ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet06c12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds Length = 1080 Score = 101 bits (51), Expect = 2e-18 Identities = 204/255 (80%) Strand = Plus / Minus Query: 146 tgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtaga 205 |||||||||| ||||||||||| |||| || || |||| ||| ||||| |||||||||| Sbjct: 967 tgtagcagtccaggttgtttccgtagctgacgccgaggaggtcgcagtagcgcttgtaga 908 Query: 206 acccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccaccattaa 265 |||| |||||||| | || | || |||||| || |||||||| ||| ||||| | Sbjct: 907 acccgatccggtctgcgacgcggttgtcctgccctttgccgcactcgagcccgccattga 848 Query: 266 tgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacg 325 ||||||||||||| ||||||||||| ||||||| || || || | ||| |||| ||| | Sbjct: 847 tgatgttggtgatcacgccgtacccgggcaccctccccgccgcttggtctgcgctcgagg 788 Query: 326 gcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccc 385 | ||||||| || |||||||||||||| || ||||||| || ||||||||||| || Sbjct: 787 ggctccactggccggtgatcacggcgtggctcgacggcttgggcgactgagccgtcatcc 728 Query: 386 aaaaccacaacgccg 400 | ||||||| ||||| Sbjct: 727 agaaccacagcgccg 713
>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds Length = 1148 Score = 95.6 bits (48), Expect = 1e-16 Identities = 174/216 (80%) Strand = Plus / Minus Query: 138 cctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcg 197 |||||||||||||||||| ||||||| || |||| || ||||||| ||| ||||| || Sbjct: 999 cctttggttgtagcagtccaggttgtcaccgtagctgacgccaaggaggtcgcagtagcg 940 Query: 198 cttgtagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctccc 257 |||||||||||| |||||||| | || | || |||||| ||||||||| ||| Sbjct: 939 cttgtagaacccgatccggtcggcgacacggccgtcctgcccgcgcccgcactcgagccc 880 Query: 258 accattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggc 317 ||| || |||||||||||||| || |||||||||||||||| || || || | |||||| Sbjct: 879 accgttgatgatgttggtgatcacaccgtacccaggcaccctccccgccgcctggtcggc 820 Query: 318 gcccgacggcgtccactgacccgtgatcacggcgtg 353 |||||| || ||||| | |||||||||||| |||| Sbjct: 819 gcccgaggggctccaccggcccgtgatcacgtcgtg 784
>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds Length = 1779 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||||||||||||| || ||||||| || || || |||| ||| ||| | Sbjct: 1511 atgatgttggtgatgacgccgtagccgggcaccctccccgccgcggtgtctgcggccgtc 1452 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 |||||||| || ||||||||||||||||| || | ||||||||| ||||| | ||||| | Sbjct: 1451 ggcgtccattggcccgtgatcacggcgtgagaggacggcttgttggcctgcggcgtcatc 1392 Query: 385 caaaacca 392 || ||||| Sbjct: 1391 cagaacca 1384 Score = 44.1 bits (22), Expect = 0.34 Identities = 70/86 (81%) Strand = Plus / Minus Query: 133 aaggacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacag 192 |||| ||| |||||||||||||| |||||| || ||||| || ||||||| || ||| Sbjct: 1643 aagggcctctggttgtagcagtcgaggttgcccccgtagccgacgccaaggatgttgcag 1584 Query: 193 tatcgcttgtagaacccaatccggtc 218 || |||| |||||| || |||||||| Sbjct: 1583 tagcgctggtagaagccgatccggtc 1558
>gb|AY106654.1| Zea mays PCO078819 mRNA sequence Length = 574 Score = 79.8 bits (40), Expect = 6e-12 Identities = 147/182 (80%), Gaps = 3/182 (1%) Strand = Plus / Plus Query: 190 cagtatcgcttgtagaacccaatccggtcaaccacctcggggttctgccccttcccgcac 249 ||||| ||||||||||| ||||||||||| ||| ||||| | ||| | ||||||| Sbjct: 255 cagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccgcac 314 Query: 250 tccctcccaccattaatgatgttggtgatgacgccgtacccaggcac---ccggccggcg 306 || ||||||| || |||||||||||||| ||||||||||| ||| | ||||||||| Sbjct: 315 tcgatcccaccgttgatgatgttggtgatcacgccgtaccctggcgcgccccggccggcc 374 Query: 307 gcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 || |||| || ||| ||||||||||| ||||||||||||||||| ||| ||||||| Sbjct: 375 gccctgtccgcagccgtgggcgtccactgccccgtgatcacggcgtggcacgacggcttg 434 Query: 367 tt 368 || Sbjct: 435 tt 436
>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 1192 Score = 77.8 bits (39), Expect = 2e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 255 cccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtc 314 |||||| || |||||||||||||| ||||||||||||||||||| || || || | ||| Sbjct: 876 cccaccgttgatgatgttggtgatcacgccgtacccaggcaccctacccgctgcctggtc 817 Query: 315 ggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| || ||||| | |||||||||||| |||| Sbjct: 816 ggcgcccgaggggctccaccggcccgtgatcacgtcgtg 778 Score = 50.1 bits (25), Expect = 0.006 Identities = 64/77 (83%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 |||||||||||||| || |||| || |||| || || |||| ||||||||| |||||| Sbjct: 989 tggttgtagcagtccagattgtggccgtagctgacgccgaggaggtcacagtagcgcttg 930 Query: 202 tagaacccaatccggtc 218 |||||||| || ||||| Sbjct: 929 tagaacccgattcggtc 913
>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds Length = 1252 Score = 77.8 bits (39), Expect = 2e-11 Identities = 135/167 (80%) Strand = Plus / Minus Query: 234 ctgccccttcccgcactccctcccaccattaatgatgttggtgatgacgccgtacccagg 293 |||||| || |||||||| ||| ||||| |||||||||||||| ||||||||||| || Sbjct: 879 ctgccctttgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccggg 820 Query: 294 cacccggccggcggcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||| || || || | ||| |||| ||| || ||||||| || |||||||||||||| Sbjct: 819 caccctccccgccgcctggtctgcgctcgaggggctccactggccggtgatcacggcgtg 760 Query: 354 cgacgccggcttgttcgcctgagccgtcacccaaaaccacaacgccg 400 || ||||||| || ||||||||||| ||| ||||||| ||||| Sbjct: 759 gctcgacggcttgggcgactgagccgtcatccagaaccacagcgccg 713 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 144 gttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgta 203 |||||||||||| ||||||| ||| |||| || || |||| ||| ||||| |||||||| Sbjct: 975 gttgtagcagtccaggttgtctccgtagctgacgccgaggaggtcgcagtagcgcttgta 916 Query: 204 gaacccaatccggtc 218 |||||| |||||||| Sbjct: 915 gaacccgatccggtc 901
>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase (OSJNBb0015I11.16), mRNA Length = 891 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||||||||| || || ||||||||||| |||| || ||||| Sbjct: 740 atgatgttggtgatgacgccgtaccccgggacgcggccggcggcggtgtccgccgccgac 681 Query: 325 ggcgtccac 333 ||||||||| Sbjct: 680 ggcgtccac 672
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||||||||| || || ||||||||||| |||| || ||||| Sbjct: 104211 atgatgttggtgatgacgccgtaccccgggacgcggccggcggcggtgtccgccgccgac 104152 Query: 325 ggcgtccac 333 ||||||||| Sbjct: 104151 ggcgtccac 104143 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| |||| || ||||| Sbjct: 89485 atgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgccgac 89426 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 89425 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 89366 Query: 385 caaaacca 392 || ||||| Sbjct: 89365 cagaacca 89358
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||||||||| || || ||||||||||| |||| || ||||| Sbjct: 20702759 atgatgttggtgatgacgccgtaccccgggacgcggccggcggcggtgtccgccgccgac 20702700 Query: 325 ggcgtccac 333 ||||||||| Sbjct: 20702699 ggcgtccac 20702691 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| |||| || ||||| Sbjct: 20688033 atgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgccgac 20687974 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 20687973 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 20687914 Query: 385 caaaacca 392 || ||||| Sbjct: 20687913 cagaacca 20687906 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgt 25 |||||||||||||||||||| Sbjct: 6966265 taaaaatattatttatttgt 6966246
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||||||||| || || ||||||||||| |||| || ||||| Sbjct: 20714031 atgatgttggtgatgacgccgtaccccgggacgcggccggcggcggtgtccgccgccgac 20713972 Query: 325 ggcgtccac 333 ||||||||| Sbjct: 20713971 ggcgtccac 20713963 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| |||| || ||||| Sbjct: 20699305 atgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgccgac 20699246 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 20699245 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 20699186 Query: 385 caaaacca 392 || ||||| Sbjct: 20699185 cagaacca 20699178 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgt 25 |||||||||||||||||||| Sbjct: 6969551 taaaaatattatttatttgt 6969532
>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase (OSJNBb0015I11.14), mRNA Length = 924 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| |||| || ||||| Sbjct: 644 atgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgccgac 585 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 584 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 525 Query: 385 caaaacca 392 || ||||| Sbjct: 524 cagaacca 517
>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full insert sequence Length = 1073 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| |||| || ||||| Sbjct: 670 atgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgccgac 611 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 610 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 551 Query: 385 caaaacca 392 || ||||| Sbjct: 550 cagaacca 543
