cacatgcacatgcacatgca 145444



to top

>gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome 9, complete sequence
          Length = 183012

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 19626 gcacatgcacatgcacatgca 19606



to top

>emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenicity island (YAPI),
             complete sequence, strain 32777
          Length = 102752

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 64731 gcacatgcacatgcacatgca 64751



to top

>emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mitochondrial genome
          Length = 17036

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16410 gcacatgcacatgcacatgca 16430



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16404 gcacatgcacatgcacatgca 16424



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16398 gcacatgcacatgcacatgca 16418



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16392 gcacatgcacatgcacatgca 16412



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16386 gcacatgcacatgcacatgca 16406



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16380 gcacatgcacatgcacatgca 16400



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16374 gcacatgcacatgcacatgca 16394



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16368 gcacatgcacatgcacatgca 16388



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16362 gcacatgcacatgcacatgca 16382



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16356 gcacatgcacatgcacatgca 16376



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16350 gcacatgcacatgcacatgca 16370



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16344 gcacatgcacatgcacatgca 16364



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16338 gcacatgcacatgcacatgca 16358



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16332 gcacatgcacatgcacatgca 16352



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16326 gcacatgcacatgcacatgca 16346



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16320 gcacatgcacatgcacatgca 16340



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16314 gcacatgcacatgcacatgca 16334



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16308 gcacatgcacatgcacatgca 16328



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16302 gcacatgcacatgcacatgca 16322



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16296 gcacatgcacatgcacatgca 16316



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16290 gcacatgcacatgcacatgca 16310



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16284 gcacatgcacatgcacatgca 16304



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16278 gcacatgcacatgcacatgca 16298



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16272 gcacatgcacatgcacatgca 16292



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16266 gcacatgcacatgcacatgca 16286



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16260 gcacatgcacatgcacatgca 16280



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16254 gcacatgcacatgcacatgca 16274



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16248 gcacatgcacatgcacatgca 16268



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 16242 gcacatgcacatgcacatgca 16262



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 94992 gcacatgcacatgcacatgca 95012



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 94986 gcacatgcacatgcacatgca 95006



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 94981 cacatgcacatgcacatgca 95000



to top

>gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, complete sequence
          Length = 159617

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 69413 gcacatgcacatgcacatgca 69393



to top

>gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, complete sequence
          Length = 163180

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 99803 gcacatgcacatgcacatgca 99783



to top

>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence
          Length = 33456

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13356 gcacatgcacatgcacatgca 13336



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13350 gcacatgcacatgcacatgca 13330



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13344 gcacatgcacatgcacatgca 13324



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13338 gcacatgcacatgcacatgca 13318



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13332 gcacatgcacatgcacatgca 13312



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13326 gcacatgcacatgcacatgca 13306



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13320 gcacatgcacatgcacatgca 13300



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13314 gcacatgcacatgcacatgca 13294



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13308 gcacatgcacatgcacatgca 13288



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13302 gcacatgcacatgcacatgca 13282



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13296 gcacatgcacatgcacatgca 13276



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13290 gcacatgcacatgcacatgca 13270



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13284 gcacatgcacatgcacatgca 13264



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13278 gcacatgcacatgcacatgca 13258



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13272 gcacatgcacatgcacatgca 13252



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13266 gcacatgcacatgcacatgca 13246



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13260 gcacatgcacatgcacatgca 13240



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13254 gcacatgcacatgcacatgca 13234



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13248 gcacatgcacatgcacatgca 13228



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13242 gcacatgcacatgcacatgca 13222



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13236 gcacatgcacatgcacatgca 13216



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13230 gcacatgcacatgcacatgca 13210



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13224 gcacatgcacatgcacatgca 13204



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 13218 gcacatgcacatgcacatgca 13198



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 13360 acatgcacatgcacatgca 13342



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 70    gcacatgcacatgcacatg 88
             |||||||||||||||||||
Sbjct: 13212 gcacatgcacatgcacatg 13194



to top

>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11,
             complete sequence
          Length = 252675

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 10592 gcacatgcacatgcacatgca 10612



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 10587 cacatgcacatgcacatgca 10606



to top

>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 187438

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 70416 gcacatgcacatgcacatgca 70436



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 70410 gcacatgcacatgcacatgca 70430



to top

>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 177096

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 48160 gcacatgcacatgcacatgca 48140



to top

>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence
          Length = 193569

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    cacatgcacatgcacatgcag 91
             |||||||||||||||||||||
Sbjct: 96146 cacatgcacatgcacatgcag 96126



to top

>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence
          Length = 112615

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 28613 gcacatgcacatgcacatgca 28593



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 28607 gcacatgcacatgcacatgca 28587



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 28618 cacatgcacatgcacatgca 28599



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 70    gcacatgcacatgcacatg 88
             |||||||||||||||||||
Sbjct: 28601 gcacatgcacatgcacatg 28583



to top

>gb|AC112031.4| Rattus norvegicus  BAC CH230-99K18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 242158

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 71     cacatgcacatgcacatgcag 91
              |||||||||||||||||||||
Sbjct: 121225 cacatgcacatgcacatgcag 121245



to top

>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone
             BACR23F24, complete sequence
          Length = 183592

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 31529 gcacatgcacatgcacatgca 31549



to top

>gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, complete sequence
          Length = 146978

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51702 gcacatgcacatgcacatgca 51722



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51696 gcacatgcacatgcacatgca 51716



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51690 gcacatgcacatgcacatgca 51710



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51684 gcacatgcacatgcacatgca 51704



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 51678 gcacatgcacatgcacatgca 51698



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 51674 acatgcacatgcacatgca 51692



to top

>gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, complete sequence
          Length = 157519

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 89387 gcacatgcacatgcacatgca 89367



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 89381 gcacatgcacatgcacatgca 89361



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 2058901 gcacatgcacatgcacatgca 2058881



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 2058895 gcacatgcacatgcacatgca 2058875



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 70      gcacatgcacatgcacatgc 89
               ||||||||||||||||||||
Sbjct: 2058889 gcacatgcacatgcacatgc 2058870



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgca 1349867



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 72       acatgcacatgcacatgcag 91
                ||||||||||||||||||||
Sbjct: 13094744 acatgcacatgcacatgcag 13094763



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 71      cacatgcacatgcacatgca 90
               ||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgca 1349861



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 70      gcacatgcacatgcacatg 88
               |||||||||||||||||||
Sbjct: 1349853 gcacatgcacatgcacatg 1349871



to top

>gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence
          Length = 224

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 70  gcacatgcacatgcacatgca 90
           |||||||||||||||||||||
Sbjct: 194 gcacatgcacatgcacatgca 214



to top

>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete
            sequence
          Length = 141898

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 2916 gcacatgcacatgcacatgca 2896



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 2910 gcacatgcacatgcacatgca 2890



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 70   gcacatgcacatgcacatgc 89
            ||||||||||||||||||||
Sbjct: 2904 gcacatgcacatgcacatgc 2885



to top

>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence
          Length = 186063

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    cacatgcacatgcacatgcag 91
             |||||||||||||||||||||
Sbjct: 43146 cacatgcacatgcacatgcag 43166



to top

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
              complete sequence
          Length = 143879

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 111625 gcacatgcacatgcacatgca 111605



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 111619 gcacatgcacatgcacatgc 111600



to top

>gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-580N24, complete
             sequence
          Length = 87280

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 77034 gcacatgcacatgcacatgca 77014



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 77028 gcacatgcacatgcacatgca 77008



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 77022 gcacatgcacatgcacatgc 77003



to top

>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence
          Length = 193119

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 119858 gcacatgcacatgcacatgca 119838



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 119863 cacatgcacatgcacatgca 119844



to top

>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence
          Length = 194103

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 58117 gcacatgcacatgcacatgca 58097



to top

>emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on chromosome 16, complete
             sequence
          Length = 136128

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 60753 gcacatgcacatgcacatgca 60773



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 60747 gcacatgcacatgcacatgca 60767



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 60741 gcacatgcacatgcacatgca 60761



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 60735 gcacatgcacatgcacatgca 60755



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 60729 gcacatgcacatgcacatgca 60749



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 60724 cacatgcacatgcacatgca 60743



to top

>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 230270

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 71   cacatgcacatgcacatgcag 91
            |||||||||||||||||||||
Sbjct: 7462 cacatgcacatgcacatgcag 7482



to top

>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete
              sequence
          Length = 271902

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 125790 gcacatgcacatgcacatgca 125810



to top

>emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-855C23 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 196698

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 135322 gcacatgcacatgcacatgca 135342



to top

>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete
              sequence
          Length = 318699

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 194964 gcacatgcacatgcacatgca 194984



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 194958 gcacatgcacatgcacatgca 194978



to top

>emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-497E19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181433

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 67     caagcacatgcacatgcacat 87
              |||||||||||||||||||||
Sbjct: 123883 caagcacatgcacatgcacat 123863



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 110470 gcacatgcacatgcacatgca 110450



to top

>dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-264L21, complete
              sequence
          Length = 151939

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 105911 gcacatgcacatgcacatgca 105891



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 105915 acatgcacatgcacatgca 105897



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 70     gcacatgcacatgcacatg 88
              |||||||||||||||||||
Sbjct: 105905 gcacatgcacatgcacatg 105887



to top

>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete
             sequence
          Length = 171738

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 28586 gcacatgcacatgcacatgca 28566



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 28590 acatgcacatgcacatgca 28572



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 70    gcacatgcacatgcacatg 88
             |||||||||||||||||||
Sbjct: 28580 gcacatgcacatgcacatg 28562



to top

>gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, complete sequence
          Length = 193884