>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence Length = 1173 Score = 71.9 bits (36), Expect = 2e-09 Identities = 168/212 (79%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 |||||||||||||| ||||||| || |||| || || |||| ||| ||||| |||||| Sbjct: 1134 tggttgtagcagtccaggttgtccccgtagctgacgccgaggaggtcgcagtagcgcttg 1075 Query: 202 tagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccacca 261 |||||||| |||| ||| | || | || ||||||||| |||||||| ||| || Sbjct: 1074 tagaacccgatcctgtcggcgacgcggttgtcctgccccttgccgcactcgagcccgccg 1015 Query: 262 ttaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgccc 321 || |||||||| ||||| ||||||||||| ||||||| || || || | ||| |||||| Sbjct: 1014 ttgatgatgttagtgatcacgccgtacccgggcaccctccccgccgcctggtctgcgccc 955 Query: 322 gacggcgtccactgacccgtgatcacggcgtg 353 || || ||||||| || |||||||||||||| Sbjct: 954 gaggggctccactggccggtgatcacggcgtg 923
>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA, complete cds Length = 1121 Score = 71.9 bits (36), Expect = 2e-09 Identities = 168/212 (79%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 |||||||||||||| ||||||| || |||| || || || | ||| ||||| |||||| Sbjct: 1009 tggttgtagcagtccaggttgtcgccgtagctgacgccgagtaggtcgcagtagcgcttg 950 Query: 202 tagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccacca 261 |||||||| |||||||| | || || || |||||| ||||||||| |||||| Sbjct: 949 tagaacccgatccggtcggcaacacgggcgtcctgcccgcgcccgcactcgagcccaccg 890 Query: 262 ttaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgccc 321 || |||||||||||||| || |||||||||||||||| || || || | |||||||||| Sbjct: 889 ttgatgatgttggtgatcacaccgtacccaggcaccctccccgccgcctggtcggcgccc 830 Query: 322 gacggcgtccactgacccgtgatcacggcgtg 353 || || ||||| | ||||| |||||| |||| Sbjct: 829 gaggggctccaccggcccgtaatcacgtcgtg 798
>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene, complete cds Length = 891 Score = 67.9 bits (34), Expect = 2e-08 Identities = 211/270 (78%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcac 190 |||||| ||| |||||||||||||| ||||||| || ||||| || || |||| ||| | Sbjct: 796 caaagggcctctggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgc 737 Query: 191 agtatcgcttgtagaacccaatccggtcaaccacctcggggttctgccccttcccgcact 250 |||| |||||||| ||||| ||||| ||| | || | || ||||| | |||||||| Sbjct: 736 agtagcgcttgtaaaacccgatccgatcagcgacgcggctgtcttgcccgtgcccgcact 677 Query: 251 ccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcat 310 | ||||||| || |||||||||||||| || || |||| |||||||| || ||||| Sbjct: 676 cgatcccaccgttgatgatgttggtgatcacaccaaacccgggcacccgccctgcggccc 617 Query: 311 tgtcggcgcccgacggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcg 370 ||| || || || || ||||||| ||||||||||| || || || |||||| || Sbjct: 616 ggtctgcccctgaggggctccactggcccgtgatcacagcatggctcgacggctttggcg 557 Query: 371 cctgagccgtcacccaaaaccacaacgccg 400 |||||||||||| ||| ||||||| ||||| Sbjct: 556 cctgagccgtcatccagaaccacatcgccg 527
>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase Length = 1120 Score = 65.9 bits (33), Expect = 9e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 138 cctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcg 197 ||||||||||||||||||||||||| ||||||| || ||||| | ||||||||| | Sbjct: 970 cctttggttgtagcagtcaaggttggagccatagctgactccaagcaagtcacagtacct 911 Query: 198 cttgtagaacccaatccggtc 218 ||||||||| ||||| ||||| Sbjct: 910 cttgtagaagccaatgcggtc 890
>dbj|AB015655.1| Cucurbita cv. Ebisu Nankin chitP1 mRNA for chitinase, complete cds Length = 1058 Score = 65.9 bits (33), Expect = 9e-08 Identities = 60/69 (86%) Strand = Plus / Minus Query: 255 cccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtc 314 ||||||||| ||||||||||||||||| || ||||||||||| | ||||| ||| |||| Sbjct: 833 cccaccattgatgatgttggtgatgacaccatacccaggcactctcccggcagcactgtc 774 Query: 315 ggcgcccga 323 |||| |||| Sbjct: 773 ggcggccga 765
>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds Length = 923 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||||||||| ||||| || || ||||||||||| | || || ||||| Sbjct: 650 atgatgttggtgatgacgccatacccggggacgcggccggcggcgtgttccgccgccgac 591 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||| | || ||| ||| |||| ||| |||||||||| |||| ||||||| | Sbjct: 590 ggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtcatc 531 Query: 385 caaaacca 392 || ||||| Sbjct: 530 cagaacca 523
>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete sequence Length = 146303 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 243 cccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggcc 302 |||||||||| ||| || || |||||||||||||| ||||||||||| |||||||| || Sbjct: 96187 cccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccgccc 96128 Query: 303 ggc 305 ||| Sbjct: 96127 ggc 96125 Score = 52.0 bits (26), Expect = 0.001 Identities = 107/134 (79%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 |||||||||||| ||||||||||| ||| |||| || || || |||||| ||| || Sbjct: 87251 gatgttggtgatcacgccgtaccccggcgcccgccccgccgcggcgtcggccggcgaggg 87192 Query: 327 cgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccca 386 || |||| | |||||||||||| |||| || |||||||||| |||| | ||||| ||| Sbjct: 87191 cgcccaccgccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatcca 87132 Query: 387 aaaccacaacgccg 400 ||||||| ||||| Sbjct: 87131 gaaccacagcgccg 87118
>gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds Length = 1232 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 259 ccattaatgatgttggtgatgacgccgtacccaggcacccggccggc 305 ||||| |||||||| ||||||||||||||||| || ||||||||||| Sbjct: 866 ccattgatgatgttcgtgatgacgccgtacccgggaacccggccggc 820
>gb|AY444342.1| Oryza sativa chitinase gene, complete cds Length = 1101 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 243 cccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggcc 302 |||||||||| ||| || || |||||||||||||| ||||||||||| |||||||| || Sbjct: 963 cccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccgccc 904 Query: 303 ggc 305 ||| Sbjct: 903 ggc 901
>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds Length = 1204 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 243 cccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggcc 302 |||||||||| ||| || || |||||||||||||| ||||||||||| |||||||| || Sbjct: 870 cccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccgccc 811 Query: 303 ggc 305 ||| Sbjct: 810 ggc 808
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 243 cccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggcc 302 |||||||||| ||| || || |||||||||||||| ||||||||||| |||||||| || Sbjct: 19292112 cccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccgccc 19292053 Query: 303 ggc 305 ||| Sbjct: 19292052 ggc 19292050 Score = 52.0 bits (26), Expect = 0.001 Identities = 107/134 (79%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 |||||||||||| ||||||||||| ||| |||| || || || |||||| ||| || Sbjct: 19283176 gatgttggtgatcacgccgtaccccggcgcccgccccgccgcggcgtcggccggcgaggg 19283117 Query: 327 cgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccca 386 || |||| | |||||||||||| |||| || |||||||||| |||| | ||||| ||| Sbjct: 19283116 cgcccaccgccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatcca 19283057 Query: 387 aaaccacaacgccg 400 ||||||| ||||| Sbjct: 19283056 gaaccacagcgccg 19283043
>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds Length = 2730 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcgg 307 |||||||||||||||||||||||||| || || |||||||||| Sbjct: 2173 atgatgttggtgatgacgccgtacccggggacgcggccggcgg 2131
>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds Length = 913 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcgg 307 |||||||||||||||||||||||||| || || |||||||||| Sbjct: 633 atgatgttggtgatgacgccgtacccggggacgcggccggcgg 591
>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds Length = 1291 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 243 cccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggcc 302 |||||||||| ||| || || |||||||||||||| ||||||||||| |||||||| || Sbjct: 906 cccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccgccc 847 Query: 303 ggc 305 ||| Sbjct: 846 ggc 844
>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene, complete cds Length = 1082 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene, complete cds Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|DQ078281.1| Ulmus americana chitinase (CHT) mRNA, complete cds Length = 966 Score = 60.0 bits (30), Expect = 6e-06 Identities = 117/146 (80%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 ||||| ||||| ||||||||||| |||||||| || ||||| |||||||| | ||| Sbjct: 926 tggttatagcaatcaaggttgttcccatagccaactataaggatatcacagtaccttttg 867 Query: 202 tagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccacca 261 ||||| |||||||| || ||||||| ||| ||| || |||||||| || ||||||| Sbjct: 866 tagaatccaatccgttccaccacctggggaacctgacctttcccgcattctatcccaccg 807 Query: 262 ttaatgatgttggtgatgacgccgta 287 || || || |||||||| |||||||| Sbjct: 806 ttgataatattggtgatcacgccgta 781