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    cacatgcacatgcacatgcag 91
             |||||||||||||||||||||
Sbjct: 19626 cacatgcacatgcacatgcag 19606



to top

>gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, complete sequence
          Length = 200031

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 139469 gcacatgcacatgcacatgca 139489



to top

>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence
          Length = 181287

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 158851 gcacatgcacatgcacatgca 158871



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 70     gcacatgcacatgcacatg 88
              |||||||||||||||||||
Sbjct: 158857 gcacatgcacatgcacatg 158875



to top

>gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome 8, complete sequence
          Length = 219376

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 155969 gcacatgcacatgcacatgca 155949



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 70      gcacatgcacatgcacatgca 90
               |||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgca 1349867



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 72       acatgcacatgcacatgcag 91
                ||||||||||||||||||||
Sbjct: 13049018 acatgcacatgcacatgcag 13049037



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 71      cacatgcacatgcacatgca 90
               ||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgca 1349861



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 70      gcacatgcacatgcacatg 88
               |||||||||||||||||||
Sbjct: 1349853 gcacatgcacatgcacatg 1349871



to top

>emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chromosome 11, complete
            sequence
          Length = 131385

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 8084 gcacatgcacatgcacatgca 8104



to top

>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499
             (D217), and DS08132 (D174)), complete sequence
          Length = 173970

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 37904 gcacatgcacatgcacatgca 37924



to top

>emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003_C01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 157453

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 79322 gcacatgcacatgcacatgca 79302



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 79327 cacatgcacatgcacatgca 79308



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 70    gcacatgcacatgcacatg 88
             |||||||||||||||||||
Sbjct: 79316 gcacatgcacatgcacatg 79298



to top

>emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chromosome 12, complete
            sequence
          Length = 197822

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3935 gcacatgcacatgcacatgca 3955



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3929 gcacatgcacatgcacatgca 3949



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3923 gcacatgcacatgcacatgca 3943



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3917 gcacatgcacatgcacatgca 3937



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3911 gcacatgcacatgcacatgca 3931



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 70   gcacatgcacatgcacatgca 90
            |||||||||||||||||||||
Sbjct: 3905 gcacatgcacatgcacatgca 3925



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 3900 cacatgcacatgcacatgca 3919



to top

>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence
          Length = 201762

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 161188 gcacatgcacatgcacatgca 161168



to top

>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence
          Length = 171340

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 116938 gcacatgcacatgcacatgca 116958



to top

>gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, complete sequence
          Length = 186273

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 98905 gcacatgcacatgcacatgca 98885



 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 98910 cacatgcacatgcacatgca 98891



to top

>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete
             sequence
          Length = 163330

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 11303 gcacatgcacatgcacatgca 11323



to top

>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete
              sequence
          Length = 129293

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 120165 gcacatgcacatgcacatgca 120185



to top

>gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, complete sequence
          Length = 190466

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 155791 gcacatgcacatgcacatgca 155771



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 155785 gcacatgcacatgcacatgca 155765



to top

>emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on chromosome 4, complete
             sequence
          Length = 183416

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 70527 gcacatgcacatgcacatgca 70507



to top

>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete
             sequence
          Length = 242502

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 81189 gcacatgcacatgcacatgca 81169



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 81183 gcacatgcacatgcacatgca 81163



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 81177 gcacatgcacatgcacatgca 81157



 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 81171 gcacatgcacatgcacatgca 81151



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 81193 acatgcacatgcacatgca 81175



to top

>gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, complete sequence
          Length = 209748

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    gcacatgcacatgcacatgca 90
             |||||||||||||||||||||
Sbjct: 18836 gcacatgcacatgcacatgca 18816



to top

>gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome 13, complete sequence
          Length = 242910

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     gcacatgcacatgcacatgca 90
              |||||||||||||||||||||
Sbjct: 169818 gcacatgcacatgcacatgca 169798



to top

>emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 123F11
          Length = 23109

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  gcacatgcacatgcacatgca 90
           |||||||||||||||||||||
Sbjct: 488 gcacatgcacatgcacatgca 468



to top

>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence
          Length = 162962

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     caagcacatgcacatgcaca 86
              ||||||||||||||||||||
Sbjct: 154838 caagcacatgcacatgcaca 154857



to top

>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence
          Length = 156067

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 2462 cacatgcacatgcacatgca 2481



to top

>gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, complete sequence
          Length = 207176

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 128882 gcacatgcacatgcacatgc 128901



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 128878 acatgcacatgcacatgca 128896



to top

>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 53534 cacatgcacatgcacatgca 53553



to top

>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence
          Length = 167871

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 107712 cacatgcacatgcacatgca 107731



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 70     gcacatgcacatgcacatg 88
              |||||||||||||||||||
Sbjct: 107717 gcacatgcacatgcacatg 107735



to top

>gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, complete sequence
          Length = 176315