>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene, complete cds Length = 811 Score = 60.0 bits (30), Expect = 6e-06 Identities = 210/270 (77%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcac 190 |||||| ||| |||||||||||||| ||||||| || ||||| || || |||| ||| | Sbjct: 796 caaagggcctctggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgc 737 Query: 191 agtatcgcttgtagaacccaatccggtcaaccacctcggggttctgccccttcccgcact 250 |||| |||||||| ||||| ||||| ||| | || | || ||||| | |||||||| Sbjct: 736 agtagcgcttgtaaaacccgatccgatcagcgacgcggctgtcttgcccgtgcccgcact 677 Query: 251 ccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcat 310 | ||||||| || |||||||||||||| || || || | |||||||| || ||||| Sbjct: 676 cgatcccaccgttgatgatgttggtgatcacaccaaacacgggcacccgccctgcggccc 617 Query: 311 tgtcggcgcccgacggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcg 370 ||| || || || || ||||||| ||||||||||| || || || |||||| || Sbjct: 616 ggtctgcccctgaggggctccactggcccgtgatcacagcatggctcgacggctttggcg 557 Query: 371 cctgagccgtcacccaaaaccacaacgccg 400 |||||||||||| ||| ||||||| ||||| Sbjct: 556 cctgagccgtcatccagaaccacatcgccg 527
>gb|L22032.1|ULMCHITIN Ulmus americana chitinase (pHS2) mRNA, complete cds Length = 1193 Score = 60.0 bits (30), Expect = 6e-06 Identities = 117/146 (80%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 ||||| ||||| ||||||||||| |||||||| || ||||| |||||||| | ||| Sbjct: 1013 tggttatagcaatcaaggttgttcccatagccaactataaggatatcacagtaccttttg 954 Query: 202 tagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccacca 261 ||||| |||||||| || ||||||| ||| ||| || |||||||| || ||||||| Sbjct: 953 tagaatccaatccgttccaccacctggggaacctgacctttcccgcattctatcccaccg 894 Query: 262 ttaatgatgttggtgatgacgccgta 287 || || || |||||||| |||||||| Sbjct: 893 ttgataatattggtgatcacgccgta 868
>emb|X59995.1|PTGWIN62B P.trichocarpa chitinase gene gwin6.2b, chiX pseudogene and gwin6.2c gene 5'-region Length = 7305 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 148 tagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaac 207 |||||||| || ||||||||||| || || ||||| | ||||||||| | |||||||||| Sbjct: 3439 tagcagtcgagattgtttccatatccaactccaagcaagtcacagtacctcttgtagaac 3380 Query: 208 ccaat 212 ||||| Sbjct: 3379 ccaat 3375
>gb|AF034566.1|AF034566 Gossypium hirsutum class I chitinase mRNA, partial cds Length = 909 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 ||||||||||||||||| ||||| ||||||| || ||||| | |||||| || | ||| Sbjct: 869 tggttgtagcagtcaagattgttaccatagctaactccaagaatgtcacaatacctctta 810 Query: 202 tagaacccaatccggtc 218 ||||||||||| ||||| Sbjct: 809 tagaacccaatgcggtc 793
>gb|U78888.1|GHU78888 Gossypium hirsutum class I endochitinase mRNA, partial cds Length = 909 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 ||||||||||||||||| ||||| ||||||| || ||||| | |||||| || | ||| Sbjct: 869 tggttgtagcagtcaagattgttaccatagctaactccaagtatgtcacaatacctctta 810 Query: 202 tagaacccaatccggtc 218 ||||||||||| ||||| Sbjct: 809 tagaacccaatgcggtc 793
>gb|U60197.1|GHU60197 Gossypium hirsutum class I chitinase gene, complete cds Length = 1335 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 ||||||||||||||||| ||||| ||||||| || ||||| | |||||| || | ||| Sbjct: 1262 tggttgtagcagtcaagattgttaccatagctaactccaagtatgtcacaatacctctta 1203 Query: 202 tagaacccaatccggtc 218 ||||||||||| ||||| Sbjct: 1202 tagaacccaatgcggtc 1186
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds Length = 1163 Score = 58.0 bits (29), Expect = 2e-05 Identities = 131/165 (79%) Strand = Plus / Minus Query: 141 ttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgctt 200 ||||||||||||||| ||||| || || ||||| | || | | |||||| || ||||| Sbjct: 947 ttggttgtagcagtcgaggttattcccgtagccgatgccgaaaatgtcacaatagcgctt 888 Query: 201 gtagaacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccacc 260 ||||||||| ||||| || |||||| | |||||||||| | ||||| || |||| || Sbjct: 887 gtagaacccgatccgatccgccaccttgtcgttctgccccatgccgcattcgatcccgcc 828 Query: 261 attaatgatgttggtgatgacgccgtacccaggcacccggccggc 305 || |||| |||||||||||| || ||||| || ||||| ||||| Sbjct: 827 gttgatgacgttggtgatgacaccatacccgggtacccgtccggc 783
>ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA Length = 981 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 860 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 801 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 800 gccgcctggtcgtcggcggagggcgtccactg 769
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 17203966 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 17203907 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 17203906 gccgcctggtcgtcggcggagggcgtccactg 17203875
>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete sequence Length = 115326 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 36710 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 36651 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 36650 gccgcctggtcgtcggcggagggcgtccactg 36619
>emb|X88800.1|VURNACHI1 V.unguiculata mRNA for chitinase clase 1 (partial) Length = 1146 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Minus Query: 147 gtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaa 206 |||||||||||||||||| ||||| || || |||| | ||||||||||||||| |||| Sbjct: 916 gtagcagtcaaggttgttgccataaccaactccaaacagatcacagtatcgcttgaagaa 857 Query: 207 cccaatccggtc 218 ||| || ||||| Sbjct: 856 cccgatgcggtc 845
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 95359 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 95300 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 95299 gccgcctggtcgtcggcggagggcgtccactg 95268
>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds Length = 1082 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 903 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 844 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 843 gccgcctggtcgtcggcggagggcgtccactg 812
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 56.0 bits (28), Expect = 9e-05 Identities = 76/92 (82%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 ||||||||| ||| || || ||||||||||||||||||||||| || ||||| ||||| Sbjct: 17197535 ccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcacgcggccc 17197476 Query: 304 gcggcattgtcggcgcccgacggcgtccactg 335 || || | |||| || | || ||||||||||| Sbjct: 17197475 gccgcctggtcgtcggcggagggcgtccactg 17197444
>gb|AF307511.1|AF307511 Vigna sesquipedalis class I chitinase gene, partial cds Length = 892 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Minus Query: 147 gtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaa 206 |||||||||||||||||| ||||| || || |||| | ||||||||||||||| |||| Sbjct: 844 gtagcagtcaaggttgttgccataaccaactccaaacagatcacagtatcgcttgaagaa 785 Query: 207 cccaatccggtc 218 ||| || ||||| Sbjct: 784 cccgatgcggtc 773
>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase Length = 1985 Score = 54.0 bits (27), Expect = 4e-04 Identities = 81/99 (81%) Strand = Plus / Minus Query: 255 cccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtc 314 |||||| || |||||||| ||||| || |||||||||||||||| || || || | ||| Sbjct: 1466 cccaccgttgatgatgttagtgatcacaccgtacccaggcaccctccccgccgcctggtc 1407 Query: 315 ggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| || ||||| | ||||| |||||| |||| Sbjct: 1406 ggcgcccgaggggctccaccggcccgtaatcacgtcgtg 1368
>dbj|AB051578.1| Secale cereale rsca mRNA for seed chitinase-a, complete cds Length = 1191 Score = 54.0 bits (27), Expect = 4e-04 Identities = 128/159 (80%), Gaps = 2/159 (1%) Strand = Plus / Minus Query: 142 tggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttg 201 |||||||| ||||| |||||||| |||||||| || | ||||| ||| ||||| |||||| Sbjct: 1007 tggttgtaacagtcgaggttgttgccatagccaacacgaaggatgtcgcagtagcgcttg 948 Query: 202 tagaacccaatccggtcaaccacctcggg-gttctgccccttcccgcactccctcccacc 260 || ||||| || || || | || |||| || |||||| | ||||||||| |||| || Sbjct: 947 taaaacccgattcgatcggcgac-tcggctgtcctgcccatgcccgcactcgatcccgcc 889 Query: 261 attaatgatgttggtgatgacgccgtacccaggcacccg 299 ||| | |||||||||||| ||||| |||| |||||||| Sbjct: 888 attgacgatgttggtgatcacgccaaacccgggcacccg 850
>gb|U30324.1|TCU30324 Theobroma cacao class I chitinase gene, complete cds Length = 1856 Score = 54.0 bits (27), Expect = 4e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 136 gacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtat 195 ||||| |||||||||||||| || ||||| |||||||| || ||||| |||||| || Sbjct: 1602 gacctctggttgtagcagtcgagattgttaccatagccaactccaagtgtgtcacaatac 1543 Query: 196 cgcttgtagaacccaatccggtc 218 | ||| ||||||||||| ||||| Sbjct: 1542 ctcttatagaacccaatgcggtc 1520
>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds Length = 1128 Score = 54.0 bits (27), Expect = 4e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 ||||||||||| ||||||||| || |||| || ||||||||| |||| ||| | || || Sbjct: 840 gatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagcggcggaggg 781 Query: 327 cgtccactgacccgt 341 ||||||||| ||||| Sbjct: 780 cgtccactgccccgt 766 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 932 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 889
>gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, partial cds Length = 1012 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||||||||||||| || || | || || ||||| ||||||||| |||| Sbjct: 656 atgatgttggtgatgacgccgtagcccggaagcctccccgcggccttgtcggcggccgag 597 Query: 325 ggcgtccactg 335 || |||||||| Sbjct: 596 ggggtccactg 586
>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene, complete cds Length = 1081 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 827 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 768 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 767 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 726 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 917 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 874
>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene, complete cds Length = 1084 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 830 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 771 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 770 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 729 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 920 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 877
>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene, complete cds Length = 1081 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 827 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 768 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 767 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 726 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 917 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 874
>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 827 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 768 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 767 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 726 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 917 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 874
>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene, complete cds Length = 1078 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene, complete cds Length = 1087 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 824 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 765 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 764 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 723 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 914 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 871
>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene, complete cds Length = 1081 Score = 52.0 bits (26), Expect = 0.001 Identities = 83/102 (81%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||||||||||| ||||||||| || |||| || ||||||||| |||| || | || Sbjct: 827 atgatgttggtgacgacgccgtagcccggcagcctgccggcggccgtgtcagccgcggag 768 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttg 366 ||||||||||| ||||| || ||| |||| ||| ||||||| Sbjct: 767 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 726 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 175 accccaaggacgtcacagtatcgcttgtagaacccaatccggtc 218 |||||||| | |||||||||||| |||||||| || |||||||| Sbjct: 917 accccaagcaagtcacagtatcgtttgtagaagccgatccggtc 874
>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase Length = 1186 Score = 52.0 bits (26), Expect = 0.001 Identities = 107/134 (79%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 |||||||||||| ||||||||||| ||| |||| || || || |||||| ||| || Sbjct: 861 gatgttggtgatcacgccgtaccccggcgcccgccccgccgcggcgtcggccggcgaggg 802 Query: 327 cgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccca 386 || |||| | |||||||||||| |||| || |||||||||| |||| | ||||| ||| Sbjct: 801 cgcccaccgccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatcca 742 Query: 387 aaaccacaacgccg 400 ||||||| ||||| Sbjct: 741 gaaccacagcgccg 728
>emb|Z68153.1|GHCHI2B G.hirsutum chitinase gene (2525 bp) Length = 2525 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtacccagg 293 |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 1575 ccaccattgatgatgttggtgatgacaccgtatccagg 1538 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 139 ctttggttgtagcagtcaaggttgt 163 |||||||||||||||||||| |||| Sbjct: 1692 ctttggttgtagcagtcaagattgt 1668
>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full insert sequence Length = 979 Score = 52.0 bits (26), Expect = 0.001 Identities = 107/134 (79%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 |||||||||||| ||||||||||| ||| |||| || || || |||||| ||| || Sbjct: 526 gatgttggtgatcacgccgtaccccggcgcccgccccgccgcggcgtcggccggcgaggg 467 Query: 327 cgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccca 386 || |||| | |||||||||||| |||| || |||||||||| |||| | ||||| ||| Sbjct: 466 cgcccaccgccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatcca 407 Query: 387 aaaccacaacgccg 400 ||||||| ||||| Sbjct: 406 gaaccacagcgccg 393
>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase, complete cds Length = 2986 Score = 52.0 bits (26), Expect = 0.001 Identities = 107/134 (79%) Strand = Plus / Minus Query: 267 gatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgacgg 326 |||||||||||| ||||||||||| ||| |||| || || || |||||| ||| || Sbjct: 2296 gatgttggtgatcacgccgtaccccggcgcccgccccgccgcggcgtcggccggcgaggg 2237 Query: 327 cgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcaccca 386 || |||| | |||||||||||| |||| || |||||||||| |||| | ||||| ||| Sbjct: 2236 cgcccaccgccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatcca 2177 Query: 387 aaaccacaacgccg 400 ||||||| ||||| Sbjct: 2176 gaaccacagcgccg 2163
>gb|AY378172.1| Oryza sativa (japonica cultivar-group) OsmChiI-34 mRNA, partial cds Length = 894 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 842 cagtagcgcttgtagaacccaatccggtc 814
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 1025 cagtagcgcttgtagaacccaatccggtc 997
>emb|X87109.1|OSDNARC24 O.sativa RC24 gene Length = 2048 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 1958 cagtagcgcttgtagaacccaatccggtc 1930
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 857 cagtagcgcttgtagaacccaatccggtc 829
>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase Length = 556 Score = 50.1 bits (25), Expect = 0.006 Identities = 141/177 (79%), Gaps = 2/177 (1%) Strand = Plus / Minus Query: 133 aaggacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacag 192 |||| ||| ||| |||||||||| |||||||| || ||||| || || |||| ||| ||| Sbjct: 530 aagggcctctggctgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcag 471 Query: 193 tatcgcttgtagaacccaatccggtcaaccacctcggg-gttctgccccttcccgcactc 251 || |||||||| ||||| ||||| || | || ||| || |||||| | ||||||||| Sbjct: 470 tagcgcttgtaaaacccgatccgatcggcgac-tcgactgtcctgcccatgcccgcactc 412 Query: 252 cctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggc 308 |||| || || | |||||||||||| ||||| ||||||||||||| || ||||| Sbjct: 411 gatcccgccgttgacgatgttggtgatcacgccaaacccaggcacccgccccgcggc 355
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 30375892 cagtagcgcttgtagaacccaatccggtc 30375864 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 30372208 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 30372149 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 30372148 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 30372089 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 30372088 cagaaccagaacgccg 30372073
>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds Length = 1018 Score = 50.1 bits (25), Expect = 0.006 Identities = 109/137 (79%) Strand = Plus / Minus Query: 145 ttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtag 204 ||||||||||| ||||||| || ||||| || || |||| ||| ||||| |||||||| Sbjct: 836 ttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaa 777 Query: 205 aacccaatccggtcaaccacctcggggttctgccccttcccgcactccctcccaccatta 264 ||||| ||||| || | || | || |||||| | ||||||||| ||||||||| Sbjct: 776 aacccgatccgatcggcaacgcggctgtcctgcccgtgcccgcactcgagcccaccattg 717 Query: 265 atgatgttggtgatgac 281 ||||||||||||||||| Sbjct: 716 atgatgttggtgatgac 700 Score = 40.1 bits (20), Expect = 5.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 369 cgcctgagccgtcacccaaaaccacaacgccg 400 |||||| ||||||| ||| ||||||||||||| Sbjct: 612 cgcctgcgccgtcatccagaaccacaacgccg 581
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 13253 cagtagcgcttgtagaacccaatccggtc 13225 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 9569 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 9510 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 9509 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 9450 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 9449 cagaaccagaacgccg 9434
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 122487 cagtagcgcttgtagaacccaatccggtc 122459 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 118803 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 118744 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 118743 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 118684 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 118683 cagaaccagaacgccg 118668
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 962 cagtagcgcttgtagaacccaatccggtc 934
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 957 cagtagcgcttgtagaacccaatccggtc 929
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 938 cagtagcgcttgtagaacccaatccggtc 910
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 960 cagtagcgcttgtagaacccaatccggtc 932
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| ||||||||||||||||||||||| Sbjct: 2222 cagtagcgcttgtagaacccaatccggtc 2194
>gb|AF024538.1|AF024538 Solanum tuberosum class II chitinase (ChtA4) mRNA, partial cds Length = 961 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtacccaggcac 296 ||||| |||||||||||||| ||||| |||||||| ||||| Sbjct: 589 ccaccgttaatgatgttggtaatgacaccgtaccctggcac 549