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 96798 gcacatgcacatgcacatgc 96779



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 96802 acatgcacatgcacatgca 96784



to top

>gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, complete sequence
          Length = 182151

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 151531 cacatgcacatgcacatgca 151512



to top

>gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellite sequences
          Length = 687

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 71 cacatgcacatgcacatgca 90
          ||||||||||||||||||||
Sbjct: 99 cacatgcacatgcacatgca 80



to top

>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence
          Length = 187202

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 157568 cacatgcacatgcacatgca 157587



to top

>gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 59971

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 41983 cacatgcacatgcacatgca 42002



to top

>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence
          Length = 238060

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 234459 cacatgcacatgcacatgca 234478



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 70      gcacatgcacatgcacatgc 89
               ||||||||||||||||||||
Sbjct: 2104564 gcacatgcacatgcacatgc 2104583



to top

>gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-536L14, complete
             sequence
          Length = 148631

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 39531 gcacatgcacatgcacatgc 39550



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 39527 acatgcacatgcacatgca 39545



to top

>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete
            sequence
          Length = 202934

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 5745 cacatgcacatgcacatgca 5726



to top

>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence
          Length = 248320

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 67     caagcacatgcacatgcacatgca 90
              |||||||||||||| |||||||||
Sbjct: 218760 caagcacatgcacaggcacatgca 218737



to top

>gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, complete sequence
          Length = 141045

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 84001 gcacatgcacatgcacatgc 84020



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 83997 acatgcacatgcacatgca 84015



to top

>gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, complete sequence
          Length = 245496

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 5695 cacatgcacatgcacatgca 5676



to top

>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence
          Length = 193532

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 119761 cacatgcacatgcacatgca 119742



to top

>gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome 9, complete sequence
          Length = 242229

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 69671 gcacatgcacatgcacatgc 69690



to top

>gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, complete sequence
          Length = 171181

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 43169 cacatgcacatgcacatgca 43188



to top

>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence
          Length = 212183

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 33272 cacatgcacatgcacatgca 33291



to top

>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence
          Length = 123569

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 74233 cacatgcacatgcacatgca 74252



to top

>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence
          Length = 229632

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 106204 cacatgcacatgcacatgca 106185



to top

>emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chromosome 17, complete
             sequence
          Length = 210326

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 26450 cacatgcacatgcacatgca 26431



to top

>emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 in linkage group 24,
             complete sequence
          Length = 181023

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    caagcacatgcacatgcaca 86
             ||||||||||||||||||||
Sbjct: 53191 caagcacatgcacatgcaca 53210



to top

>emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi-IMBB05
          Length = 374

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 71 cacatgcacatgcacatgca 90
          ||||||||||||||||||||
Sbjct: 39 cacatgcacatgcacatgca 58



to top

>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence
          Length = 183845

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 141307 cacatgcacatgcacatgca 141326



to top

>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete
             sequence
          Length = 158065

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 51571 cacatgcacatgcacatgca 51552



to top

>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence
          Length = 168858

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 153982 cacatgcacatgcacatgca 154001



to top

>gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome 5, complete sequence
          Length = 134272

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 15578 gcacatgcacatgcacatgc 15597



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 15574 acatgcacatgcacatgca 15592



to top

>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence
          Length = 189936

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 15523 cacatgcacatgcacatgca 15504



to top

>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence
          Length = 182135

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 147254 cacatgcacatgcacatgca 147273



to top

>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence
          Length = 146757

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 62    gtaagcaagcacatgcacatgcacatgc 89
             ||||||| ||||||||||| ||||||||
Sbjct: 84905 gtaagcatgcacatgcacacgcacatgc 84932



to top

>emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chromosome 6, complete
            sequence
          Length = 67632

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   catgcacatgcacatgcagt 92
            ||||||||||||||||||||
Sbjct: 2471 catgcacatgcacatgcagt 2452



to top

>gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, complete sequence
          Length = 247892

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 165924 cacatgcacatgcacatgca 165943



to top

>gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complete sequence
          Length = 159482

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 27288 cacatgcacatgcacatgca 27269



to top

>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence
          Length = 137137

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 76350 cacatgcacatgcacatgca 76331



to top

>gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, complete sequence
          Length = 190345

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 57942 cacatgcacatgcacatgca 57961



to top

>gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, complete sequence
          Length = 160383

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 64270 cacatgcacatgcacatgca 64289



to top

>emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in linkage group 14,
             complete sequence
          Length = 79737

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    caagcacatgcacatgcaca 86
             ||||||||||||||||||||
Sbjct: 32759 caagcacatgcacatgcaca 32740



to top

>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part of
              the ODZ1 gene for odz, odd Oz/ten-m homolog 1(Drosophila),
              complete sequence
          Length = 110180