>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds Length = 1684 Score = 50.1 bits (25), Expect = 0.006 Identities = 141/177 (79%), Gaps = 2/177 (1%) Strand = Plus / Minus Query: 133 aaggacctttggttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacag 192 |||| ||| ||| |||||||||| |||||||| || ||||| || || |||| ||| ||| Sbjct: 1549 aagggcctctggctgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcag 1490 Query: 193 tatcgcttgtagaacccaatccggtcaaccacctcggg-gttctgccccttcccgcactc 251 || |||||||| ||||| ||||| || | || ||| || |||||| | ||||||||| Sbjct: 1489 tagcgcttgtaaaacccgatccgatcggcgac-tcgactgtcctgcccatgcccgcactc 1431 Query: 252 cctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccggcggc 308 |||| || || | |||||||||||| ||||| ||||||||||||| || ||||| Sbjct: 1430 gatcccgccgttgacgatgttggtgatcacgccaaacccaggcacccgccccgcggc 1374
>gb|AY357300.2| Phaseolus vulgaris class I chitinase (BCHi) gene, complete cds Length = 1088 Score = 48.1 bits (24), Expect = 0.022 Identities = 51/60 (85%) Strand = Plus / Minus Query: 147 gtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaa 206 |||||||||||||||||| ||||| || || ||||| | |||||||||| |||| |||| Sbjct: 933 gtagcagtcaaggttgttgccataaccaactccaagcagatcacagtatctcttgaagaa 874
>gb|AY618888.1| Nepenthes khasiana basic chitinase 2-2 mRNA, complete cds Length = 957 Score = 48.1 bits (24), Expect = 0.022 Identities = 57/68 (83%) Strand = Plus / Minus Query: 145 ttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtag 204 ||||||||||| | ||||| |||||||| || ||||| | |||||||| ||||||||| Sbjct: 914 ttgtagcagtccaaattgttgccatagccgactccaagtatatcacagtaccgcttgtag 855 Query: 205 aacccaat 212 || ||||| Sbjct: 854 aatccaat 847
>gb|AY618887.1| Nepenthes khasiana basic chitinase 2-2 gene, complete cds Length = 1674 Score = 48.1 bits (24), Expect = 0.022 Identities = 57/68 (83%) Strand = Plus / Minus Query: 145 ttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtag 204 ||||||||||| | ||||| |||||||| || ||||| | |||||||| ||||||||| Sbjct: 1631 ttgtagcagtccaaattgttgccatagccgactccaagtatatcacagtaccgcttgtag 1572 Query: 205 aacccaat 212 || ||||| Sbjct: 1571 aatccaat 1564
>gb|AY618886.1| Nepenthes khasiana basic chitinase 2-1 mRNA, complete cds Length = 957 Score = 48.1 bits (24), Expect = 0.022 Identities = 57/68 (83%) Strand = Plus / Minus Query: 145 ttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtag 204 ||||||||||| | ||||| |||||||| || ||||| | |||||||| ||||||||| Sbjct: 914 ttgtagcagtccaaattgttgccatagccgactccaagtatatcacagtaccgcttgtag 855 Query: 205 aacccaat 212 || ||||| Sbjct: 854 aatccaat 847
>gb|AY618885.1| Nepenthes khasiana basic chitinase 2-1 gene, complete cds Length = 1673 Score = 48.1 bits (24), Expect = 0.022 Identities = 57/68 (83%) Strand = Plus / Minus Query: 145 ttgtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtag 204 ||||||||||| | ||||| |||||||| || ||||| | |||||||| ||||||||| Sbjct: 1630 ttgtagcagtccaaattgttgccatagccgactccaagtatatcacagtaccgcttgtag 1571 Query: 205 aacccaat 212 || ||||| Sbjct: 1570 aatccaat 1563
>gb|AF053341.1| Vitis vinifera class I extracellular chitinase (Chi1b) mRNA, complete cds Length = 1110 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Minus Query: 187 tcacagtatcgcttgtagaacccaatccggtc 218 |||||||||| ||| ||||||||||||||||| Sbjct: 942 tcacagtatctcttatagaacccaatccggtc 911 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatga 280 |||||||| |||||||||||||||| Sbjct: 873 ccaccattgatgatgttggtgatga 849
>emb|Z68152.1|GHCHI2A G.hirsutum chitinase gene (2439 bp) Length = 2439 Score = 48.1 bits (24), Expect = 0.022 Identities = 39/44 (88%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtacccaggcacccg 299 |||||||| ||||||||||| ||||| ||||| ||||| ||||| Sbjct: 1525 ccaccattgatgatgttggtaatgacaccgtatccagggacccg 1482 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 139 ctttggttgtagcagtcaaggttgt 163 |||||||||||||||||||| |||| Sbjct: 1642 ctttggttgtagcagtcaagattgt 1618
>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase Length = 1237 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 957 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 898 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 897 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 838 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 837 cagaaccagaacgccg 822
>emb|AJ291506.1|VVI291506 Vitis vinifera chit1b gene for chitinase, exons 1-3 Length = 1618 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Minus Query: 187 tcacagtatcgcttgtagaacccaatccggtc 218 |||||||||| ||| ||||||||||||||||| Sbjct: 1427 tcacagtatctcttatagaacccaatccggtc 1396 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatga 280 |||||||| |||||||||||||||| Sbjct: 1358 ccaccattgatgatgttggtgatga 1334
>gb|S43926.1| CH5B=chitinase [Phaseolus vulgaris=beans, cv Saxa, Genomic, 4704 nt] Length = 4704 Score = 48.1 bits (24), Expect = 0.022 Identities = 51/60 (85%) Strand = Plus / Minus Query: 147 gtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaa 206 |||||||||||||||||| ||||| || || ||||| | |||||||||| |||| |||| Sbjct: 2981 gtagcagtcaaggttgttgccataaccaactccaagcagatcacagtatctcttgaagaa 2922
>gb|AF280438.1|AF280438 Secale cereale 24.8 kDa class II endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 998 Score = 48.1 bits (24), Expect = 0.022 Identities = 57/68 (83%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 ||||| |||||||| |||||||||||||| ||||| || || || || ||||| ||| | Sbjct: 695 atgatattggtgattacgccgtacccagggacccgacccgcagcgttatcggcagccgtc 636 Query: 325 ggcgtcca 332 |||||||| Sbjct: 635 ggcgtcca 628
>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full insert sequence Length = 1169 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 895 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 836 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 835 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 776 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 775 cagaaccagaacgccg 760
>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase, complete cds Length = 2808 Score = 48.1 bits (24), Expect = 0.022 Identities = 108/136 (79%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgcccgac 324 |||||||||||||| ||||||| || || || || || || || | |||| || | ||| Sbjct: 2650 atgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggcggac 2591 Query: 325 ggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtcacc 384 ||||||||||| || |||||||| ||||| ||| ||||||| || ||| | ||||| | Sbjct: 2590 ggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatc 2531 Query: 385 caaaaccacaacgccg 400 || ||||| ||||||| Sbjct: 2530 cagaaccagaacgccg 2515
>gb|M13968.1|PHVCHM P.vulgaris chitinase mRNA, complete cds Length = 1132 Score = 48.1 bits (24), Expect = 0.022 Identities = 51/60 (85%) Strand = Plus / Minus Query: 147 gtagcagtcaaggttgtttccatagcctaccccaaggacgtcacagtatcgcttgtagaa 206 |||||||||||||||||| ||||| || || ||||| | |||||||||| |||| |||| Sbjct: 963 gtagcagtcaaggttgttgccataaccgactccaagcagatcacagtatctcttgaagaa 904
>gb|AY958085.1| Staurastrum punctulatum chloroplast, complete genome Length = 157089 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Minus Query: 1 aacaataaaaatattatttattt 23 ||||||||||||||||||||||| Sbjct: 9235 aacaataaaaatattatttattt 9213
>gb|AY278737.1| Dasineura sp. RJA3011 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278736.1| Dasineura sp. RJAW2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278734.1| Dasineura sp. RJA2667 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278733.1| Dasineura sp. RJA2797 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278732.1| Dasineura sp. RJA2576 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278731.1| Dasineura sp. RJA2770 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278729.1| Dasineura sp. RJA2789 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278728.1| Dasineura sp. RJA3024 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278725.1| Dasineura sp. RJA3145 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278723.1| Dasineura sp. RJA3086 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278722.1| Dasineura sp. RJA2810 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278721.1| Dasineura sp. RJA3187 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278720.1| Dasineura sp. RJA3200 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278719.1| Dasineura sp. RJA3185 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278717.1| Dasineura sp. RJA3220 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278715.1| Dasineura sp. RJA3191 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278714.1| Dasineura sp. RJA2814 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278711.1| Dasineura sp. RJA3150 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278710.1| Dasineura sp. RJA3208 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278709.1| Dasineura sp. RJA3155 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278708.1| Dasineura sp. RJA3004 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278707.1| Dasineura sp. RJA2774 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278706.1| Dasineura sp. RJA3201 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278705.1| Dasineura sp. RJA3196 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278704.1| Dasineura sp. RJA3139 