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 107146 cacatgcacatgcacatgca 107165



to top

>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the
             GPR53P pseudogene for G protein-coupled receptor 53, the
             OR2I1P pseudogene for olfactory receptor, family 2,
             subfamily I, member 1, the UBD gene for ubiquitin D, the
             OR2H5P pseudogene for olfactory receptor, family 2,
             subfamily H, member 5, the RPL13AP pseudogene for
             ribosomal protein L13a, the OR2H2 gene for olfactory
             receptor, family 2, subfamily H, member 2, the GABBR1 gene
             for gamma-aminobutyric acid (GABA) B receptor, 1, and 3
             CpG islands, complete sequence
          Length = 102684

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 75647 catgcacatgcacatgcagt 75628



to top

>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a
             MAS1 oncogene pseudogene, a olfactory receptor, family 2,
             subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the
             UBD gene for ubiquitin D (FAT10), a olfactory receptor,
             family 2, subfamily H, member 5 pseudogene (OR2H5P,
             HS6M1-13P), a 60S ribosomal protein L13A (RPL13A)
             pseudogene, the OR2H2 gene for olfactory receptor, family
             2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for
             gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A,
             GABABR1), the 5' end of the MOG gene for myelin
             oligodendrocyte protein and three CpG islands, complete
             sequence
          Length = 145431

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 82068 catgcacatgcacatgcagt 82049



to top

>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the
             OR2H2 gene for olfactory receptor, family 2, subfamily H,
             member 2, the OR2I1P and OR2H5P pseudogenes for olfactory
             receptor, family 2, subfamily I, member 1 and subfamily H,
             member 5, the UBD gene for ubiquitin D, a 60S ribosomal
             protein L13A (RPL13A) pseudogene, the GABBR1 gene for
             gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3
             suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the
             MOG gene for myelin oligodendrocyte glycoprotein, the gene
             for a novel KRAB box-containing C2H2 type zinc finger
             protein and four CpG islands, complete sequence
          Length = 155874

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 58940 catgcacatgcacatgcagt 58921



to top

>emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on chromosome 13, complete
             sequence
          Length = 89264

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 5     tttattattgtatataaagcacac 28
             ||||||||| ||||||||||||||
Sbjct: 37818 tttattattatatataaagcacac 37795



to top

>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence
          Length = 197545

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 156696 cacatgcacatgcacatgca 156715



to top

>gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, complete sequence
          Length = 221489

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 37710 cacatgcacatgcacatgca 37691



to top

>gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133392

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 65791 gcacatgcacatgcacatgc 65772



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 65795 acatgcacatgcacatgca 65777



to top

>gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 128765

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 70   gcacatgcacatgcacatgc 89
            ||||||||||||||||||||
Sbjct: 4839 gcacatgcacatgcacatgc 4820



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 266151 gcacatgcacatgcacatgc 266170



to top

>gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:106271 IMAGE:5341608),
            complete cds
          Length = 3092

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 2251 cacatgcacatgcacatgca 2232



to top

>gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3489729)
          Length = 2096

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 1254 cacatgcacatgcacatgca 1235



to top

>gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3666894)
          Length = 2070

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 1230 cacatgcacatgcacatgca 1211



to top

>gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:5150458), with apparent
            retained intron
          Length = 2194

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 1354 cacatgcacatgcacatgca 1335



to top

>gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:4024476), partial cds
          Length = 2433

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 1593 cacatgcacatgcacatgca 1574



to top

>gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, complete sequence
          Length = 180209

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 30422 cacatgcacatgcacatgca 30403



to top

>emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 in linkage group 1,
              complete sequence
          Length = 161017

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 110167 cacatgcacatgcacatgca 110186



to top

>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the
             5' end of the Scpep1 gene for serine carboxypeptidase 1,
             two transcription elongation factor B (SIII) polypeptide 2
             (Tceb2) pseudogenes, four novel genes (incl.
             A930013B10Rik), the Coil gene for coilin, the Trim25 gene
             for tripartite motif protein 25 and the Dgke gene for
             diacylglycerol kinase epsilon, complete sequence
          Length = 171512

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 96100 cacatgcacatgcacatgca 96081



to top

>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153284

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 115612 cacatgcacatgcacatgca 115593



to top

>emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313K1416 (from clone
           DKFZp313K1416)
          Length = 2410

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  cacatgcacatgcacatgca 90
           ||||||||||||||||||||
Sbjct: 430 cacatgcacatgcacatgca 411



to top

>emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on chromosome 6, complete
             sequence
          Length = 127280

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 53966 catgcacatgcacatgcagt 53947



to top

>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a
             novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 196097

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 14871 cacatgcacatgcacatgca 14852



to top

>emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in linkage group 14,
             complete sequence
          Length = 213600

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    caagcacatgcacatgcaca 86
             ||||||||||||||||||||
Sbjct: 41131 caagcacatgcacatgcaca 41112



to top

>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence
          Length = 223809

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 67     caagcacatgcacatgcacatgca 90
              |||||||||||||| |||||||||
Sbjct: 182132 caagcacatgcacaggcacatgca 182155



to top

>emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chromosome 6, complete
             sequence
          Length = 57743

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 30792 catgcacatgcacatgcagt 30773



to top

>emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chromosome 6, complete
             sequence
          Length = 64196

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 20317 catgcacatgcacatgcagt 20298



to top

>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 192550

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 35938 cacatgcacatgcacatgca 35919



to top

>emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on chromosome 4, complete
              sequence
          Length = 209024

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 186478 cacatgcacatgcacatgca 186497



to top

>emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86L3, complete sequence
          Length = 154099

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 85284 cacatgcacatgcacatgca 85265



to top

>gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 188653

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 131326 gcacatgcacatgcacatgc 131307



to top

>gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence
          Length = 156998

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 35047 cacatgcacatgcacatgca 35066



to top

>gb|AC140322.4| Mus musculus BAC clone RP23-413F14 from chromosome 14, complete sequence
          Length = 205679

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gctttattattgtatataaa 22
              ||||||||||||||||||||
Sbjct: 128945 gctttattattgtatataaa 128926



to top

>gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, complete sequence
          Length = 190692

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 27347 cacatgcacatgcacatgca 27328



to top

>gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, complete sequence
          Length = 170605

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 15011 cacatgcacatgcacatgca 15030



to top

>gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, complete sequence
          Length = 177978

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, complete sequence
          Length = 210074

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 58663 cacatgcacatgcacatgca 58644



to top

>gb|DP000052.1| Sus scrofa target 126 genomic scaffold
          Length = 432382

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    agcacatgcacatgcacatg 88
             ||||||||||||||||||||
Sbjct: 71903 agcacatgcacatgcacatg 71922



to top

>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence
          Length = 226416

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 15947 cacatgcacatgcacatgca 15928



to top

>gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N02) from 6p21, complete
             sequence
          Length = 129806

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 49256 catgcacatgcacatgcagt 49275



to top

>gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome 17, complete sequence
          Length = 220526

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 52103 cacatgcacatgcacatgca 52122



to top

>gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosome 13, complete
             sequence
          Length = 185090

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 49079 cacatgcacatgcacatgca 49060



to top

>gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome 13, complete sequence
          Length = 199707

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 105689 cacatgcacatgcacatgca 105708



to top

>gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosome 9, complete sequence
          Length = 185878

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 158441 gcacatgcacatgcacatgc 158460



to top

>gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex BAC MMU268P23, complete
             sequence
          Length = 185838

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 34025 catgcacatgcacatgcagt 34006



to top

>gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex BAC MMU222I18, complete
              sequence
          Length = 174202

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 73     catgcacatgcacatgcagt 92
              ||||||||||||||||||||
Sbjct: 131087 catgcacatgcacatgcagt 131068



to top

>dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830014N07 product:unclassifiable, full
            insert sequence
          Length = 2863

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 1025 cacatgcacatgcacatgca 1006



to top

>gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, complete sequence
          Length = 128950

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 58627 cacatgcacatgcacatgca 58646



to top

>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 70      gcacatgcacatgcacatgc 89
               ||||||||||||||||||||
Sbjct: 1244995 gcacatgcacatgcacatgc 1245014



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 72      acatgcacatgcacatgca 90
               |||||||||||||||||||
Sbjct: 1244991 acatgcacatgcacatgca 1245009



to top

>gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A17, complete sequence
          Length = 151801

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 88742 cacatgcacatgcacatgca 88723



to top

>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence
          Length = 159497

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 29950 cacatgcacatgcacatgca 29931



to top

>gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome 16, complete sequence
          Length = 154624

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 50006 cacatgcacatgcacatgca 49987



to top

>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence
          Length = 197652

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 168710 gcacatgcacatgcacatgc 168691



to top

>gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complete sequence
          Length = 152996

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 79453 cacatgcacatgcacatgca 79434



to top

>gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O11, complete sequence
          Length = 177978

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome 7, complete sequence
          Length = 189942

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 30858 cacatgcacatgcacatgca 30839



to top

>gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, complete sequence
          Length = 188226

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    gcacatgcacatgcacatgc 89
             ||||||||||||||||||||
Sbjct: 37172 gcacatgcacatgcacatgc 37153



to top

>emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chromosome X, complete
             sequence
          Length = 225082

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 82307 cacatgcacatgcacatgca 82326



to top

>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete
             sequence
          Length = 103290

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 42287 cacatgcacatgcacatgca 42268



to top

>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence
          Length = 162077

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 59327 cacatgcacatgcacatgca 59308



to top

>gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, complete sequence
          Length = 199709

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 62321 cacatgcacatgcacatgca 62302



to top

>gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, complete sequence
          Length = 172093