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278703.1| Dasineura sp. RJA3084 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278702.1| Dasineura sp. RJA3195 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278701.1| Dasineura sp. RJA3183 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278700.1| Dasineura sp. RJA3007 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278699.1| Dasineura sp. RJA2797 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278698.1| Dasineura sp. RJA3142 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278696.1| Dasineura sp. RJA2570 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278695.1| Dasineura sp. RJA3131 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278693.1| Dasineura sp. RJA3198 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278692.1| Dasineura sp. RJA3207 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278691.1| Dasineura sp. RJA3221 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278689.1| Dasineura sp. RJA2776 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278688.1| Dasineura dielsi cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278687.1| Dasineura sp. RJA2725 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278686.1| Dasineura sp. RJA3144 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278685.1| Dasineura sp. RJA2581 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278684.1| Dasineura sp. RJA3142 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278683.1| Dasineura sp. RJA3158 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278681.1| Dasineura sp. RJA2662 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>gb|AY278680.1| Dasineura acaciaelongifoliae cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttatttgt 25 ||||||||||||||||||||||| Sbjct: 244 caataaaaatattatttatttgt 266
>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I Length = 1100 Score = 46.1 bits (23), Expect = 0.087 Identities = 65/79 (82%) Strand = Plus / Minus Query: 322 gacggcgtccactgacccgtgatcacggcgtgcgacgccggcttgttcgcctgagccgtc 381 |||||||||||||| || |||||||| ||||| ||| ||||||| || ||| | |||| Sbjct: 779 gacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgtc 720 Query: 382 acccaaaaccacaacgccg 400 | ||| ||||| ||||||| Sbjct: 719 atccagaaccagaacgccg 701 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 190 cagtatcgcttgtagaacccaatccggtc 218 ||||| |||||||||||||| |||||||| Sbjct: 902 cagtagcgcttgtagaacccgatccggtc 874
>emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b Length = 1013 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccg 299 ||||| |||||||| |||||||| ||||||||||| Sbjct: 672 atgatattggtgattacgccgtatccaggcacccg 638
>emb|AJ277279.1|MAC277279 Musa acuminata mRNA for putative chitinase isoform 2 Length = 1129 Score = 46.1 bits (23), Expect = 0.087 Identities = 41/47 (87%) Strand = Plus / Minus Query: 241 ttcccgcactccctcccaccattaatgatgttggtgatgacgccgta 287 |||||||||||| ||| ||||| |||||||||||| |||| ||||| Sbjct: 856 ttcccgcactccaaccctccattgatgatgttggtggtgacaccgta 810
>emb|AJ277278.1|MAC277278 Musa acuminata mRNA for putative chitinase isoform 1 Length = 1186 Score = 46.1 bits (23), Expect = 0.087 Identities = 41/47 (87%) Strand = Plus / Minus Query: 241 ttcccgcactccctcccaccattaatgatgttggtgatgacgccgta 287 |||||||||||| ||| ||||| |||||||||||| |||| ||||| Sbjct: 840 ttcccgcactccaaccctccattgatgatgttggtggtgacaccgta 794
>emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (pathogenesis-related protein 3) (cht2 gene) Length = 890 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 265 atgatgttggtgatgacgccgtacccaggcacccg 299 ||||| |||||||| |||||||| ||||||||||| Sbjct: 678 atgatattggtgattacgccgtatccaggcacccg 644
>gb|AF416677.1|AF416677 Musa acuminata endochitinase (EndoChit1) mRNA, partial cds Length = 862 Score = 46.1 bits (23), Expect = 0.087 Identities = 41/47 (87%) Strand = Plus / Minus Query: 241 ttcccgcactccctcccaccattaatgatgttggtgatgacgccgta 287 |||||||||||| ||| ||||| |||||||||||| |||| ||||| Sbjct: 575 ttcccgcactccaaccctccattgatgatgttggtggtgacaccgta 529
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttatttgtg 26 ||||||||||||||||||||||| Sbjct: 19445893 aataaaaatattatttatttgtg 19445915
>gb|AF494397.1| Malus x domestica class II chitinase (CHT-3) mRNA, partial cds Length = 667 Score = 46.1 bits (23), Expect = 0.087 Identities = 41/47 (87%) Strand = Plus / Minus Query: 259 ccattaatgatgttggtgatgacgccgtacccaggcacccggccggc 305 ||||| |||||||||||||| || || |||||||| ||||| ||||| Sbjct: 413 ccattgatgatgttggtgatcactccatacccaggaacccgaccggc 367
>dbj|AP004691.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0453D01 Length = 147461 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttatttgtg 26 ||||||||||||||||||||||| Sbjct: 40650 aataaaaatattatttatttgtg 40672
>emb|AJ291505.1|VVI291505 Vitis vinifera chit1a gene for chitinase, exons 1-3 Length = 1452 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 138 cctttggttgtagcagtcaaggttgtttccatagc 172 ||||||||||| |||||| |||||||| ||||||| Sbjct: 1235 cctttggttgttgcagtccaggttgttgccatagc 1201
>gb|L19342.1|TOMPCTH28X Lycopersicon chilense endochitinase mRNA, complete cds Length = 949 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtaccc 290 ||||| |||||||||||||| ||||| |||||||| Sbjct: 646 ccaccgttaatgatgttggtaatgacaccgtaccc 612
>gb|M97210.1|TOMCHITINA Lycopersicon chilense endochitinase mRNA, partial cds Length = 918 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtaccc 290 ||||| |||||||||||||| ||||| |||||||| Sbjct: 619 ccaccgttaatgatgttggtaatgacaccgtaccc 585
>gb|DQ267094.1| Vitis vinifera chitinase class I mRNA, complete cds Length = 1133 Score = 46.1 bits (23), Expect = 0.087 Identities = 32/35 (91%) Strand = Plus / Minus Query: 138 cctttggttgtagcagtcaaggttgtttccatagc 172 ||||||||||| |||||| |||||||| ||||||| Sbjct: 929 cctttggttgttgcagtccaggttgttgccatagc 895
>gb|M95835.1|BNACH25A Brassica napus (clone BnCh25) endochitinase gene, complete cds Length = 3013 Score = 46.1 bits (23), Expect = 0.087 Identities = 29/31 (93%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaaggtt 161 ||||||||||||||||||| || |||||||| Sbjct: 1928 caaaggacctttggttgtaacaatcaaggtt 1898
>gb|AY278694.1| Dasineura sp. RJA3030 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttatttgt 25 |||||||||||||||||||||| Sbjct: 245 aataaaaatattatttatttgt 266
>emb|CT027656.2| Macaca mulatta chromosome 9 BAC CH250-15E16, complete sequence Length = 163478 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 5 ataaaaatattatttatttgtg 26 |||||||||||||||||||||| Sbjct: 53993 ataaaaatattatttatttgtg 53972
>emb|BX548069.7| Zebrafish DNA sequence from clone CH211-238G23 in linkage group 18, complete sequence Length = 142514 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 2 acaataaaaatattatttattt 23 |||||||||||||||||||||| Sbjct: 100111 acaataaaaatattatttattt 100132
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 297 ccggccggcggcattgtcggcg 318 |||||||||||||||||||||| Sbjct: 3097595 ccggccggcggcattgtcggcg 3097574
>dbj|AB059275.2| Cucumis melo mRNA for endochitinase MCHT-2, complete cds Length = 1020 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgac 281 ||||| |||||||||||||||||||| Sbjct: 809 ccaccgttaatgatgttggtgatgac 784
>gb|AC132335.3| Mus musculus BAC clone RP24-230C24 from chromosome 10, complete sequence Length = 180642 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgtg 26 ||||||||||||||||||||| Sbjct: 61966 taaaaatattatttatttgtg 61946
>gb|AC119943.12| Mus musculus chromosome 10, clone RP24-271F24, complete sequence Length = 174009 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgtg 26 ||||||||||||||||||||| Sbjct: 3545 taaaaatattatttatttgtg 3525
>gb|AY775335.1| Capsicum annuum Chi2 gene, promoter region and complete cds Length = 2619 Score = 42.1 bits (21), Expect = 1.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtacccaggcac 296 ||||||||||| |||||||| ||||| ||||| || ||||| Sbjct: 2287 ccaccattaataatgttggttatgacaccgtagcctggcac 2247
>gb|AF091235.1| Capsicum annuum chitinase class II (CAChi2) mRNA, complete cds Length = 1004 Score = 42.1 bits (21), Expect = 1.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgtacccaggcac 296 ||||||||||| |||||||| ||||| ||||| || ||||| Sbjct: 654 ccaccattaataatgttggttatgacaccgtagcctggcac 614
>gb|AY278738.1| Dasineura sp. RJAW1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 410 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 3 caataaaaatattatttattt 23 ||||||||||||||||||||| Sbjct: 244 caataaaaatattatttattt 264
>emb|BX323566.13| Zebrafish DNA sequence from clone DKEYP-67A8 in linkage group 2, complete sequence Length = 108226 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 tgtgatcacacttacacatgc 43 ||||||||||||||||||||| Sbjct: 6339 tgtgatcacacttacacatgc 6319
>gb|AC113025.9| Mus musculus chromosome 6, clone RP23-196D12, complete sequence Length = 223925 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 aacaataaaaatattatttat 21 ||||||||||||||||||||| Sbjct: 207483 aacaataaaaatattatttat 207503
>ref|XM_669549.1| Plasmodium berghei strain ANKA Pb-reticulocyte binding protein (PB000822.00.0) partial mRNA Length = 468 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgtg 26 ||||||||||||||||||||| Sbjct: 448 taaaaatattatttatttgtg 428