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 50462 cacatgcacatgcacatgca 50443



to top

>gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome 6, complete sequence
          Length = 212275

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 191335 cacatgcacatgcacatgca 191316



to top

>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence
          Length = 185649

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 124609 cacatgcacatgcacatgca 124628



to top

>gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, complete sequence
          Length = 175838

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 129905 cacatgcacatgcacatgca 129886



to top

>gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, complete sequence
          Length = 149905

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 2869 cacatgcacatgcacatgca 2888



to top

>emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e2, COMPLETE SEQUENCE
          Length = 122895

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 67   caagcacatgcacatgcacatgca 90
            |||||||| |||||||||||||||
Sbjct: 9247 caagcacaagcacatgcacatgca 9224



to top

>gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, complete sequence
          Length = 171789

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 63343 cacatgcacatgcacatgca 63362



to top

>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete
           sequence
          Length = 217169

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  cacatgcacatgcacatgca 90
           ||||||||||||||||||||
Sbjct: 814 cacatgcacatgcacatgca 795



to top

>emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene
          Length = 4787

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   gcacatgcacatgcacatgc 89
            ||||||||||||||||||||
Sbjct: 4003 gcacatgcacatgcacatgc 4022



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 72   acatgcacatgcacatgca 90
            |||||||||||||||||||
Sbjct: 3999 acatgcacatgcacatgca 4017



to top

>gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41 of 83 of the complete
              sequence
          Length = 280378

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 149774 gcacatgcacatgcacatgc 149755



to top

>emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence
          Length = 139693

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 109011 cacatgcacatgcacatgca 109030



to top

>gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, complete sequence
          Length = 278172

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 254552 cacatgcacatgcacatgca 254571



to top

>emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chromosome 14, complete
              sequence
          Length = 178159

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     caagcacatgcacatgcaca 86
              ||||||||||||||||||||
Sbjct: 150708 caagcacatgcacatgcaca 150727



to top

>gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome 14, complete sequence
          Length = 186187

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 65805 cacatgcacatgcacatgca 65824



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    gcacatgcacatgcacatg 88
             |||||||||||||||||||
Sbjct: 65810 gcacatgcacatgcacatg 65828



to top

>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete
             sequence
          Length = 181372

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 37404 cacatgcacatgcacatgca 37385



to top

>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence
          Length = 162290

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 22263 cacatgcacatgcacatgca 22282



to top

>emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21 on chromosome 6p21.31-22.2
              Contains a MAS1 oncogene pseudogene, the OR2H2 gene for
              olfactory receptor 2H2, olfactory receptor 2I1 and 2H5
              pseudogenes OR2I1P and OR2H5P, the gene for diubiquitin, an
              RPL13A (60S Ribosomal Protein L13A) pseudogene, the GABBR1
              gene for gamma-aminobutyric acid (GABA) B receptor 1 and an
              SMT3H1 or SMT3H2 (SMT3 (suppressor of mif two 3, yeast)
              homolog) pseudogene and three CpG islands, complete
              sequence
          Length = 134292

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 73     catgcacatgcacatgcagt 92
              ||||||||||||||||||||
Sbjct: 104348 catgcacatgcacatgcagt 104329



to top

>emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa0037L20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 178827

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    acatgcacatgcacatgcag 91
             ||||||||||||||||||||
Sbjct: 83947 acatgcacatgcacatgcag 83966



to top

>gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete sequence
          Length = 40293

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 22052 cacatgcacatgcacatgca 22071



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 71      cacatgcacatgcacatgca 90
               ||||||||||||||||||||
Sbjct: 1995856 cacatgcacatgcacatgca 1995875



to top

>gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complete sequence
          Length = 205543

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 66199 cacatgcacatgcacatgca 66180



to top

>gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, complete sequence
          Length = 186190

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 178171 cacatgcacatgcacatgca 178152



to top

>gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complete sequence
          Length = 174224

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 158756 cacatgcacatgcacatgca 158737



to top

>emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 in linkage group 1,
             complete sequence
          Length = 76732

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 65303 cacatgcacatgcacatgca 65284



to top

>emb|CT025838.2| Medicago truncatula chromosome 5 clone mth2-124f10, COMPLETE SEQUENCE
          Length = 113309

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 67     caagcacatgcacatgcacatgca 90
              |||||||| |||||||||||||||
Sbjct: 112245 caagcacaagcacatgcacatgca 112222



to top

>gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, complete sequence
          Length = 193750

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 116174 gcacatgcacatgcacatgc 116155



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 116178 acatgcacatgcacatgca 116160



to top

>gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome 17, complete
           sequence
          Length = 161769

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  cacatgcacatgcacatgca 90
           ||||||||||||||||||||
Sbjct: 306 cacatgcacatgcacatgca 325



to top

>gb|DQ221252.1| Tetraodon nigroviridis voltage-gated sodium channel Nav1.4b (Nav1.4b)
            gene, complete cds
          Length = 14067