>gb|AC144514.10| Medicago truncatula clone mth2-12j2, complete sequence Length = 110255 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 aacaataaaaatattatttat 21 ||||||||||||||||||||| Sbjct: 71826 aacaataaaaatattatttat 71806
>gb|AC135467.15| Medicago truncatula clone mth2-34h12, complete sequence Length = 114945 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 aacaataaaaatattatttat 21 ||||||||||||||||||||| Sbjct: 6497 aacaataaaaatattatttat 6517
>emb|Z15141.1|LECHI3 L.esculentum mRNA for chitinase Length = 941 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 262 ttaatgatgttggtgatgacgccgtaccc 290 |||||||||||||| ||||| |||||||| Sbjct: 626 ttaatgatgttggtaatgacaccgtaccc 598
>emb|X16939.1|NTECHITR Nicotiana tabacum mRNA for endochitinase (EC 3.2.1.14) Length = 1132 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgcc 284 |||||||| |||||||| ||||||||||| Sbjct: 837 ccaccattgatgatgtttgtgatgacgcc 809
>emb|X16938.1|NTECHITG Nicotiana tabacum gene for endochitinase (EC 3.2.1.14) Length = 3850 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgcc 284 |||||||| |||||||| ||||||||||| Sbjct: 3358 ccaccattgatgatgtttgtgatgacgcc 3330
>emb|X15494.1|STCHITIN Potato endochitinase gene (EC 3.2.1.14) Length = 3281 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 259 ccattaatgatgttggtgatgacgccgtacccaggca 295 |||||||||||||| |||||||| ||| | ||||||| Sbjct: 2835 ccattaatgatgttcgtgatgacaccgaatccaggca 2799
>emb|X07130.1|STCHIT Solanum tuberosum mRNA for endochitinase (EC 3.2.1.14) Length = 1057 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 259 ccattaatgatgttggtgatgacgccgtacccaggca 295 |||||||||||||| |||||||| ||| | ||||||| Sbjct: 857 ccattaatgatgttcgtgatgacaccgaatccaggca 821
>emb|BX323068.15| Zebrafish DNA sequence from clone DKEYP-25A6 in linkage group 24, complete sequence Length = 156749 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 2 acaataaaaatattatttatt 22 ||||||||||||||||||||| Sbjct: 49073 acaataaaaatattatttatt 49093
>emb|BX470169.7| Zebrafish DNA sequence from clone DKEY-31P8 in linkage group 7, complete sequence Length = 222405 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 acaataaaaatattatttatt 22 ||||||||||||||||||||| Sbjct: 217787 acaataaaaatattatttatt 217767
>gb|DQ431248.1| Limonium bicolor class Ib chitinase mRNA, complete cds Length = 1107 Score = 42.1 bits (21), Expect = 1.4 Identities = 60/73 (82%) Strand = Plus / Minus Query: 262 ttaatgatgttggtgatgacgccgtacccaggcacccggccggcggcattgtcggcgccc 321 ||||| ||||| |||||||| ||||||||||| || | ||||| ||| |||| || | Sbjct: 838 ttaattatgttagtgatgactccgtacccaggaactcttccggccgcactgtcagctgac 779 Query: 322 gacggcgtccact 334 ||||||||||||| Sbjct: 778 gacggcgtccact 766
>gb|S44869.1| basic chitinase [Nicotiana tabacum=tobacco, cv Samsun nn, floral bud day 7 explant, mRNA, 1156 nt] Length = 1156 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgcc 284 |||||||| |||||||| ||||||||||| Sbjct: 834 ccaccattgatgatgtttgtgatgacgcc 806
>gb|DQ078282.1| Ulmus pumila chitinase (CHT) mRNA, complete cds Length = 954 Score = 42.1 bits (21), Expect = 1.4 Identities = 81/101 (80%) Strand = Plus / Minus Query: 187 tcacagtatcgcttgtagaacccaatccggtcaaccacctcggggttctgccccttcccg 246 |||||||| | ||||||||| |||||||| || |||||| || ||| || |||||| Sbjct: 869 tcacagtacctcttgtagaatccaatccgatcctccacctgaggaacctggcctttcccg 810 Query: 247 cactccctcccaccattaatgatgttggtgatgacgccgta 287 || || ||||||| || |||||||||||||| | |||||| Sbjct: 809 cattctatcccaccgttgatgatgttggtgatcatgccgta 769
>gb|AC160403.5| Mus musculus 10 BAC RP24-286J14 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 180869 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgtg 26 ||||||||||||||||||||| Sbjct: 82590 taaaaatattatttatttgtg 82570
>gb|AF135153.1|AF135153 Arabis parishii country USA class I chitinase gene, partial cds Length = 1205 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 301 ccggcggcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| |||||||| | |||||| |||||| || | |||||||||||| Sbjct: 1010 ccggcggcactgtcggcgtctgacggctgccactgcccagcgatcacggcgtg 958 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1180 caaaggacctttggttgtaacaatcaag 1153
>gb|AF135150.1|AF135150 Arabis microphylla country USA class I chitinase gene, partial cds Length = 1151 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 301 ccggcggcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| |||||||||| |||||| |||||| || |||||||||||| Sbjct: 956 ccggcggcactgtcggcgcctgacggctgccactgcccgacgatcacggcgtg 904
>gb|AF135147.1|AF135147 Arabis lignifera country USA class I chitinase gene, partial cds Length = 1151 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 301 ccggcggcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| |||||||||| |||||| |||||| || |||||||||||| Sbjct: 956 ccggcggcactgtcggcgcctgacggctgccactgcccgacgatcacggcgtg 904
>gb|AF135143.1|AF135143 Arabis lemmonii country USA class I chitinase gene, partial cds Length = 1446 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 301 ccggcggcattgtcggcgcccgacggcgtccactgacccgtgatcacggcgtg 353 ||||||||| |||||||| | |||||| |||||| || | |||||||||||| Sbjct: 1247 ccggcggcactgtcggcgtctgacggctgccactgcccagcgatcacggcgtg 1195
>emb|AL928670.6| Zebrafish DNA sequence from clone CH211-258F15, complete sequence Length = 167613 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 2 acaataaaaatattatttatt 22 ||||||||||||||||||||| Sbjct: 61671 acaataaaaatattatttatt 61691
>emb|BX927197.7| Zebrafish DNA sequence from clone DKEY-28F16 in linkage group 18, complete sequence Length = 70511 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 5 ataaaaatattatttatttgt 25 ||||||||||||||||||||| Sbjct: 55090 ataaaaatattatttatttgt 55110
>gb|AY613856.1| Oikopleura dioica clone BACOIKO008 5xo15, complete sequence Length = 174913 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttatttg 24 ||||||||||||||||||||| Sbjct: 19863 aataaaaatattatttatttg 19883
>emb|AM231412.1| Solanum tuberosum partial mRNA for putative endochitinase (chit1 gene) Length = 442 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgcc 284 |||||||| |||||||| ||||||||||| Sbjct: 378 ccaccattgatgatgtttgtgatgacgcc 350
>gb|AC166165.3| Mus musculus BAC clone RP23-381I17 from chromosome 10, complete sequence Length = 217425 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgtg 26 ||||||||||||||||||||| Sbjct: 130514 taaaaatattatttatttgtg 130494
>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds Length = 3169 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 |||||||| |||| || || |||||||||||||| || || |||| ||||||||||| Sbjct: 2380 ccgcactcgatcccgccgttgatgatgttggtgatcacaccaaacccgggcacccggcct 2321 Query: 304 gcggc 308 ||||| Sbjct: 2320 gcggc 2316
>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds Length = 998 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Minus Query: 244 ccgcactccctcccaccattaatgatgttggtgatgacgccgtacccaggcacccggccg 303 |||||||| |||| || || |||||||||||||| || || |||| ||||||||||| Sbjct: 743 ccgcactcgatcccgccgttgatgatgttggtgatcacaccaaacccgggcacccggcct 684 Query: 304 gcggc 308 ||||| Sbjct: 683 gcggc 679
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 302 cggcggcattgtcggcgccc 321 |||||||||||||||||||| Sbjct: 905631 cggcggcattgtcggcgccc 905612
>gb|BC059438.1| Danio rerio zgc:73060, mRNA (cDNA clone MGC:73060 IMAGE:4144241), complete cds Length = 2682 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tttatttgtgatcacactta 36 |||||||||||||||||||| Sbjct: 1961 tttatttgtgatcacactta 1980
>gb|AC129023.4| Mus musculus BAC clone RP23-430E12 from chromosome 18, complete sequence Length = 185832 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 aacaataaaaatattattta 20 |||||||||||||||||||| Sbjct: 150764 aacaataaaaatattattta 150783
>gb|AC117072.3| Dictyostelium discoideum chromosome 2 map 3879572-4071762 strain AX4, complete sequence Length = 192187 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 23249 aataaaaatattatttattt 23268
>gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124-6045772 strain AX4, complete sequence Length = 183648 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 32285 aataaaaatattatttattt 32266
>ref|XM_847793.1| PREDICTED: Canis familiaris similar to olfactory receptor Olr1582 (LOC488626), mRNA Length = 936 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 tgttcgcctgagccgtcacc 384 |||||||||||||||||||| Sbjct: 147 tgttcgcctgagccgtcacc 166
>emb|CR450831.4| Zebrafish DNA sequence from clone CH211-79O8 in linkage group 11, complete sequence Length = 190163 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 154557 aataaaaatattatttattt 154576
>gb|AC114008.5| Mus musculus BAC clone RP23-198A16 from chromosome 15, complete sequence Length = 202835 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgt 25 |||||||||||||||||||| Sbjct: 108857 taaaaatattatttatttgt 108838
>gb|AC142338.1| Pan troglodytes BAC clone RP43-41H4 from 7, complete sequence Length = 186208 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ttaatgatgttggtgatgac 281 |||||||||||||||||||| Sbjct: 118403 ttaatgatgttggtgatgac 118384
>gb|AC150706.4| Medicago truncatula clone mth2-132l18, complete sequence Length = 105472 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 aaaatattatttatttgtga 27 |||||||||||||||||||| Sbjct: 53985 aaaatattatttatttgtga 53966
>gb|CP000107.1| Ehrlichia canis str. Jake, complete genome Length = 1315030 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 2 acaataaaaatattatttat 21 |||||||||||||||||||| Sbjct: 495616 acaataaaaatattatttat 495597
>emb|CR450821.7| Zebrafish DNA sequence from clone CH211-156B7 in linkage group 3, complete sequence Length = 163751 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 135415 aataaaaatattatttattt 135434
>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence Length = 3281944 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 caccattaatgatgttggtg 276 |||||||||||||||||||| Sbjct: 2057183 caccattaatgatgttggtg 2057202
>emb|AL354709.15| Human DNA sequence from clone RP11-145E5 on chromosome 9 Contains the 5' end of the CDKN2B gene for cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4), a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) (RPL40) pseudogene, the 3' end of a variant of the MTAP gene for methylthioadenosine phosphorylase (MSAP), a novel gene and a CpG island, complete sequence Length = 157533 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 aaaaatattatttatttgtg 26 |||||||||||||||||||| Sbjct: 36609 aaaaatattatttatttgtg 36628
>gb|AE017159.1| Chlamydophila pneumoniae TW-183, section 3 of 4 of the complete genome Length = 300066 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 209678 aataaaaatattatttattt 209697
>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the 3' end of the TACC2 gene for transforming, acidic coiled-coil containing protein 2 (AZU-1), the gene for a novel protein (FLJ25359) and two CpG islands, complete sequence Length = 213861 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 aacaataaaaatattattta 20 |||||||||||||||||||| Sbjct: 133748 aacaataaaaatattattta 133729
>gb|DQ124037.1| Coffea arabica clone MN-SSH4-E01 mRNA sequence Length = 295 Score = 40.1 bits (20), Expect = 5.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 256 ccaccattaatgatgttggtgatgacgccgta 287 ||||| ||||| |||||||||||||| ||||| Sbjct: 274 ccaccgttaataatgttggtgatgaccccgta 243
>emb|AL929354.1|PFA929354 Plasmodium falciparum strain 3D7, chromosome 5, segment 4/4 Length = 340552 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 116772 aataaaaatattatttattt 116753
>emb|AL162752.2|NMA1Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 1/7 Length = 340806 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 gccggcggcattgtcggcgc 319 |||||||||||||||||||| Sbjct: 211242 gccggcggcattgtcggcgc 211261
>emb|BX908782.7| Zebrafish DNA sequence from clone DKEY-6E4 in linkage group 2, complete sequence Length = 196309 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 36803 aataaaaatattatttattt 36784
>ref|NM_200698.1| Danio rerio zgc:73060 (zgc:73060), mRNA Length = 2682 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tttatttgtgatcacactta 36 |||||||||||||||||||| Sbjct: 1961 tttatttgtgatcacactta 1980
>gb|AC020923.9| Homo sapiens chromosome 5 clone CTD-2123J17, complete sequence Length = 159973 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 4 aataaaaatattatttatttgtga 27 ||||||||||| |||||||||||| Sbjct: 146901 aataaaaatatcatttatttgtga 146924
>gb|AC099040.10| Oryza sativa chromosome 10 BAC OSJNBa0004P12 genomic sequence, complete sequence Length = 137029 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 taaaaatattatttatttgt 25 |||||||||||||||||||| Sbjct: 34416 taaaaatattatttatttgt 34397
>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence Length = 3354505 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 caccattaatgatgttggtg 276 |||||||||||||||||||| Sbjct: 2410256 caccattaatgatgttggtg 2410237
>gb|AC024086.5| Homo sapiens chromosome 7 clone RP11-242F21, complete sequence Length = 153232 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ttaatgatgttggtgatgac 281 |||||||||||||||||||| Sbjct: 99629 ttaatgatgttggtgatgac 99610
>gb|AC145591.5| Mus musculus BAC clone RP24-176N2 from chromosome 18, complete sequence Length = 167532 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 aaatattatttatttgtgat 28 |||||||||||||||||||| Sbjct: 61358 aaatattatttatttgtgat 61339
>ref|XM_697236.1| PREDICTED: Danio rerio hypothetical protein LOC554868 (LOC554868), mRNA Length = 1650 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tttatttgtgatcacactta 36 |||||||||||||||||||| Sbjct: 947 tttatttgtgatcacactta 966
>gb|AE002161.1| Chlamydophila pneumoniae AR39, complete genome Length = 1229853 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 28031 aataaaaatattatttattt 28012
>emb|BX649300.4| Zebrafish DNA sequence from clone CH211-195I16 in linkage group 23, complete sequence Length = 202963 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 1 aacaataaaaatattatttatttg 24 |||||||||||||||| ||||||| Sbjct: 126644 aacaataaaaatattaattatttg 126667
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence Length = 220673 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 aaaatattatttatttgtga 27 |||||||||||||||||||| Sbjct: 202875 aaaatattatttatttgtga 202856
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome Length = 2272360 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 gccggcggcattgtcggcgc 319 |||||||||||||||||||| Sbjct: 2249693 gccggcggcattgtcggcgc 2249712
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 aaaatattatttatttgtga 27 |||||||||||||||||||| Sbjct: 21528082 aaaatattatttatttgtga 21528101
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 27874334 aataaaaatattatttattt 27874315
>gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, complete sequence Length = 185124 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ttaatgatgttggtgatgac 281 |||||||||||||||||||| Sbjct: 96034 ttaatgatgttggtgatgac 96015
>gb|AE001363.1| Chlamydophila pneumoniae CWL029, complete genome Length = 1230230 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 813554 aataaaaatattatttattt 813573
>gb|AF135151.1|AF135151 Arabis microphylla country USA class I chitinase gene, partial cds Length = 1143 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1118 caaaggacctttggttgtaacaatcaag 1091
>gb|AF135149.1|AF135149 Arabis microphylla class I chitinase gene, partial cds Length = 1266 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1241 caaaggacctttggttgtaacaatcaag 1214
>gb|AF135146.1|AF135146 Arabis lignifera country USA class I chitinase gene, partial cds Length = 1358 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1333 caaaggacctttggttgtaacaatcaag 1306
>gb|AF135145.1|AF135145 Arabis lignifera country USA class I chitinase gene, partial cds Length = 1460 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1435 caaaggacctttggttgtaacaatcaag 1408
>gb|AF135142.1|AF135142 Halimolobos perplexa var. perplexa class I chitinase gene, partial cds Length = 1617 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1592 caaaggacctttggttgtaacaatcaag 1565
>gb|AF135140.1|AF135140 Arabis glabra country USA class I chitinase gene, partial cds Length = 1295 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1266 caaaggacctttggttgtaacaatcaag 1239
>gb|AF135136.1|AF135136 Arabis fecunda country USA class I chitinase gene, partial cds Length = 1444 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1415 caaaggacctttggttgtaacaatcaag 1388
>gb|AF135134.1|AF135134 Arabis blepharophylla class I chitinase gene, partial cds Length = 1201 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 131 caaaggacctttggttgtagcagtcaag 158 ||||||||||||||||||| || ||||| Sbjct: 1176 caaaggacctttggttgtaacaatcaag 1149
>dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1144G04 Length = 194459 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 61015 aataaaaatattatttattt 60996
>dbj|BA000008.3| Chlamydophila pneumoniae J138 genomic DNA, complete sequence Length = 1226565 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 812875 aataaaaatattatttattt 812894
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 aaaatattatttatttgtga 27 |||||||||||||||||||| Sbjct: 65866 aaaatattatttatttgtga 65885
>emb|CR933768.7| Zebrafish DNA sequence from clone CH211-176D22 in linkage group 19, complete sequence Length = 50629 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 aataaaaatattatttattt 23 |||||||||||||||||||| Sbjct: 26819 aataaaaatattatttattt 26800
>emb|CR855860.7| Zebrafish DNA sequence from clone CH211-239D6 in linkage group 19, complete sequence Length = 90948 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 tttatttgtgatcacactta 36 |||||||||||||||||||| Sbjct: 6729 tttatttgtgatcacactta 6710 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,702,637 Number of Sequences: 3902068 Number of extensions: 3702637 Number of successful extensions: 92123 Number of sequences better than 10.0: 256 Number of HSP's better than 10.0 without gapping: 257 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 91099 Number of HSP's gapped (non-prelim): 993 length of query: 401 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 379 effective length of database: 17,147,199,772 effective search space: 6498788713588 effective search space used: 6498788713588 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