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   cacatgcacatgcacatgca 90
            ||||||||||||||||||||
Sbjct: 8258 cacatgcacatgcacatgca 8277



to top

>gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome 8, complete sequence
          Length = 224462

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 62731 cacatgcacatgcacatgca 62712



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     cacatgcacatgcacatgc 89
              |||||||||||||||||||
Sbjct: 155920 cacatgcacatgcacatgc 155902



to top

>emb|AL844900.3| Mouse DNA sequence from clone RP23-301L16 on chromosome X, complete
             sequence
          Length = 183256

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 33714 cacatgcacatgcacatgca 33733



to top

>emb|AL626774.23| Mouse DNA sequence from clone RP23-198O15 on chromosome 4, complete
             sequence
          Length = 181545

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 57207 cacatgcacatgcacatgca 57226



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 56982 acatgcacatgcacatgca 57000



to top

>gb|M23926.1|MUSIFN6A Mus musculus (clone pKK22) interferon-alpha 6 (IFN-alpha-6) gene,
           5' region
          Length = 812

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  cacatgcacatgcacatgca 90
           ||||||||||||||||||||
Sbjct: 511 cacatgcacatgcacatgca 530



to top

>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete
             sequence
          Length = 205838

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    caagcacatgcacatgcaca 86
             ||||||||||||||||||||
Sbjct: 36057 caagcacatgcacatgcaca 36038



to top

>emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chromosome 4, complete
             sequence
          Length = 252953

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacatgcacatgcacatgca 90
             ||||||||||||||||||||
Sbjct: 27449 cacatgcacatgcacatgca 27468



to top

>emb|AL772170.14| Mouse DNA sequence from clone RP23-322G9 on chromosome 4, complete
              sequence
          Length = 195589

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     gcacatgcacatgcacatgc 89
              ||||||||||||||||||||
Sbjct: 189021 gcacatgcacatgcacatgc 189002



to top

>emb|AL806523.14| Mouse DNA sequence from clone RP23-423O7 on chromosome 4, complete
              sequence
          Length = 217762

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cacatgcacatgcacatgca 90
              ||||||||||||||||||||
Sbjct: 112286 cacatgcacatgcacatgca 112305



to top

>dbj|AB065476.1| Homo sapiens gene for seven transmembrane helix receptor, complete cds,
             isolate:CBRC7TM_39
          Length = 39703

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    catgcacatgcacatgcagt 92
             ||||||||||||||||||||
Sbjct: 20037 catgcacatgcacatgcagt 20056



to top

>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence
          Length = 181052

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 65856 acatgcacatgcacatgca 65838



to top

>gb|AC102656.28| Mus musculus chromosome 5, clone RP23-15G1, complete sequence
          Length = 227533

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 68     aagcacatgcacatgcacatgca 90
              |||||||||||||||| ||||||
Sbjct: 163531 aagcacatgcacatgcgcatgca 163509



to top

>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence
          Length = 196946

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 64    aagcaagcacatgcacatgcaca 86
             ||||| |||||||||||||||||
Sbjct: 49013 aagcatgcacatgcacatgcaca 49035



to top

>gb|AC099614.9| Mus musculus chromosome 15, clone RP23-408O11, complete sequence
          Length = 201092

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     cacatgcacatgcacatgc 89
              |||||||||||||||||||
Sbjct: 150019 cacatgcacatgcacatgc 150001



to top

>gb|AC139513.10| Mus musculus chromosome 15, clone RP23-151N6, complete sequence
          Length = 238980

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 71     cacatgcacatgcacatgc 89
              |||||||||||||||||||
Sbjct: 166766 cacatgcacatgcacatgc 166784



to top

>gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, complete sequence
          Length = 183287

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 138669 acatgcacatgcacatgca 138651



to top

>gb|AC154465.2| Mus musculus BAC clone RP24-146O1 from chromosome 14, complete sequence
          Length = 189186

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acatgcacatgcacatgca 90
             |||||||||||||||||||
Sbjct: 66958 acatgcacatgcacatgca 66976



to top

>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence
          Length = 213155

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     acatgcacatgcacatgca 90
              |||||||||||||||||||
Sbjct: 109302 acatgcacatgcacatgca 109284



to top

>gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, complete sequence
          Length = 211691

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     cacatgcacatgcacatgc 89
              |||||||||||||||||||
Sbjct: 142992 cacatgcacatgcacatgc 142974


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,267,059
Number of Sequences: 3902068
Number of extensions: 1267059
Number of successful extensions: 113781
Number of sequences better than 10.0: 340
Number of HSP's better than 10.0 without gapping: 342
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111667
Number of HSP's gapped (non-prelim): 1865
length of query: 127
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 106
effective length of database: 17,151,101,840
effective search space: 1818016795040
effective search space used: 1818016795040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top